5. The double helix model of DNA explained Chargaff's rules
because
A. adenine could hydrogen-bond with thymine and
guanine could hydrogen-bond with cytosine to hold the
helix together.
B. a helix repeats itself many times over, so the four bases
in DNA can repeat themselves many times.
C. adenine and thymine are found in one strand of the
double helix and guanine and cytosine are found in the
other strand.
OD. adenine could change places with thymine while
munninn anuld chanannhan with

Answers

Answer 1

Answer:A adenine could hydrogen-bond with thymine and guanine could hydrogen bond with cytosine to hold the helix together

Explanation:

Answer 2

The double helix model of DNA explained Chargaff's rules because adenine could hydrogen-bond with thymine and guanine could hydrogen-bond with cytosine to hold the helix together. The correct option is A.

What is Chargaff's rule?

According to Chargaff's criteria, guanine and cytosine should be equal in amount in the DNA of every species and organism, and adenine and thymine should be equal in amount.

Additionally, the purine and pyrimidine bases should be in a 1:1 stoichiometric ratio.

The ratio of the several nitrogenous bases present inside the DNA molecule is described. It assists in figuring out the makeup and structure of DNA in various species.

Because adenine could hydrogen bond with thymine and guanine could hydrogen bond with cytosine to maintain the helix together, the double helix model of DNA provided an explanation for Chargaff's rules.

Thus, the correct option is A.

For more details regarding Chargaff's rule, visit:

https://brainly.com/question/14083251

#SPJ5


Related Questions

ALOT OF POINTS PLEASE HELP :)

How did humankind discover the presence of DNA?

Answers

Answer:

The real breakthrough in understanding DNA, however, came with the discovery of its structure in 1953. The discovery of the structure of DNA is often credited to James Watson and Francis Crick.

Explanation:

Based on the synthesis reaction what would the product of the reaction be? NaPO3+CuO

Answers

the answer is NaCuPO4

Answer: NaCuPO4

Explanation:

I need help with this question

Answers

bike -> CO2
computer -> saving forest
water and factory -> freshwater

how did advancements in technology help scientists better understand process of cell division?

Answers

Answer:

As is true for many fields of research, cell biology has always been ... Thanks to these advances we now have access to microscopes and ... You might then also realize that the new method, at least on paper, may have additional applications. ... which makes the technology attractive to yet more scientists.

Explanation:

Hoped I helped you out please mark me brainliest!!!

With the creation of the microscope, humans were able to observe plant and animal cells, and as technology advanced, scientists were able to learn more about these various types of cells.

What is a microscope?

A microscope is a device that can be used to examine small objects, including cells. The image of an object is magnified in the microscope by at least one lens.

In most cases, the light is focused on the sample by passing it through a condenser.

After passing through the sample, the light passes through the objective lens, which magnifies the image of the sample, and then to the oculars, where the enlarged image is viewed.

The discovery of the green fluorescent protein (GFP), the development of increasingly sophisticated microscopes, and the development of in vitro assays that faithfully reproduce cellular functions are just a few examples of technological advances that have fueled many areas of cell biology.

Thus, it can be concluded that the advancements in technology help scientists better understand process of cell division.

For more details regarding microscope, visit:

https://brainly.com/question/18661784

#SPJ2

in guinea pigs short hair is dominant over long hair. a female guinea pig with short hair but whose father had long hair is mated with a male whose parents were both short haired, but who has long hair. using a punnett square, predict the genotypic and phenotypic ratios of their offspring?

Answers

The picture is what the punnet square looks like. Capital S represents short hair and lowercase s represents long hair.
The genotypic ratio is 2:2 (Ss 50% and ss 50%)
The phenotypic ratio is 2:2 (short hair 50% and long hair 50%)

Help with all please 10 points and try and leave a small explanation, sorry for the quality lol.

Answers

Answer for question 1- B (eliminate all plant life)

Answer for question 3- A (Direct energy from the Sun)

(i’m not entirely sure what the answer is to question 2 and i do apologies if any of this incorrect)

During the cell cycle, (1)_______ is the stage when the cell is performing
its functions and/or resting, whereas _(2)______ is the stage when the
cell is actively dividing.

Answers

Answer:

A is correct happy new year

THE ANSWER IS A I HOPE THIS HELPS

The image illustrates a sustainable method of providing transportation for
people in a society. How does this method compare with having many
gasoline-powered vehicles, each with only one occupant?
A. It conserves more fossil fuels.
B. It uses the same amount of fuel per person.
C. It uses more expensive fuel per person.
D. It uses more fossil fuels per person

Answers

Answer: A. It conserves more fossil fuels

Explanation:

This approach saves more fossil fuels than using lots of gasoline-powered cars, each with just one occupant.  So, the correct option is A.

What are Fossil fuels?

A fossil fuel is a hydrocarbon-containing substance that is recovered and used as fuel that naturally forms in the Earth's crust from the remains of dead organisms and plants. Fossil fuels include coal, oil, and natural gas. Fossil fuels can be burned to produce energy, drive engines, or provide heat for immediate use.

A general name encompassing non-renewable energy sources such crude oil, petroleum products, natural gas, derived gas, coal, coal products, and non-renewable wastes is "fossil fuel." These fuels are made from ancient geologically-dated plants and animals (for example, millions of years ago). Compared to using many single-occupant gasoline-powered cars, the method conserves more fossil fuels.

Therefore, the correct option is A.

Learn more about Fossil fuels, here:

https://brainly.com/question/3371055

#SPJ7

does anyone know this pls help

Answers

Answer:

A person standing on the ground is barely affected by surface gravity

hypothesis on what is the effect of the genes of the parental mice on the fur color of the offspring mice? use "If...then...format

Answers

Answer:

If the GENES of the parental mice encodes for a black fur, THEN the FUR COLOR of one of the offspring mice will be black.

Explanation:

Hypothesis is one of the steps used in the scientific method. It is a testable explanation of a given question or observation. Hypothesis in an experiment must be subjected to testing via experimentation in order to determine whether to reject it or not.

Hypothesis is usually constructed in the IF, THEN format. It tells us how the independent variable (cause) affects the dependent variable (outcome). In this case, a question is asked this: "what is the effect of the genes of the parental mice on the fur color of the offspring mice?"

A possible hypothesis will be: If the GENES of the parental mice encodes a black fur, THEN the FUR COLOR of one of the offspring mice will be black.

Answer:

A. If either parent mouse passes a dominant allele, the offspring will have black fur.

Explanation:

Either option is correct because it didn't show any green check. It determines on what hypothesis you wrote. I chose A because it relates to my statement. <33

What are the three blood types? Explain how there could be an AB blood type.

Answers

Answer:

AB

O

A

B

the AB blood type is created (mostly) by someone with A blood type making a baby with someone with B blood.

Explanation:

The human blood group is classified into four major classes which are A, B, AB, and O. This is possible due to multiple allelism and codominance which are found in the alleles A and B.

What is blood typing?

A blood type is the classification of blood into different groups, based on the presence or absence of antibodies and inherited antigenic substances on the surface of the red blood cells which are present in the blood. These antigens may be proteins, carbohydrates, glycoproteins, or the glycolipids, depending up on the blood group system.

In humans, the blood typing is of four types that is A, B, AB, and O. This is because, the blood typing is an example of multiple allelism and codominance. A and B alleles are codominant and O is recessive.

Learn more about Blood typing here:

https://brainly.com/question/256625

#SPJ2

how does asexual reproduction limit variation in species?

Answers

Answer:

less of a chance for mutations

Explanation:

Answer:

Asexual reproduction is a cheap and fast method for producing large numbers of propagules having little diversity. The method of cell division is mitosis, which produces identical daughter cells. This is largely advantageous when survival of offspring is dependent, more upon explosive population growth, than on the diversity of each individual. Plankton species are such an example, where to survive they mostly just need to out produce predation.

Most organisms engage in sexual reproduction at some point in their life cycle to introduce diversity when survival is dependent on susceptibility to parasites. Host — parasite coevolution is an arms race accelerated by diversity.

In sexual reproduction, the method of cell division is meiosis, where diversity is introduced through crossing over, independent assortment, and also, random fertilization.

Explanation:

The parietal pleura lines the

Answers

Answer:

Uh im confused so here is the defination The parietal pleura is the outer membrane that attaches to and lines the inner surface of the thoracic cavity, covers the upper surface of the diaphragm and is reflected over structures within the middle of the thorax. It separates the pleural cavity from the mediastinum.

Explanation:

plzzzzzzzzzzz help lol

Answers

Answer:

litter

Explanation:

how does a beneficial trait increases an organism's survival and potential reproductive success.

Answers

Answer:

This cumbersome trait significantly decreases the male's chances of survival. ... natural selection: that is, that organisms better adapted to their environment would benefit from ... the individual's reproductive success, even at the expense of their survival (Darwin 1871). ... A successful male can potentially sire many offspring.

Explanation:

The beneficial trait increase the survival and potential reproductive success of the organism as they help organism to thrive in their unfavorable changing environment.

Natural selectionThe natural selection can be defined as the differential survival and reproduction of those organisms which have beneficial traits over others.For example, the color change in chameleon helps them to remain undetected from predator population as well as from prey so it helps in increase in rate of survival of chameleon also helps them to reproduce and increase in number.

Hence, beneficial traits increase the rate of survival and reproduction of organisms.

Learn more about natural selection:

https://brainly.com/question/9830102

What can you infer about the Maastrichtian Age from its name?

Question 7 options:

A)

That is was an extremely long, complicated age.


B)

Rocks from that era were first studied near the city of Maastricht, Netherlands


C)

That is was the most strict geologic age in history.


D)

Nothing - the names of geologic ages are arbitrary.

Answers

Answer:

The B) is answer

my answer have to be atleast 20 characters long oof

You have adopted a gray mouse, which you know is a wild type phenotype. When crossed with a white mouse, your gray mouse has a first litter of 3 gray mice and 2 white mice. In the second litter, you observe 3 gray mice and 4 white mice. What is the probable genotype of your gray mouse

Answers

Assuming the white phenotype is recessive. white: gg
I think the gray mouse is Gg because the offspring were pretty equally distributed in terms of color. See the punnet square below.
g g
G| Gg Gg
g| gg gg

If the Gray phenotype is recessive, then gray: ww but only if white is Ww because its about 50% chance for both.

What limits the growth of phytoplankton?

Answers

Answer:

phosphorus has been considered to be the primary nutrient limiting phytoplankton growth in freshwater ecosystems

Explanation:

Which molecule is split apart during the light reactions in photosynthesis?
A. Water
O B. Carbon dioxide
ООО
C. Glucose
D. ATP

Answers

It’s B because carbon dioxide is splits apart

PLZ ASAP
A scientist is using a microscope to observe a type of
bacteria.

Which two structures would the scientist most likely see?PLEASE EXPLAIN WHY

A:nucleus and DNA
B:DNA and cell wall
C:cell wall and vacuole
D:vacuole and nucleus

Answers

Answer:

The two structures most likely to be observed by the scientist when looking at a type of bacteria under the microscope are cell wall and vacuole (option C).

Explanation:

Bacteria are prokaryotic organisms that lack a nucleus, most of the organelles, and whose DNA is dispersed in the cytoplasm. Some types of bacteria have a plasma membrane surrounded by a cell wall, and may be equipped with vacuoles to perform their functions.

It is very likely that two structures that are most likely to be differentiated when a type of bacteria is observed under the microscope are the cell wall and the vacuole, according with information above.

The other options are not correct because:

    A and D. Bacteria lack a nucleus.

    A and B. Bacterial DNA is dispersed in the cytoplasm and is very difficult to observe under the microscope.

Answer:

cell wall vacuole

Explanation:

Help me please thanks the first one

Answers

Answer:

7683.2 Joules

Explanation:

We can calculate potential energy using the equation that is used to calculate the work done by a conservative force, in this case, gravity.

U(x)gravity = mgy

U represents potential energy, m is mass, g is gravity, and y is the height.

U(x) = (80 kg)(9.8 m/s^2)(9.8m)

Potential Energy = 7683.2 Joules

I need someone to do a very big task for me in biology..I will give brainlist. The teask i need is the first one in my profile. Thankyou

Answers

Answer:

Explanation:

i'll try

Please Help i will give brainliest

Answers

Answer:

1. it establishes the foundation for food webs and food chains.

2. preservation of biodiversity prevents the extinction of species

Explanation:

Biodiversity gives a role to every species, whether or not it may seem important. By establishing a food chain, the roles of each organism is fulfilled as an ongoing cycle. If we didn't have this, there could end up being too many animals.

In which stage do vertebrate embryos or offspring show the most similarities?

Answers

Answer: Middle stages

Explanation:

Answer:

Earliest stages

Expation:

Which statement is best represented by the diagram?
All carbon is in the form of carbon dioxide,

Carbon can exist in many forms, but the total amount of carbon stays the same.

The amount of carbon in the cycle can increase or decrease based on the number of factories present.

Only living things release carbon dioxide into the atmosphere.

Answers

Answer:

All carbon is in the form of carbon dioxide

Using the data in Figure 13.2, translate the following DNA segment into an amino acid sequence: -TTTAGCGAGTCTCGA-

Answers

Phe-ser-glu-ser-arg

T (thymine) should be translated into U (uracil)

If this is right, can you mark me brainliest? :)

In which area of the cell does the interaction between codon and anti codon occur?

Answers

Answer:

This occurs at the 3′ end position which sits on an mRNA, while a distinct tRNA anticodon triplet sequence matches a three complementary base pair mRNA codon sequence to guide appropriate amino acid into place at a ribosome activation site to form a polypeptide or protein.

The interaction between codon and anti-codon is occurs at the 3′ end position which sits on an mRNA.

What are the functions of mRNA?

Messenger ribonucleic acid is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is read by a ribosome in the process of synthesizing a protein.

The role of mRNA is to carry protein information from the DNA in a cell's nucleus to the cell's cytoplasm (watery interior), where the protein-making machinery reads the mRNA sequence and translates each three-base codon into its corresponding amino acid.

Found in all cells, messenger ribonucleic acid, or mRNA, is a single-stranded molecule. It is responsible for transferring genetic information from DNA, found in the nucleus of the cell, to ribosomes floating in the cell's cytoplasm.

Learn more about mRNA:

https://brainly.com/question/21312423

#SPJ6


If a strand of
DNA reads ATC
C, what would
the other side
read?

Answers

Answer:

TAGG

Explanation:

Adenine always pairs with thymine and cytosine always pairs with guanine

what does the phrase "science is not done" mean?

Answers

Answer:

yrfquwrfbliueiurviurnfr

Explanation:

that means i do not know what that means

It means that theres more too explore and we haven't begun to understand the mysteries of the universe. There's still a lot more to learn with any sciences.

Which of the following accurately describes where glyphosate can be used and why

Answers

Answer is
Glyphosate is an herbicide. It is applied to the leaves of plants to kill both broadleaf plants and grasses. The sodium salt form of glyphosate is used to regulate plant growth and ripen specific crops.
Other Questions
HELP PLZ What connections can we make between finding the slope of a line connecting two points and the distance between those same two points? 1. 42+14x2. 3(2x + 9) what is the value of y in the solution to the system of equations 5x-y=25 and x+4y=-10 Any body got common lit answers 3 Drag the tiles to the boxes to form correct pairs. Match the expressions with the property used to generate 5y + 2y+ 6+2. Distributive Property 6y - y + 2y + 10 - 4 + 2 5y + 2(y + 3) + 2 combining like terms 5y + 2 + 6 + 2y Commutative Property cared How can I solve .6 x .5 Which is a like radical to 3 sqrt 54 and 3 sqrt 128 when the expression are simplified? Which rule applies to the translation of the RED trapezoid to the BLUE trapezoid?)(c.y) - (x* 2, y- 3)B)(x. y) - (x+ 4, y- 5)(x, y) - (x + 2, y - 5)D)(.Y) - (x- 2, y - 5) what color is the darkest.A. RedB. BlueC. purpleD. Black Read this excerpt from from Robinson Crusoe:Then I took my turn, and embraced him as my deliverer,and we rejoiced together. I told him I looked upon him as aman sent from Heaven to deliver me, and that the wholetransaction seemed to be a chain of wonders (243).Based on the wording in this excerpt, which of the following is Crusoe mostlikely describing?O A. A mutineerOB. A cannibalOC. The captainOD. Friday the measure of G is 82. What is the measure of its compliment? facts on wourld war 2 TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA HELP! SSUUUUUUUUPER EASY! REEEEEEEEEEEALLY QUICK! I'm just du. mb Below is an equilateral triangle. Find the value of x, then find the value of a side length. How do we use positive and negative signs to communicate the direction of a vector Fill in the question mark area of the dimensional analysis set up with the correct conversion 3.25 x 10-3 molecules H2O x 1 mole moles PLEASSSS HELPPPP How do you feel about the way you spend money on needs and wants? Is there anything you'd like to change about your spending habits when it comes to needs versus wants? A party rental company has chairs and tables for rent. The total cost to rent 4 chairs and 8 tables is 89 . The total cost to rent 2 chairs and 3 tables is 34 . What is the cost to rent each chair and each table? PLEASE HELP WILL GIVE 10pts AND BRAINLIEST FOR THE RIGHT ANWSER!!!Jackson just started kindergarten and his teacher has noticed that he if having trouble identifying objects with their correct names and seems to have reduced complexity of vocabulary and sentence structure types. Based on this, what does Jackson's teacher suspect that he might be dealing with? A) emotional delayB) physical delayC) cognitive delayD) speech delay