24:38
Carlos is heading a student council project to improve cafeteria meals. He surveyed all students who eat cafeteria
lunches to find out which of the five weekly cafeteria options they like least. What steps should Carlos take to best
display this data?

Answers

Answer 1

Answer:

He should gather His data, then he should put it into a bar graph or a pie chart so the school can know what lunches they like best.

Explanation:


Related Questions

state two features in the nephron that facilitate ultrafiltration​

Answers

Answer:

The glomerulus is a knot of cappilaries inside the Bowman's capsule. ... Podocytes are cells that have 'foot-like extensions' which are wrapped around a capillary. This increases the surface area for filtration.

Explanation:

which of the following properties of water are essential for life on Earth?​

Answers

Answer:

Option D

Explanation:

Complete question

which of the following properties of water are essential for life on Earth?​

A) polarity

B) Cohesion & Adhesion

C) High heat capacity

D) All the above

Solution

Some essential properties of water are as follows –  

a) Polarity

b) Solvent

c) High heat capacity - it is essential to maintain the temperature on earth. The water bodies are comparatively cooler than the temperature of earth

d) High heat of vaporization

e) Cohesion – It is essential for surface tension & capillary action

f) Adhesion – It is essential for surface tension & capillary action

g) Lower freezing density – Due to this reason, ice is lighter than water

Hence, option D is correct

A.Bacteria and mold
B. deer
C.grasses
D.mountain lion
Please help

Answers

Either A or C I believe


3. The leaf relates to ____ because it's cells are numerous in
chloroplast

Answers

Answer:

photosynthesis

Explanation:

Photosynthesis is the process every plant does

GIVING 100 BRAINLY POINTS AND BRAINLEST.

Part A Cut a 7-inch-diameter circle out of card stock. Draw a spiral on the circle as shown. Next, use the scissors to cut along the lines you drew starting on the outside and ending in the center. Use the hole punch or scissors to make a hole at the middle of the spiral and attach the thread with a knot. Tie the other end of the thread loosely around the center of the stick so you can suspend the spiral in the air. Fill the pot with 2 inches of water. Heat the water until it boils, and then turn off the heat source. Let the pot sit for 4 minutes. Holding the ends of the stick with the spiral attached, position the bottom of the spiral right above the top of the pot so it’s not touching the water. Describe what happens.

Answers

Answer:

the spiral stick wouldnt be wet because it isnt touching the water, so therefore the sprial stick wouldnt be hot because it isnt touching the water.

Explanation:

Answer: yeah it’s 50.

Explanation:

A variegated leaf with green and yellow patches is used for an experiment to prove that chlorophyll is required for photosynthesis. Before the experiment the green portions (A), and the yellow portions (B), arte observed. What will be the colour of „A‟ just before and after the starch test? Also write the equation of photosynthesis and mark, well ash molecule the by-product is obtained.

Answers

Answer: The colour of A before the starch test is GREEN while after the starch test is BLUE- BLACK. The equation for photosynthesis is

6CO2 + 6H2O → C6H12O6 + 6O2.

Explanation:

PHOTOSYNTHESIS is the process by which green plants use energy from sunlight to manufacture their own food. It is a building up process since simple inorganic compounds such as carbondioxide and water are built up into large organic compounds such as glucose and OXYGEN is given off as a by product.

Oxygen given out in photosynthesis occurs in the light stage during the process of photolysis of water. This occurs when the chlorophyll traps, absorbs and captures light energy and become energised. The energised chlorophyll supplies energy which is to split molecules of water into hydrogen ion ( H+) and hydroxyl ion ( OH-). The hydroxyl ion is reconverted to water and oxygen is given out as a by product.

To show that chlorophyll is NECESSARY for photosynthesis, a variegated leaf with green and yellow patches is used for an experiment.

The green portion is marked A and the yellow portion marked B. The leaf is tested for starch using the procedure below:

--> place leaf in boiling water for half a minute to kill it.

--> decolorize leaf by placing it in hot alcohol.

--> dip decolorize leaf in hot water to soften it.

--> place leaf on tile and add iodine solution to it.

RESULT: It would be found that only the green parts contain starch as blue+black colouration is observed while yellow area is unaffected by iodine.

how is population dynamics in animals affected by sewage water release
plzz helppp

Answers

Answer:

It may be that synthesis in population dynamics has been slow to emerge because population change is more complicated than it first appears. After all, population change is determined ultimately by only four factors: birth, death, immigration, and emigration.

Explanation:

Research has shown that population size and growth are important factors in the emission of greenhouse gases. ... While population-driven emissions from developed nations are estimated to contribute 42 percent of CO2 emissions between 1985 and 2020, they are expected to contribute only 3 percent between 2025 and 2100.

If sewage is only partially treated before it is disposed of, it can contaminate water and harm huge amounts of wildlife. Alternatively, leaking or flooding can cause completely untreated sewage to enter rivers and other water sources, causing them to become polluted. The consequences aren't great

Factors influencing population growth

+Economic development. ...

+Education. ...

+Quality of children. ...

+Welfare payments/State pensions. ...

+Social and cultural factors. ...

+Availability of family planning. ...

+Female labour market participation. ...

+Death rates – Level of medical provision.

Hoped this helped! <3

When the heart is in fibrillation, A) there is no contraction of the myocardium. B) effective pumping of the ventricles ceases because the myocardial cells fail to work as a team, and the brain cannot get adequate oxygen. C) the myocardial cells may become damaged from contracting too fast. D) the myocardial cells deplete their oxygen supply because they are contracting too fast, and the lactic acid produced damages the myocardial cells. E) the myocardial cells are contracting together as they should; fibrillation indicates a normal sinus rhythm of 75 beats per minute.

Answers

Answer:

The correct answer is - B) effective pumping of the ventricles ceases because the myocardial cells fail to work as a team, and the brain cannot get adequate oxygen.

Explanation:

When the heart is in an irregular and rapid heart rate due to chaotic electrical signals in the atrial chambers of the heart which leads to a very fast heart rhythm that shows 100 to 175 heart rate. That leads to failure of the myocardial cells that stop the pumping of the ventricles effectively and therefore blood would not reach the brain and the brain would not get an adequate amount of oxygen. This will result in organisms experiencing faint, blackout or stroke-like complications.

2. What are the steps of the dichotomous key?

Answers

Answer:

1.list down the characteristics

2.Organnize the characteristics in order

3.divide the specimens

4.divide the specimens even further

5.draw a dichotomous Key diagram

6. test it out

Which of the following is not a product or use of tropical rainforests?
a.
food
b.
medicine
c.
tourism
d.
none of the above


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

D

Explanation:

Trees give food

Tourist come to see trees sometimes

Medicine sometimes comes from tree herbs

That's all I know..hope it helps

Answer:

its d guys !

Explanation:

What are the similarities and differences between a nerve cell and a typical animal cell?

Answers

Answer:

Hi Rudaba

Where r u from ??

I am Ahaana

Cells are the structural and functioning units of all living organism. They formed the foundation all living organism.

Based on location and functions, there  are different types of cells. Because some cells transfer messages from one part of the body to another, they are have a head like structure(the cell body) and a  a long pipe shaped structure (axon) and with branches at the end ( dendrites) .These cells are nerve cells. They are located in the CNS  and PNS.

Other cells on animals have almost the same shape with some variations.

Similarities.

Both contains Nucleus, mitochondria

Both contains fluid inclusion called cytoplasm where all organelles,

Both bounded  layer of cell membranes to restrict movement  the cells organelles and to give shapes.

Differences;

Typical animals cells are of different colors based on location in organs .But

nerve cells  are made of the grey color ( granules) of the cell body and white color of the axon. This is uniform for all nerve cells.

Animal cells performs different functions in animals based on location, but nerve cell is for transmission of impulses and action potential only.

Animal cells undergo regeneration after death or damage. The Regeneration of  nerve cells is slow or not possible in most cases. This is the reasons why most neurological disease are incurable.

Animal cells are made up of three distinct parts: the cell membrane, cytoplasm and the nucleus. Cell body, axon and dendrite are the parts of a nerve cells.

More-https://brainly.com/question/23093826

I NEED HELP ASAP DUE IN 10 MINUTES
The herbivores in the forest don’t consume this low-growing invasive plant because they mistake it for a similarly shaped toxic plant in the forest. The invasive plant needs a lot of room to grow. It sprouts from its seeds much earlier than the native species. What effect can its growth have on the native herbivores’ food supply?

Answers

Answer:

It could grow at such an extrem erate that it could use up all natural resources that the native species needs to survive. thus breeding out all native species and becoming a invasive species. The native species the animals eat now does not exist and the animals that needed that food will decrease drastically in populus.

Explanation:

When a person is suddenly cut by a sharp object, a nervous impulse is sent along a sensory neuron to the spinal cord. The impulse is immediately transmitted through motor neurons to produce a response. Which of the following correctly identifies and describes this response?
A.It is a leamed response that does not occur in infants and small children
B. It is a reflex response that causes various muscles to contract in order to move away from the object.
C.It is a conditioned response that occurs only to prevent injury!
D. It is a voluntary response that is initiated only after the impulse has been caried to the relevant area of the brain.​

Answers

Answer:

B. It is a reflex response that causes various muscles to contract in order to move away from the object.

Explanation:

I just took the Test

It is a reflex response that causes various muscles to contract in order to move away from the object. Therefore, option (B) is correct.

What is reflex response?

A reflex response is an automatic, involuntary response to a stimulus that does not involve the conscious part of the brain. In this case, the reflex response causes various muscles to contract in order to move away from the sharp object, which helps to minimize further injury. Reflexes are a protective mechanism that can operate without the need for conscious control or decision making.

The reflex response described in this scenario is not a learned response, a conditioned response, or a voluntary response. It is an innate, automatic response that occurs in response to a specific stimulus, and it occurs in both infants and adults.

Learn more about reflex response, here:

https://brainly.com/question/28148821

#SPJ6

PLEASE HELP ME!!!!
IT IS FOR BIOLOGY!!!

Answers

Answer is selective breeding

Answer:

d. selective breeding

Explanation:

HELP!!!! 50PTS!!!!! WILL BE MARKED BRAINLIEST!!!!

Adaptive radiation is often seen after which of the following events? (4 points)
Mass extinctions
Sexual selection
Genetic drift
Founder effect I think is A

Answers

Answer:

genetic drift I'm pretty sure

Explanation:

have an amazing day!!!!!!!

Answer:

mass extinctions

Explanation:

Help will mark brainiest

Answers

Answer:

Amino acids are the building blocks of proteins

There are many possibilities that could happen if the sequence of amino acids were to change. It could potentially create a completely different protein with a different function, or it could create a more efficient protein but this is less likely.

Explanation:

What is the relationship between photosynthesis and respiration?
A Photosynthesis produces water, while respiration does not. .
B. Respiration requires sunlight, while photosynthesis does not.
C. Photosynthesis produces oxygen, and oxygen is required for respiration
D. Respiration produces glucose, and glucose is required for photosynthesis iser​

Answers

Answer:

c.

Explanation:

That be your answer mate.

Answer:

the correct answer is c

Explanation:

Photosynthesis converts carbon dioxide and water into oxygen and glucose. Glucose is used as food by the plant and oxygen is a by-product. Cellular respiration converts oxygen and glucose into water and carbon dioxide. Water and carbon dioxide are by- products and ATP is energy that is transformed from the process.

which of these is a plantation crop?
a)Coffee
b)Tea
c)Spices
d)All of these

choose one​

Answers

Answer:

D) All Of These

Explanation:

Tea, Coffee, and Spices are a plantation crop.

Answer:

the right answer is D all of these

*PLEASE ANSWERR!!*
What is the second step in fieldwork for marine science?

a.) presentation

b.) analysis

c.) collection

Answers

Answer:

its b

Explanation:

I hope this help

Mmm

A. GUC
B. CGU
C. UCG
D. UGU

Answers

Answer:

A

Explanation:

it'll go GUC➡️CAG➡️GUC

b) How does adaptation affect the survival of a species? Why?

Answers

In evolutionary theory, adaptation is the biological mechanism by which organisms adjust to new environments or to changes in their current environment. This enables better survival and reproduction compared with other members of the species, leading to evolution.

Explanation:

If you want more info, you can check out this site. It is safe and secure.

https://www.nationalgeographic.org/encyclopedia/adaptation/

Son Órganos que desempeñan la misma función, pero tienen una constitución anatómica diferente, hablamos de

Answers

Answer:

órganos análogos

Explanation:

Los órganos análogos son aquellos que cumplen la misma función (o similares funciones), pero no poseen un origen evolutivo en común. Por otra parte, los órganos homólogos son aquellos que poseen un origen evolutivo común (es decir, derivan de un ancestro en común). Los órganos análogos pueden ser distinguidos durante desarrollo embrionario ya que ellos experimentan diferentes mecanismos para su formación. Estos órganos (análogos) han experimentado evolución convergente, es decir, representan estructuras similares las cuales han evolucionado a partir de organismos que no tienen un antepasado en común. Un ejemplo de órgano análogo es la presencia de alas en murciélagos y abejas.

10. Explain why the feel of gypsum and talc can be used to distinguis
between the minerals?

Answers

Talc has a score of 1, and gypsum has a score of 2, which makes these two minerals similar and difficult to differentiate between. Feel both pieces of rock for how slippery they are. If the rock is slippery, it may be talc. If the rock isn't slippery it may be gypsum.

The reticular formation ________.
A) sets the rate of respiratory movements
B) contains nuclei and centers that regulate vital autonomic nervous system functions
C) relays somatic information to the ventral posterior nuclei of the thalamus
D) regulates heart rate and force of contraction, and distribution of blood flow
E) relays information from the spinal cord, the red nuclei, other midbrain centers, and the cerebral cortex to the vermis of the cerebellum

Answers

Answer:

B) contains nuclei and centers that regulate vital autonomic nervous system functions

Explanation:

The correct option is - B) contains nuclei and centers that regulate vital autonomic nervous system functions

Reason -

The reticular formation contains nuclei and centers that regulate vital autonomic nervous system functions.

Which condition is NOT a requirement of the Hardy-Weinberg equilibrium?
A. No mutations in a population
B. No net migration of alleles into or out of the population
C. Sexually reproducing and randomly mating in a population
D. Small population with genetic drift

Answers

D; Hardy- Weinberg requires a very large population size so that genetic drift can be insignificant.

Answer:

D since people need to produce more, producing in a small population with genetic drift is not a requirement Hardy Weinberg equilibrium

27)
Natural selection produces changes most quickly in
A)
species with short reproductive cycles
B)
complex multicellular organisms
C)
individuals that produce a small number of offspring
D)
individual pathogens killed by antibiotics

Answers

Answer:

A) species with short reproductive cycles

A) species with short reproductive cycles

This is because these organisms will have more chances to have mutations if more births are happening

Which will diffuse easily in the cell membrane: Molecules that are lipids or molecules that are ionic (charged).

Answers

Answer: Molecules that are lipid soluble because the cell membrane is a phospholipid bilayer.

Explanation:

6. The absorbed dose of electrons is 50 mrad. What is the equivalent dose in J/kg?
O 5.0 x 10-4 g/kg
500 J/kg
5.0 x 10-3 J/kg
50 J/kg

Answers

Answer:

5.0 x 10-4 g/kg

Explanation:

This is because

I mrad is equivalent to 1/100,000j/kg

Therefore,

To convert 50 mrad to j/kg

= 50/100,000

= 5 × 10^-4j/kg.

Millirad is a decimal unit or rad which is the unit for measuring absorbed ionization radiation.

PLEASE HELP

Which of the following is the best example of gene flow?

Wind blows pollen from one population of plants to another, and cross-fertilization occurs.
An earthquake results in the formation of a canyon, splitting a population of toads apart.
Genes are shuffled by the crossing over of chromosomes during meiosis.
A small population of humans colonizes a newly formed island.

Answers

Answer: Wind blows pollen from one population of plants to another, and cross-fertilization occurs. brainliest?

Explanation:

The best example of gene flow is Wind blows pollen from one population of plants to another and cross-fertilization occurs.

What do you mean by pollination?

A pollinator is anything that helps carry pollen from the male part of the flower (stamen) to the female part of the same or another flower (stigma).

Self-pollination is the transfer of pollen from the anther to the stigma of the same flower.

Cross-pollination is the transfer of pollen from the anther of one flower to the stigma of another flower on a different.

Thus, option A is correct, as pollination leads to fertilization which involves the gamete's interaction.

To learn more about fertilization  click here:

https://brainly.com/question/3204813

Earth is made up of
layers.

Answers

Answer:

multiple different layers and that's how we also have different types of rocks like sedimentary

Other Questions
What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential What is the example of unique number? Juan is trying to factor x + 7x+3 and makes the following table.- see picture-Juan concludes that x + 7x+3 cannot be factored using integers.a. Is Juan correct? b. Comment on Juan's strategy and improve it if possible. Consider the linear equation. 5x+6y=15 Which point represents a solution to the equation? Is there a closed economy?