10. What are examples of antisemitism today?
• In your local community?
•State community?
• In the United States ?
• On a website or on social media?

10. What Are Examples Of Antisemitism Today? In Your Local Community?State Community? In The United States

Answers

Answer 1
In your community: people not catering and being supportive of everyone during the holidays
State community: states not requiring adequate WW2 history in class
In the us: disrespect at synagogue, or general anti Semitic speech from politicians (ex: making fun of nose)
Social media: Aryan look being promoted, still ingrained in the mind that blue eyes and blonde hair are what make someone beautiful. This was promoted by hitler in ww2

Related Questions

For government systems like those in Communist China in the 1950s and the Khmer Rouge in Cambodia to cause genocide in their own populations requires a (4 points)

disregard for the needs and rights of the individual
lack of a central government and a weak military
lack of opportunity for the middle class
vast network of city states that can be controlled

Answers

Answer:

Woah haven’t learn this yet I’m so sorry!!

Explanation:

So sorry:( !!!

Answer:

Disregard for the needs and rights of the individual

Explanation:

Hope it help

Mark brainliest

What was the purpose of the Black Hand group
that formed in Serbia after the Bosnian Crisis of
1908?

Answers

Answer:

The purpose of the group was to liberate Serbs under the Austro-Hungarian occupation. They also undertook anti-Austrian propaganda and organized spies and saboteurs to operate within the occupied provinces. Satellite groups were formed in Slovenia, Bosnia, Herzegovina and Istria.

Explanation:

"When is war justified?"

Answers

Protecting innocent life from harm should be the main justification for going to war and recovering stolen property. punishing those who have committed crimes.

What is a war?

War is commonly understood to be an aggressive confrontation involving states or countries. Various factors can cause nations to engage in war. It has been stated that a country will engage in war if it believes the gains of war exceed the drawbacks and in the absence of an alternative.

Wars that are undertaken to halt the rise of a morally reprehensible power are justified even though they are eradicating an evil that might eventually bring misery to a larger population. War for self-defense can indeed be justified against since doing so leaves you open to attack.

Learn more about war, Here:

https://brainly.com/question/3445478

#SPJ1

Need help with these questions!!

Answers

Answer:

I don't really know sorry. Please read under here though!

Explanation:

Hope you have/ had a great day! Also a great Happy New Year! Bye! Please answer my question! And i will find one of yours to actually answer! bye!

3. Which problems did the Islamic Missionaries face in East Africa?

Answers

As in North Africa, trade was a powerful strand in the conversion of people to Islam. East Africa offered gold, ivory and slaves, and later on very fine woven cotton. In return, traders from the East and Persian Gulf brought textiles, spices, porcelain and other finished goods.

how did the colonists express their discontent

Answers

Answer:

I wrote ALOT sorry.

Explanation:

On March 5, 1770, a group of colonists—mostly youths and dockworkers—surrounded some soldiers in front

of the State House. Soon, the two groups

began trading insults, shouting at each

other and even throwing snowballs.

As the crowd grew larger, the soldiers

began to fear for their safety. Thinking

they were about to be attacked, the soldiers fired into the crowd. Five people,

including Crispus Attucks, were killed.

The people of Boston were outraged

at what came to be known as the Boston

Massacre. In the weeks that followed, the

colonies were flooded with anti-British

propaganda in newspapers, pamphlets,

and political posters. Attucks and the

four victims were depicted as heroes

who had given their lives for the cause

of freedom. The British soldiers, on the other hand, were portrayed as evil

and menacing villains.

At the same time, the soldiers who had fired the shots were arrested and

charged with murder. John Adams John Adams, a lawyer and cousin of Samuel Adams,

agreed to defend the soldiers in court. Many people criticized Adams and

some even threatened to harm the lawyer. But Adams believed that everyone—including the British soldiers—was entitled to a fair trial. Although

Adams supported the colonists’ cause, he wanted to demonstrate that everyone was subject to the rule of law.

Adams argued that the soldiers had acted in self-defense. The jury agreed

and acquitted the soldiers. To many colonists, however, the Boston Massacre

would stand as a symbol of British tyranny in the colonies.

 

In April 1770, Parliament repealed the Townshend Acts. Once again, the

colonial boycott had worked—British trade had been hurt and Parliament

had backed down. But Parliament kept the tea tax to show that it still had

the right to tax the colonists.

The Tea Act Increases Anger To demonstrate their displeasure with the

remaining tax on tea, many colonists chose not to purchase luxuries from

British merchants. Instead, they drank tea that was smuggled from Holland.

As a result, many British tea companies lost money in America as their tea

went unsold and rotted in ports.

Answer:

The colonists showed their discontent by dumping tea boxes into the water during the Boston Tea Party.  

Explanation:

The colonists didn't want to be taxed on tea.

Please answer it’s timed and my grade depends on it depends on it WILL MARK BRAINLIST

Which of these are among Washington’s top five manufacturing export industries? Check all that apply.
O aerospace
O automobiles
O control instruments
O fruit and vegetable Preserves
O textiles and clothing

Answers

Answer:

aerospace

control instruments

fruit and vegetable preserves

Explanation:

Aerospace, control instruments, and the fruit and vegetable preserves of these are among Washington’s top five manufacturing export industries. Thus, option (a), (c), and the (d) is correct.

What is industries?

The term industries refer to the factory are the manufacturing of the product. The production of the goods making. The process of the raw material are the converted into the finished goods. The labour are the performing the work. The industry are the important part of the economy.

According to the Washington’s, are the support on the five manufacturing industries are aerospace, control instruments, and the fruit and vegetable Preserves. Aerospace was the related to the transportation equipment. Agriculture/food manufacturing are the depend on the perishable goods. The instruments are the related to the equipment of the technology.

As a result, the aerospace, control instruments, and the fruit and vegetable preserves of these are among Washington’s top five manufacturing export industries. Therefore, option (a), (c), and the (d) is correct.

Learn more about on industries, here:

https://brainly.com/question/7721379

#SPJ2

SOMEONE PLEASE HELP ASAPPPPPPPP!!!!!!!!! IF YOU ANSWER THIS CORRECTLY I WILL GIVE YOU A GREAT RATE AND MAKE YOU THE BRAINLIEST I SWEAR JUST PLEASE ANSWER THIS CORRECTLY ASAP!!!!!!!!!!!!!

Answers

I would say B

Hope I helped

“our future lies upon the ocean...”
- Kaiser Wilhelm II, German leader

read the quote from the ruler of Germany, Kaiser Wilhelm II. what does this quote imply about the importance of a country having a strong navy?

Answers

Answer:

As modern technology allowed warships to be built it was extremely important to keep other navies in check.

Explanation:

The geography of the German Empire and even still today shows their main water access lies within the Baltic Ocean. If Germany was at war with no navy, countries like Britain can easily put a naval blockade on German merchant/ cargo ships. This would hurt the German economy severely and would not allow them to import natural resources from their colonies or trading partners across seas. It is important to have a navy to intimidate other countries at war that want to either, naval invade, economic blockade, or bombarded the country. Also referring to colonies, it would be extremely difficult to expand one's empire without any sea access if the enemy navy is superior.

When Georgions on the home front read about the Pacific Theater during World War II, they were reading about the
goal of defeating
Germany
Japan
China
Italy

Answers

Answer:

Goal of defeating.

Explanation:

To me I truth B Japan

Where did most African slaves end up working? What did they farm?

Answers

Answer:

The Southern States; Primarily Cotton, also a lot of tobbacco.

They also worked in Louisiana and farmed sugar cane

Answer:

Most African slaves worked in the Southern states and on plantations

Explanation:

On the plantations they would farm tobacco, cotton, sugar cane, olives, grapes, sugar, coffee, rice etc.

they would work for long periods during the day

take care

-kitten

how long did charles darwins adventure take

Answers

Answer:

three years and 3 months on land and 18 months at sea

Explanation:

2) When did the appointees by John Adams become valid?

Answers

Answer: The Act became law on February 13, 1801

Explanation:

The Act became law on February 13, 1801 did the appointees by John Adams become valid.

Who was John Adams?

After serving as George Washington's first Vice President, John Adams, a notable political philosopher, was elected as the second president of the United States. John Adams was a learned and perceptive man who was more notable as a political philosopher than as a politician.

John Adams has not historically been regarded as one of the greatest presidents of the United States based on the aforementioned standards. Adams' 1800 reelection campaign, which he lost to Thomas Jefferson, making him the country's first one-term leader, is largely responsible for the criticism that still exists today.

Adams was a passionate talker, and Washington was a focused listener. The two men frequently shared meals together. Adams, who held Washington in high regard, campaigned for Congress in 1775.

Thus, The Act became law on February 13, 1801

For more information about John Adams, click here:

https://brainly.com/question/12416301

#SPJ6

The Republican party would likely oppose all of the following causes EXCEPT:
A.
lower taxes for the wealthy
B.
more government intervention
C.
less power to the states
D.
shrinking the military

Answers

Answer:

lower taxes for the wealthy

Answer:

A

Explanation:

Took the test


The 6th Amendment gives you the right to a speedy trial. Meaning that after you are
charged with a crime, the government must allow you to go to court within a certain
amount of time.
The case of Barker vs Wingo set the time of a speedy trial to be set at about
a _after being charged with a crime.

Please help

Answers

Answer:

The case of Barker vs Wingo set the time of a speedy trial to be set at about a FIVE years after being charged with a crime.

The 6th Amendment gives you the right to a speedy trial and its meaning is explained below in detail.

Explanation:

In all criminal pursuits, the summoned shall possess the right to a rapid and public prosecution, by an unbiased tribunal of the case and district wherein the offense shall have been perpetrated, which district shall have been beforehand determined by law, and be notified of the nature and cause of the complaint.

What was the Haitian Revolution and how did it affect the United States?

Answers

Answer:

The Haitian revolution came to North American shores in the form of a refugee crisis. In 1793, competing factions battled for control of the then-capital of St. Domingue, Cap-Français (now Cap-Haïtien.) The fighting and ensuing fire destroyed much of the capital, and refugees piled into ships anchored in the harbor. The Haitian Revolution and the subsequent emancipation of Haiti as an independent state provoked mixed reactions in the United States. This led to uneasiness in the US, instilling fears of racial instability on its own soil and possible problems with foreign relations and trade between the two countries.

Explanation:

i have to fill this thing out for class, what's something to look forward to in world history?

Answers

Answer:

While history may seem like a class with no practical function in the business world, it actually provides management lessons and insight. History analyzes past events and how they shaped the world today. By understanding various aspects of the past, you’ll be prepared to integrate with people of different backgrounds and cultural heritage. This is especially useful when managing a group of diverse people.

yeh lol but I’d honestly look forward to being done with the classs

PLZ HELP MEEE!!!! How long are most personal vision statements?

one to thirty words long
thirty to one hundred words long
one hundred to two hundred words long
more than two hundred words long

Answers

Answer:

B. Thirty to one hundred words long

Explanation:

Just did this question on a assignment

Hope this helps :)

Answer:

b

Explanation:

just did it

What was the primary purpose of Wilson's Fourteen Points?

Answers

Answer:

Explanation:

Fueron una serie de propuestas realizadas el 8 de enero de 1918

Por el presidente estadounidense Wilson

Para crear unos nuevos objetivos bélicos defendibles moralmente para la Triple Entente que pudiesen servir de base para las negociaciones de paz de los imperios centrales

• Limited government interference in business
• Prices determined by supply and demand
• Private owners receive the profits
Which type of economy is best described by these characteristics?
a.
Subsistence farming
b. Free enterprise
c. Mercantilism
d. Socialism

Answers

A is the correct answer

Answer: A

Explanation:

Which president never got to live in the White House?
A Washington
B. Adams
C. Jefferson
D. Madison
E. Monroe

Answers

Answer:

Madison

Explanation:

he or she was bever ib the

Answer:

George Washington.

Explanation:

G.Washington ended his career before the Federal government moved from Philadelphia to Washing DC

Rather than go to war with the British in 1807, Jefferson passed the unpopular __________________ to prohibit trade with Britain, France, and their colonies.
a.
Townsend Acts
c.
Navigation Acts
b.
Embargo Act
d.
Nonintercourse Act

Answers

Answer:

Embargo act

Explanation:

Analyze the illustration and use your knowledge of history to answer the following question
YOU
buya
LIBERTY BOND
LEST I PERISH
What was the purpose of the bonds being advertised in the poster above?
A. to make emergency loans to Britain and France
B. to keep the U.S. out of war
C. to avoid an economic depression
D. to help finance the American war effort

Answers

Answer:

D. To help finance the American War Effort

Explanation:

War Bonds were put in place to fund the government for its war effort. This was used in multiple countries as well as it promises its citizens to reclaim their share of money after the war.

corvette corvette ????

Answers

Answer:

um wut ?

Explanation:

What were some of the customs and ways of life of the Cherokees?




Need help Plz!?!?!? :(​

Answers

Answer:

Explanation:

What were some of the customs and ways of life of the Cherokees? Many converted to Christianity; they had their own schools; many could read, write, and speak English; many ran businesses or were farmers; and they had their own government.

What are the four major areas of state policy (concern)?

-Government/Economics

Answers

Counties, municipalities,

You are rolling a 6-sided number cube with the
numbers 1 through 6. Which of the following represent
the probability of rolling an even number?
0
1/6
1/2
1

Answers

Answer:

1/2

Explanation:

1,3,5=odd

2,4,6=even

6-3=3. =1/2

Answer:

1/2

Explanation:  

describe three kinds of nonstate groups that influence national politics.
(U.S. government/economics)

Answers

Answer:

jaja hermano

Explanation:

Under the Articles of Confederation, Congress was
A) unable to increase the national debt.
B) able to remove British soldiers from American forts.
C) unable to deal with threats from foreign powers.
("able to collect taxes from American citizens." Is wrong so please don't say this is the answer)

Answers

Answer:

C.) Unable to deal with threats from foreign powers

Explanation:

Congress didn't have the power to:

Stop states from printing moneyRegulate PricesRegulate TradeCollect Taxes

Therefore that means Congress could not:

Stop money from losing its valueStop inflationStop foreign goods from flooding the market (is another way for saying threats from foreign powers)Reduce the national debt

I hope you have a wonderful day. I am sorry if you get this wrong.

Answer:

ACTUALLY, it is D. Trust me, I tried C. and got it wrong :(

So, it is D. unable to deal with threats from foreign powers.

Explanation:

If you were a Chinese person, what might your point of view be concerning the unequal treaties and the Chinese government that signed them?

Answers

Unequal treaty, in Chinese history, any of a series of treaties and agreements in which China was forced to concede many of its territorial and sovereignty rights. They were negotiated during the 19th and early 20th centuries between China and foreign imperialist powers, especially Great Britain, France, Germany, the United States, Russia, and Japan.
Other Questions
TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA HELP! SSUUUUUUUUPER EASY! REEEEEEEEEEEALLY QUICK! I'm just du. mb Below is an equilateral triangle. Find the value of x, then find the value of a side length. How do we use positive and negative signs to communicate the direction of a vector Fill in the question mark area of the dimensional analysis set up with the correct conversion 3.25 x 10-3 molecules H2O x 1 mole moles PLEASSSS HELPPPP How do you feel about the way you spend money on needs and wants? Is there anything you'd like to change about your spending habits when it comes to needs versus wants? A party rental company has chairs and tables for rent. The total cost to rent 4 chairs and 8 tables is 89 . The total cost to rent 2 chairs and 3 tables is 34 . What is the cost to rent each chair and each table? PLEASE HELP WILL GIVE 10pts AND BRAINLIEST FOR THE RIGHT ANWSER!!!Jackson just started kindergarten and his teacher has noticed that he if having trouble identifying objects with their correct names and seems to have reduced complexity of vocabulary and sentence structure types. Based on this, what does Jackson's teacher suspect that he might be dealing with? A) emotional delayB) physical delayC) cognitive delayD) speech delay In 35 words or fewer, why do you think it's important to learn about thepurpose, context, and audience of a rhetorical work like a speech? what type of speech would the sentence The Kid Was A Young Albert Einstein Find the values of the variables in the parallelogram. Change these times to the 24-hour clock.c)8:15 pmd)midnight Los estudiantes ______ las preguntas.contestancontestamoscontestiscontesta (pls) Find the slope of the line through (9, 4) and (0, 5). Patty is baking for the holidays. 3/5of her treats are cookies and 1/6of her treats are cupcakes. The rest are brownies. What fraction of her treats are brownies? If the 8 men on a construction crew make up 40% of the entire crew, how many people are inthe crew? Which phrase is correct..? Yes, they are. Yes, they aren't. No, they are. No, they aren't. If g(x) = 4x3 and if g(b)=6, then which of the following is the value of b? If AX:XB as AB:AC, find missing lengthAX = 5, CB = 4, AC =6, find AB Melanie bought 4 gallons of slime and plans to sellthem in small jars that each hold 1/4 of a gallon. Howmany small jars will Melanie fill with slime?