6) Pamela went to the doctor for her yearly check-up. They discovered that she had decreased
estrogen and progesterone levels. After a few months of medication, her levels returned to
normal. She stressed to her doctor that she wanted a child. Her doctor said that with the
hormonal supplements, she should be able to conceive a child.
What systems are affected?
Why?

Answers

Answer 1

Answer:

strogen and progesterone levels

Explanation:

she stressed to her doctor


Related Questions

1. Describe how the rotation of Earth on its axis affects the tides. Be sure to include the evidence that supports your answer.

Answers

Answer/Explanation:

During low elevated tides, the Earth itself is pulled marginally toward the moon, making elevated tides on the contrary side of the planet. Earths pivot and the gravitational draw of the sun and moon make tides on our planet. As the sea swells toward the moon, an elevated tide is made.

But because the Earth rotates, circulating air is deflected. Instead of circulating in a straight pattern, the air deflects toward the right in the Northern Hemisphere and toward the left in the Southern Hemisphere, resulting in curved paths. This deflection is called the Coriolis effect.

Is nature or nurture more important

Answers

Answer:

Yes

Explanation:

cus

it keeps us alive

The answer is completely subjective. I’ll assume you are talking about raising children simply because this vocabulary is often used in that case.

Nature can go from describing events out of our control, innate feelings, to describing the area we are raised in. Nature can go a long way with raising kids, in comes the theory’s of the “murder gene.” The aforementioned gene is a theory on the “murderous” behaviors in children sociopaths, or psychopaths. This theory exists because of some unexplainable behaviors the children have that were not taught, like hurting animals and lack of empathy.

In a more lose interpretation of Nature it can mean the area children are raised in. Like the different between a trailer park and a mansion. But generally Nature refers to innate, uncontrollable, behaviors.


On the other hand Nurture refers to the actual raising of the child. Referring back to the “murder gene” the question is if you could reverse the effects of the gene in children based on how you raise them. Nurture is also an argument for how kind you should be to your child as they are growing.

Personally I think Nurture is more important, but in all actuality a good balance is best.

PLEASE ASAP NEED HELP PLEASEEE !!!!

Answers

Answer:

Hunting in groups,  keen eyesight, chemicals to paralyze prey

Explanation:

Answer:

Hunting in groups

Keen Eyesight

and Camouflage

Explanation:

These are all the main adaptations that predators are born with. The rest of them do not help them at all. PLease give brainliest :)

Color blindness is a X-linked recessive trait. A couple want to predict whether it would be possible for their child to be color blind. The female is an unaffected carrier and the male is red/green color blind. What percentage of offspring would be color blind? ​

Answers

Answer: There is a probability (n.b. NOT certainty) that half of all offspring will be colour blind.

Explanation: The female is XX and as an unaffected carrier we can assign genotype Cc where c is the recessive allele.

The male is XY and colour blind, so genotype cY

Male offspring can be cY or CY so p|colourblind = 50%

Female offspring can be Cc or cc so, again p= 50%

If there is also equal probability of sex of the offspring, there is an overall probability that half the offspring will be colour blind

During a laboratory experiment, you discover that an enzyme-catalyzed reaction has a △G of -20 kcal/mol. If you double the amount of enzyme in the reaction, what will be the △G for the new reaction?


A. +20 kcal/mol

B. -40 kcal/mol

C. -20 kcal/mol

D. -10 kcal/mol

Answers

Answer:

Option-C

Explanation:

Delta G (△G) refers to the overall energy released during a chemical reaction when equilibrium is reached i.e the rate of conversion of product into the substrate is equal to the rate of conversion of substrate into product. Thus, △G accounts for the equilibrium of the reaction.

In the given question, it has been mentioned that △G of a reaction is -20 kcal/mol then how will it change if the amount of enzyme is doubled.  

The △G is not affected by the enzyme concentration as the presence of enzyme affects the G (Gibbs free energy) and activation energy.

Therefore, △G will remain the same even if the amount of enzyme is doubled i.e -20 kcal/mol will be the correct value.

Thus, Option-C is the correct answer.

What agent of erosion is this? Gravity,wind, waves, running water or glaciers.

Answers

Answer:

wind                                        

Explanation:

When you step
on a scale, what is being
measured?

Answers

Answer:

Although scales measure force, they give you measurements of mass in kilograms, grams, pounds, or whatever.

Explanation:

What the person above me said is correct


Explanation it’s correct I’m positive

Rivers that have developed over a long period of time are found in wide valleys with flat, low-lying bottoms. These valleys were
created by the removal of rock and soil through the process of _____.
OA. deposition
B
C. erosion
•D. weathering
glaciation

Answers

Option C i thinkkkkk

Given the following DNA strand TACGTATGCCGTATGGGCATT

a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?​

Answers

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

What process in humans is a good representation of asexual reproduction?

A. Meiosis

B. Mitosis

C.Fertilization

Answers

Answer:

B.

Explanation:

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

X could be an Arecaceae

Both roses and ferns are used as ornamental plants

Explanation:

Hope I got this right!! I really love plants! aslo feel free to report this answer if I was wrong!

In pea plants, the allele that produces purple flowers (P) is dominant to the allele that produces white flowers (p), and the allele that produces tall plants (T) is dominant to the allele that produces short plants (t). Two pea plants are crossed and produce 521 offspring, and the results of this cross are shown below:


Phenotype Number of offspring
Tall with purple flowers 291
Short with purple flowers 97
Tall with white flowers 101
Short with white flowers 32


Which cross would MOST LIKELY lead to this outcome?
Pptt × ppTt
pptt × PPTT
PpTt × PpTt
ppTT × PpTt

Answers

Answer: PpTt x PpTt

Explanation:

The cross PpTt × PpTt leads to the phenotype Number of offspring Tall with purple flowers 291 Short with purple flowers 97 Tall with white flowers 101 Short with white flowers 32, hence option C is correct.

What is a dihybrid cross?

Two creatures that are identically hybrid for two characteristics are said to have mated to create a dihybrid cross. When an organism is heterozygous, it signifies that there are two distinct alleles present at a certain genetic location.

An attempt in producing two creatures that are identical hybrids for two qualities is a dihybrid cross.

The people with this sort of character are homozygous for that particular trait.

Therefore, to put it another way, a dihybrid cross is a union of two organisms that are heterozygous for two separate features, hence option C is correct.

Learn more about dihybrid, here:

https://brainly.com/question/12540319

#SPJ2

How is the Grand Canyon related to volcanic activity?

Answers

In the western Grand Canyon hundreds of volcanic eruptions occurred over the past two million years. At least a dozen times, lava cascaded down the walls of the Inner Gorge, forming massive lava dams that blocked the flow of the Colorado River. ... 1064 a series of eruptions built the park's namesake cinder cone.

hope this helps ^^

Answer:

In the western Grand Canyon hundreds of volcanic eruptions occurred over the past two million years. At least a dozen times, lava cascaded down the walls of the Inner Gorge, forming massive lava dams that blocked the flow of the Colorado River.

Explanation:

Which person is collecting data through the participant observation method?
O A. William, who is reviewing the comments people wrote on
questionnaires
B. Dakota, who is calculating the results from a survey
OC. Hosea, who is watching people in their normal suroundings
OD. Brittany, who is reading research done by others

Answers

Answer:

C. Hosea, who is watching people in their normal surroundings.

Explanation:

What is antibiotic resistance and why should we be
worried?

Answers

Answer: Antibiotic resistance is when bacteria develops a resistance or an immunity against antibiotics. If this evolution/adaptation becomes widespread, our healthcare system could see a mass rise in deaths due to us not being be able to effectively treat the bacteria which is causing harm.

Explanation:

I learned about this

What controls the cell cycle at key checkpoints?
a Regulatory proteins
b Regulatory lipids
C Regulatory carbohydrates

Answers

Answer:

a regulatory proteins

Explanation:

njnjnj

The _______________ rate describes the rate at which the atmosphere gets colder as the air gets thinner at higher altitudes.

Answers

Answer:

Lapse rate

Explanation:

AHHHHSHYNJTNXT WHYYYYY

which level of the food chain is most affected by biomagnification

Answers

Answer:

animals near the top of the food chain are most affected because of a process called biomagnification. Many of the most dangerous toxins settle to the seafloor and then are taken in by organisms that live or feed on bottom sediments.

Explanation:

Have a great one!

how do vital signs allow medical professionals to assess a patient's physiology and overall health

Answers

they measure the pulse rate and blood pressure of a patient, these can  help to determine if a patient has any diseases of the blood or if they are under stress.

Why might Ponyboy have idolized Pual Newman?

Answers

Ponyboy might have idolized Paul Newman because Paul Newman played many rebellious characters who Ponyboy could relate to. Some characters he played were “Fast Eddie” in The Hustler and a Southern chain gang member in Cool Hand Luke.

Can someone help me thank you!!

Answers

Answer:

CARBON

Explanation:

The cell part that helps with cell division is the ________​

Answers

Answer:

centrioles

Explanation:

Every animal-like cell has two small organelles called centrioles. They are there to help the cell when it comes time to divide. They are put to work in both the process of mitosis and the process of meiosis.

All living organisms store genetic information that can be passed on from parent to offspring. How does the biomolecule responsible for storing this information differ from other biomolecules?

Answers

Answer:B

Explanation:

DNA analysis has little to offer from forensic science
true or flase​

Answers

Answer:

DNA analysis has little to offer forensic science is false.

Explanation:

DNA may be found on the handle or tip of a baseball bat if it is used in a crime. The evidence is used for DNA analysis

What type of cell is more likely to replicate and replicate faster brain cell or hair cell

Answers

Answer:

hair cells is most likely to replicate faster than the brain cell

Explanation:

__________

If the food on the island is small seeds, what finch is best adapted? Explain why

Answers

Answer:Adaptation in Darwins Finches. Beak depth, which is correlated with body size and the ability to crack larger seeds, varies according to drought conditions: plants produce fewer, harder seeds in dry years and more, softer seeds in wet years. Only larger birds with deeper depths survive in drought years.

Explanation:

HURRY. Why is transcription said to be unidirectional?

Answers

Answer:

Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.

Explanation:


Why must an mRNA copy be made for Protein Synthesis?
A. Ribosomes cannot read DNA, only RNA.
B. DNA must stay inside the nucleus.
C. Ribosomes are too big to enter the nucleus.
D. DNA is too degenerate to use without mRNA.

Answers

Answer:

A

Explanation:

its not D or C and B might be true but its A okay

Why must an mRNA copy be made for Protein Synthesis because C. Ribosomes are too big to enter the nucleus

Why is mRNA important for protein synthesis?

mRNA is the molecule that includes the message contained within DNA to the ribosome. Ribosomes are where proteins are produced. mRNA is vital because ribosomes cannot attain the DNA inside our cell nucleus, which is the region within the mobile wherein DNA is housed.

Why is it important to make an mRNA reproduction of a DNA gene earlier than protein synthesis?

So as for cellular to fabricate these proteins, particular genes inside its DNA should first be transcribed into molecules of mRNA; then, these transcripts must be translated into chains of amino acids, which later fold into completely useful proteins.

Learn more about Ribosomes at https://brainly.com/question/8773679

#SPJ2

The simplest structures that can carry out all of the activities characteristic of life are:
A. cells.
B. atoms.
C. molecules.
D. crystals.

Answers

atoms as they are the simplest

Which choice correctly summarizes meiosis into one statement?

Answers

Answer: D

Explanation:

Other Questions
The best description of the Big Bang Theory is ______________A. The universe began with cold dense energy compressing into matter after which all matter and energy began rapidly contracting toward each other.B. The universe began with hot dense energy compressing into matter after which all matter and energy began rapidly expanding away from each other.C. The universe began with hot dense matter after which all energy began rapidly expanding away from each other.D. The universe began with cold, spread out matter compressing into energy, after which all matter and energy began slowly moving toward each other The population of Westville grew from 25,000 to 27,000 in two years. What was the percent of increase for this period of time? How did Herbert Hoover (The President of the U.S) feel about the depression ? *A). He believed the United States could expand international tradeB). He believed the federal government was responsible for providing unemploymentinsurance to American workersC). He believed the American government should provide emergency reliefD). He believed the government should NOT take a role in relief for the American people Help please!!!!!!!!!!!!!! Advances in agriculture during the Industrial Revolution caused*A Decreased food productionB Increased food productionC Food surplusD Food shortages Alison has 63 books on her bookshelf. If she plans on donating of her books, how many will Alison have left on her bookshelf? Nietzsche said that I call myself the philosopher because I am the last man. With this he was trying to say that? Calculate the density of water in kg/m3. Express your answer in kilograms per cubic meter using three significant figures. HEY CAN ANYONE PLS TRANSLATE THESE IN UR OWN WORDS (SPANISH) There are four consumers willing to pay the following amounts for haircuts, Gloria :$7 Jay: $2 Claire : $8 Phil: $5and there are four haircutting businesses with the following costs:The maximum possible total surplus is $55. Each firm has the capacity to produce only one haircut. For efficiency, how many haircuts should be given? Which businesses should cut hair and which consumers should have their hair cut? How large is the maximum possible total surplus? If an atom has 16 protons, 14 neutrons, and 19 electrons, what is the atom's electrical charge?A +2B.-3C.-2D.-5 please answer asap no trolls Capitol Hill event!!!Had this been a group of Black or Islamic prostesors , would yesterday's events have turned out any different ? What do you think would have happened? Solve the system of linear equations by graphing.y=-3x + 5y=-2x + 4 i need help from somebody who takes debate class at school, pleaselet me know if you do Write 2^4 by using repeated multiplication. Then find the value of 2^4 HELP PLEASEAt Love Canal in the 1970s, there was an environmental disaster. In response, the Superfund law was passed. Why can we view Love Canal and the creation of the Superfund as a positive environmental event? A. It allowed the EPA to find toxic waste sites and force the responsible parties to clean up the sites. B. It provided money to businesses responsible for toxic waste sites to clean up their pollutionC. It helped boost the economy among those waste sites D. It helped identify toxic waste site and move people away from them How many moles in 206.91 g Na URGENT. CAN SOMEONE PLEASE HELP ME WITH GEOMETRY? CHECK MY PAGE FOR EZ POINTS!!! :DDD help me please******