1. Environmental scientists have become concerned that Maryland's
precipitation is too far from neutral to be safe for healthy aquatic
ecosystems. What property of water would they test?

Answers

Answer 1

Answer:

pH

Explanation:

The pH of a solution refers to the acidity or alkalinity of the solution. The solubility of some ions that are dissolved in a water body depends on the pH of the water. Sudden changes in pH could lead to sudden precipitation of substances from the water.

Hence, Maryland's precipitation may be monitored by environmentalists if they can observe the pH of the water in the course of searching for the possible cause of the precipitation occurring in the water body.


Related Questions

DNA acts as a _____________ for living things
A. map

B. blueprint

Answers

Answer:

A. map

Explanation:

DNA acts as a map for living things.

what is photo synthesis?​

Answers

Answer:

The process autotrophs (plants) use to create food. they convert CO2 (Carbon Dioxide) and H2O (Water) into O2 (Oxygen) and glucose (sugar).

Answer:

photo synthesis is the green plants which making other organisms to convert engry into chemical

The similarity of the structures shown in the picture suggests that the organisms_______

1) have a common ancestor
2) all grew at different rates
3) live for a long time
4) evolved slowly

Answers

1 because they all had traits that had come form somthing

Which organism in the food web below is likely to store the most energy?
boa constrictor
beetle
coati
poison dart frog
sloth
strangler fig
fungus
fruit bat
A. Strangler fig
B. Boa constrictor
C. Beetle
D. Poison dart frog

Answers

Answer:

Beatle

Explanation:

Beetle in the food web below is likely to store the most energy. So, the correct option is (C).

What is Food Web?

A food web is defined as the natural interconnection of food chains and is a graphical representation of what-eats in an ecological community. Food web is also known as consumer-resource system.

A food web consists of many food chains while a food chain follows only one path as animals find food. For example, Falcon eats snake, which has eaten frog, which has eaten grasshopper, which has eaten grass. Thi shows the many different pathways that plants and animals are connected.

In this, the lower trophic level organisms have more energy than the upper trophic level because only 10% of the energy flows from one trophic level to the next. In the above case, beetles have the highest energy compared to other organisms.

Thus, Beetle in the food web below is likely to store the most energy. So, the correct option is (C).

Learn more about Food Web, here:

https://brainly.com/question/18816028

#SPJ2

What is the function of the Sebaceous Gland * To produce Sweat
To produce water
To produce natural oils for the skin protection None of the Above​

Answers

Answer:

To produce natural oils for the skin

Explanation:

The normal function of sebaceous glands is to produce and secrete sebum, a group of complex oils including triglycerides and fatty acid breakdown products, wax esters, squalene, cholesterol esters and cholesterol.

Sebum lubricates the skin to protect against friction and makes it more impervious to moisture


1. Osmosis and diffusion are same phenomena.​

Answers

Answer:

they are not the same thing. Osmosis is only for water molecules. i found this, hope it is useful,'Osmosis happens when molecules move from higher to lower concentrations, but diffusion happens when it is reversed'

Explanation:

Answer:

Explanation:

Not the same

What is anatomy?

Simple answer please!
I'll give brainlist

Answers

Answer:

Anatomy is the study of the bodies of people and other animals

hope this helps

have a good day :)

Explanation:

Anatomy is the branch of biology concerned with the study of the structure of organisms and their parts. Anatomy is a branch of natural science which deals with the structural organization of living things. It is an old science, having its beginnings in prehistoric times.

In 2012, excitement rippled through the scientific community with the discovery of an enzyme that appeared to be, just maybe, a powerful new tool for combating Alzheimer’s. At the Mayo Clinic in Florida researchers identified a gene, BACE2, which appeared to destroy beta-amyloid — a protein, then understood to be toxic, which is found in clusters in the brains of people living with Alzheimer’s. Alzheimer's is often diagnosed by measuring the amount of buildup of this protein. A large amount of it is an indicator of the disease. People with this buildup often do not have enough of the BACE2 enzyme created naturally in their body. If a way to synthesize this enzyme artificially or to prompt the body to create more were discovered, it could be hailed as a cure for Alzheimer's. How does the BACE2 enzyme work?

Answers

Answer:

BACE2 cuts both beta-amyloid and beta-amyloid precursor protein.

Explanation:

What makes BACE2 so effective in fighting Alzheimer's is its efficiency in cutting both beta-amyloid and the protein that develops it. There are other enzymes, which have the ability to break down beta-amyloid, but BACE2 is the only one that breaks it down into such small pieces that it completely destroys it. Furthermore, BACE2 is able to break down the beta-amyloid precursor protein, which prevents the formation of beta-amyloid from taking place.

2. The formation of male and female sex cells is known as
A) gametogenesis
B) budding
C) sporulation
D) regeneration

Answers

Answer:

A . the formation of male and female sex cell is known as gametogenesis

the answer is a (gametogenesis)

Identify the main floral organs
of a flower.

Answers

petals, sepals, stamen, and carpel

Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts ​

Answers

Answer:

Name one waste substance the coronary veins will remove.

…………………………………………………………………………………………………..……………………

Which of the following is NOT an example of natural selection? *
A. Plants with thorns are less likely to be eaten by herbivores than other members of the same species that lack thorns.

B. Bacterial populations in hospitals develop resistance to drugs used to combat infection by them.

C. Scientists breed cows that give greater amounts of milk than their ancestors.

D. Fruit fly larvae with an enzyme to break down alcohol are better able to feed on fermenting fruit than those that lack the enzyme.

E. Female fish that produce more eggs leave more offspring than those that produce fewer eggs.

Answers

Answer:

The Answer is C

Explanation:

When scientists breed cows to produce more milk, this has not occured naturally and thus is not natural selection.

Answer:

C. Scientists breed cows that give greater amounts of milk than their ancestors.

Explanation:

The scientists breed cows that give greater amounts of milk than their ancestors is not an example of natural selection. So, option (C) is correct.

¿A que evidencia de la evolucion hacen referencia los arboles evolutivos? A.Embriologia B.Regristro fosil C.Distribucion geografica D.Grupos taxonomicos E.Anatomia comparada

Answers

Answer:

D.Grupos taxonomicos

Explanation:

Un árbol evolutivo muestra la relación entre los organismos biológicos a medida que evolucionan a partir de un ancestro común.

Los árboles evolutivos indican que las especies a menudo comparten un ancestro común.

El árbol evolutivo muestra la relación entre los grupos taxonómicos a medida que avanza el proceso de evolución.


Which organism, roadrunner or the owl, competes more for its food?
Support your answer with evidence from the food web.

Answers

The roadrunner and the owl are both predators and compete for similar prey, such as small mammals, birds, reptiles, and insects. However, the extent to which they compete for food depends on various factors such as their habitat, size, behavior, and hunting techniques.

What do you mean by predators ?

Predators are animals that hunt, kill, and consume other animals (known as prey) for their sustenance. Predation is a common form of interaction between different species in many ecosystems. Predators come in many different forms, such as mammals, birds, fish, insects, and reptiles.

Predators are typically characterized by certain physical and behavioral adaptations that help them hunt and capture prey. For example, many predators have sharp teeth, claws, or beaks that are used to kill and consume their prey. Others may have specialized hunting techniques or strategies that make them highly effective predators.

The roadrunner and the owl are both predators and compete for similar prey, such as small mammals, birds, reptiles, and insects. However, the extent to which they compete for food depends on various factors such as their habitat, size, behavior, and hunting techniques.

Roadrunners are known to be opportunistic hunters and can feed on a wide range of prey items. They are ground-dwelling birds and use their speed and agility to catch their prey. Roadrunners are also known to eat eggs and young of other birds, including owls.

Owls, on the other hand, are nocturnal predators that are known for their exceptional hearing and vision, which enables them to hunt in low light conditions. They are also skilled hunters and can catch a variety of prey, including rodents, small mammals, and birds.

Therefore, both roadrunners and owls are capable of competing for food, but the level of competition depends on the availability of prey, habitat, and other factors. In general, the competition between these two species is likely to be limited, as roadrunners are diurnal (active during the day) and owls are nocturnal (active at night).

Learn more about  predators click here:

https://brainly.com/question/29779690

#SPJ1

How has the human population grown in the last 200 years? Why has human population growth accelerated in the last 200 years?

Answers

Answer:

1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world.  2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet.

Explanation:

Answer:

1. The size and growth rate of the human population has changed in the past 200 years because reproduction rates have increased due to the large number of people in the world.  2. Human population has grown exponentially over the past century. It has done so largely by producing large amounts of food, and learning how to control disease. Ten thousand years ago, when humans first invented agriculture, there were maybe one million humans on the planet

Explanation:

When the homologous chromosomes align at the equator and then separate during meiosis I, they do so randomly. This event supports Mendel’s Law of

Answers

This supports the theory or mendal law of evolution bc the chromosomes Are aligned together

A 9.0 is how many times more powerful than a
4.0 on the Richter scale?

Answers

Answer:

It increases 31.7 times between whole number

values.

Explanation:

"That is, the wave amplitude in a level 6 earthquake is 10 times greater than in a level 5 earthquake, and the amplitude increases 100 times between a level 7 earthquake and a level 9 earthquake."

Which statement is true about gene expression? Give brainlist is answer right

Cells become specialized because different cells contain different sets of genes

Gene expression occurs primarily when DNA is replicated before the process of mitosis
The DNA of repressed genes gets destroyed because it is not being used

A cell becomes specialized by controlling the which proteins are produced from the cell's DNA

Answers

Answer:

I guess All of them

Explanation:

Gene expression has all of these statements as given above in text.

what are the four primary uses or benefits of the nguni breed amongst South African communities?​

Answers

Answer:

Utility: The Nguni cattle are used for milk and meat; their socio-cultural functions are also important. The body conformation of the Nguni is more of a dairy than beef type but it is principally used for beef production and for work.

Explanation:

5.
Name three factors that may affect the carrying capacity of the population. (3 points)

Answers

Carrying capacity, or the maximum number of individuals that an environment can sustain over time without destroying or degrading the environment, is determined by a few key factors: food availability, water, and space.

I hope this helped.

Which sample formed from the solidification of lava near Earth's surface

Answers

Answer: Granite and Basalt


Explanation: Igneous rocks (from the Latin word for fire) form when hot, molten rock crystallizes and solidifies. The melt originates deep within the Earth near active plate boundaries or hot spots, then rises toward the surface. So in this case it would be Granite and Basalt

Homologous structures, or shared detailed structures, shows us that we are _____.
A. unrelated organisms

B. bacteria

C. aliens

D. related

Answers

Answer:

Hi, there the answer is D. related

Explanation:

Homologous structures are similar structures in related organisms.

Hope This Helps :)

Answer:

it is d i think

Explanation:

sources of potassium for plants​

Answers

Answer:

mined rock powders and wood ash.

Explanation:

Fossils show that some of those extinct organisms evolved into organisms that survived today like _____.
A. ants

B. humans

C. wolves

D. birds

Answers

Answer:

c wolves would be your Excellent answer

Answer:

D. birds

Explanation:

Fossils show that some of those extinct organisms evolved into organisms that survived today like birds.

Which of the following is a subsystem of an organism?

Answers

You didn’t post all of it

helpp mee pleaseeee need help

Answers

Answer: it will increase the frequency of the action potential hope this helps

Explanation:

In your own words, can you explain where a hot
spot can be found AND what does it looks like?

Answers

Answer:

well for one you can find a lot for examples like if the light of a blazing hot sun was reflecting on a wooden stick the spot where the sun is reflecting would have a red mark with smoke comming out the stop

what do you mean by mental labour​

Answers

Answer: Mental Labour, According to this definition, mental work refers to planning, organizing, coordinating, and managing duties and tasks that we perform during the course of our lives. People's worries about their ability to manage their time efficiently and effectively.

Explanation:

I explained at the top-

Which process comes first in the process of protein synthesis?
A. Transcription

B. Translation

Answers

Answer:

A. Transcription

Explanation:

Transcription comes first in the process of protein synthesis.

Answer:

A.Transcription

Explanation:

Transcription is the process of making an RNA copy of a gene sequence. This copy, called a messenger RNA (mRNA) molecule, leaves the cell nucleus and enters the cytoplasm, where it directs the synthesis of the protein, which it encodes.

Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.

Other Questions
HELP ME OUT ASAP WILL GIVE BRAINLIEST!!!! ASAP HELP NECESITO AYUDA URGENTE...1- Ordena en forma descendente el siguiente polinomio con respecto a lavariable n. Luego identifica el trmino independiente:6n 3 + 7n 4 -2n 2 -5 + 9n 52- Completa el polinomio para que cada trmino tenga el mismo gradoabsoluto:5x 4 y 3 3x 6 ___ + 5x 2 4__ + 7___ y 2 + 8y 7 - 63- Observa el siguiente polinomio e identifica cules son los trminossemejantes:-8 + 3m 3 n 4m 2 n + 7mn 2 -11nm 3 + 5 + 6m 2 n4- Evala la veracidad de cada afirmacin de la siguiente afirmacin:El grado absoluto de un polinomio no puede ser 1: ___________5- El grado absoluto de un polinomio se obtiene sumando los grados relativosde las variables: __________6- El grado absoluto de un binomio puede ser cero: __________7- Si el grado relativo de una variable es tres, entonces, el grado absoluto esun nmero mayor que tres: __________8- Si el grado absoluto de un trmino es uno. Entonces, el polinomio tiene unasola variable: ___________9- Completa el polinomio, luego ordnalo en forma descendente:15x 4 + 5x 6 + 3x 3 + 2x 2 + 8 + +10- Cul es el valor numrico del siguiente polinomio cuando la x = -2 ; y= -3: 3x 2 y 5xy 2 + x -3y + 2 Write a C class, Flower, that has three member variables of type string, int, and float, which respectively represent the name of the flower, its number of pedals, and price. Your class must include a constructor method that initializes each variable to an appropriate value, and your class should include functions for setting the value of each type, and getting the value of each type. hi guys, which one do u think is correct: It then eats its own eggshell before it starts eating and growing. orIt then eats its own eggshell before to start eating and growing. orIt then eats its own eggshell before starting to eat and grow. tnx A variable expression cannot consist of numbers or operstions. true false using factoring what is the solution to the equation 2x^2+3x-5=0 Help is appreciated:) 3. Simplify, 27+3]{14-3(15-5) -53-51-19 HII TYSM IF YOU ANSWER ILL GIVE BRAINLIEST did I get some of these right? if not lmk :) Please help thank you! 18.Which of the following are the coordinates of the vertex of y= x2 - 10x + 2?A. (5, 23)B. (10, 2)C. (5, 23)D. (2, 10) What is the slope of the line that contains the points (-2, 5) and (6, -3)? 7 degrees per millisecond converted to 7 degrees per second Elena is going to a farmer's market for fresh produce. She has two markets tochoose from and hopes to buy both cherries and asparagus. The table showsthe probability that each type of produce will be available at the markets.North marketSouth marketCherries0.60.5Asparagus0.850.84Assuming that the availability of cherries and the availability of asparagus areindependent of each other, which market should Elena choose to maximizeher chance of buying both?A. South market. There is a 0.42 probability of both cherries andasparagus being available.B. North market. There is a 0.3 probability of both cherries andasparagus being available.c. South market. There is a 0.3 probability of both cherries andasparagus being available.D. North market. There is a 0.51 probability of both cherries andasparagus being available. Three or more notes played in harmony is termed aA. chord retrogressionB. chord progressionC. chord symbolD. chord Find the volume of the prism. You hear the dishwasher with a loudness of 40 dB and a siren outsidewith a loudness of 60 dB. How much greater is the amplitude of thesiren's sound than the amplitude of the dishwasher's sound? Convert 6 qt/min to gallons per hour Exercise 5.2Which of the capital letters of the English alphabet are symmetrical? 6 Factorisex2 + 6x -7