6B(SCIENCE) (6BB OOB)
4
What is the difference between evaporation and boiling? *
(1 Point)
A) There is no difference - they are exactly the same.
B) Evaporation, unlike boiling, occurs at all temperatures.
C) In evaporation, unlike in boiling, there is no state change.
D) In boiling, unlike in evaporation, the liquid volume reduces.
This question is required.​

Answers

Answer 1
B) Evaporation , Unlike boiling, occurs at all temperatures

Related Questions

Is nature or nurture more important

Answers

Answer:

Yes

Explanation:

cus

it keeps us alive

The answer is completely subjective. I’ll assume you are talking about raising children simply because this vocabulary is often used in that case.

Nature can go from describing events out of our control, innate feelings, to describing the area we are raised in. Nature can go a long way with raising kids, in comes the theory’s of the “murder gene.” The aforementioned gene is a theory on the “murderous” behaviors in children sociopaths, or psychopaths. This theory exists because of some unexplainable behaviors the children have that were not taught, like hurting animals and lack of empathy.

In a more lose interpretation of Nature it can mean the area children are raised in. Like the different between a trailer park and a mansion. But generally Nature refers to innate, uncontrollable, behaviors.


On the other hand Nurture refers to the actual raising of the child. Referring back to the “murder gene” the question is if you could reverse the effects of the gene in children based on how you raise them. Nurture is also an argument for how kind you should be to your child as they are growing.

Personally I think Nurture is more important, but in all actuality a good balance is best.

DNA analysis has little to offer from forensic science
true or flase​

Answers

Answer:

DNA analysis has little to offer forensic science is false.

Explanation:

DNA may be found on the handle or tip of a baseball bat if it is used in a crime. The evidence is used for DNA analysis

What type of cell is more likely to replicate and replicate faster brain cell or hair cell

Answers

Answer:

hair cells is most likely to replicate faster than the brain cell

Explanation:

__________

What is antibiotic resistance and why should we be
worried?

Answers

Answer: Antibiotic resistance is when bacteria develops a resistance or an immunity against antibiotics. If this evolution/adaptation becomes widespread, our healthcare system could see a mass rise in deaths due to us not being be able to effectively treat the bacteria which is causing harm.

Explanation:

I learned about this

Which choice correctly summarizes meiosis into one statement?

Answers

Answer: D

Explanation:

All living organisms store genetic information that can be passed on from parent to offspring. How does the biomolecule responsible for storing this information differ from other biomolecules?

Answers

Answer:B

Explanation:

Which antivenom will save Tyler?

Select one:

a.
Antivenom A


b.
Antivenom B


c.
Antivenom C


d.
Antivenom D

Answers

the answer is anticenom A

Answer:

A

Explanation:

It is A

How is the Grand Canyon related to volcanic activity?

Answers

In the western Grand Canyon hundreds of volcanic eruptions occurred over the past two million years. At least a dozen times, lava cascaded down the walls of the Inner Gorge, forming massive lava dams that blocked the flow of the Colorado River. ... 1064 a series of eruptions built the park's namesake cinder cone.

hope this helps ^^

Answer:

In the western Grand Canyon hundreds of volcanic eruptions occurred over the past two million years. At least a dozen times, lava cascaded down the walls of the Inner Gorge, forming massive lava dams that blocked the flow of the Colorado River.

Explanation:

Which person is collecting data through the participant observation method?
O A. William, who is reviewing the comments people wrote on
questionnaires
B. Dakota, who is calculating the results from a survey
OC. Hosea, who is watching people in their normal suroundings
OD. Brittany, who is reading research done by others

Answers

Answer:

C. Hosea, who is watching people in their normal surroundings.

Explanation:

how do vital signs allow medical professionals to assess a patient's physiology and overall health

Answers

they measure the pulse rate and blood pressure of a patient, these can  help to determine if a patient has any diseases of the blood or if they are under stress.

Color blindness is a X-linked recessive trait. A couple want to predict whether it would be possible for their child to be color blind. The female is an unaffected carrier and the male is red/green color blind. What percentage of offspring would be color blind? ​

Answers

Answer: There is a probability (n.b. NOT certainty) that half of all offspring will be colour blind.

Explanation: The female is XX and as an unaffected carrier we can assign genotype Cc where c is the recessive allele.

The male is XY and colour blind, so genotype cY

Male offspring can be cY or CY so p|colourblind = 50%

Female offspring can be Cc or cc so, again p= 50%

If there is also equal probability of sex of the offspring, there is an overall probability that half the offspring will be colour blind

What process in humans is a good representation of asexual reproduction?

A. Meiosis

B. Mitosis

C.Fertilization

Answers

Answer:

B.

Explanation:

Can someone help me thank you!!

Answers

Answer:

CARBON

Explanation:

During a laboratory experiment, you discover that an enzyme-catalyzed reaction has a △G of -20 kcal/mol. If you double the amount of enzyme in the reaction, what will be the △G for the new reaction?


A. +20 kcal/mol

B. -40 kcal/mol

C. -20 kcal/mol

D. -10 kcal/mol

Answers

Answer:

Option-C

Explanation:

Delta G (△G) refers to the overall energy released during a chemical reaction when equilibrium is reached i.e the rate of conversion of product into the substrate is equal to the rate of conversion of substrate into product. Thus, △G accounts for the equilibrium of the reaction.

In the given question, it has been mentioned that △G of a reaction is -20 kcal/mol then how will it change if the amount of enzyme is doubled.  

The △G is not affected by the enzyme concentration as the presence of enzyme affects the G (Gibbs free energy) and activation energy.

Therefore, △G will remain the same even if the amount of enzyme is doubled i.e -20 kcal/mol will be the correct value.

Thus, Option-C is the correct answer.

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

X could be an Arecaceae

Both roses and ferns are used as ornamental plants

Explanation:

Hope I got this right!! I really love plants! aslo feel free to report this answer if I was wrong!

Where do the mineral resources in which society depends on come from

Answers

Answer:Without minerals we would not have electricity, food, or shelter. Minerals make today's technology-based life possible, but that's something many of us take for granted.

Explanation:Soil, rocks, and minerals provide essential metals and other materials for agriculture, manufacturing, and building. 7.7. Earth scientists and engineers develop new technologies to extract resources while reducing the pollution, waste, and ecosystem degradation caused by extraction.

Describe the process of water moving in and out of the cell.

Answers

Answer:

Water moves across cell membranes by diffusion, in a process known as osmosis. Osmosis refers specifically to the movement of water across a semipermeable membrane, with the solvent (water, for example) moving from an area of low solute (dissolved material) concentration to an area of high solute concentration.

Explanation:

PLEASE ASAP NEED HELP PLEASEEE !!!!

Answers

Answer:

Hunting in groups,  keen eyesight, chemicals to paralyze prey

Explanation:

Answer:

Hunting in groups

Keen Eyesight

and Camouflage

Explanation:

These are all the main adaptations that predators are born with. The rest of them do not help them at all. PLease give brainliest :)

Given the following DNA strand TACGTATGCCGTATGGGCATT

a) What is the DNA compliment to given strand?

b) What is the mRNA compliment to the given strand?​

Answers

Answer:

a) ATGCATACGGCATACCCGTAA

B) AUGCAUACGGCAUACCCGUAA

Explanation:

For the complimentary DNA: Adenine pairs with thymine and cytosine pairs with guanine

For the complimentary mRNA: Because mRNA has no thymine anytime there is an adenine, uracil pairs with it.

What agent of erosion is this? Gravity,wind, waves, running water or glaciers.

Answers

Answer:

wind                                        

Explanation:

The simplest structures that can carry out all of the activities characteristic of life are:
A. cells.
B. atoms.
C. molecules.
D. crystals.

Answers

atoms as they are the simplest

If the food on the island is small seeds, what finch is best adapted? Explain why

Answers

Answer:Adaptation in Darwins Finches. Beak depth, which is correlated with body size and the ability to crack larger seeds, varies according to drought conditions: plants produce fewer, harder seeds in dry years and more, softer seeds in wet years. Only larger birds with deeper depths survive in drought years.

Explanation:

The _______________ rate describes the rate at which the atmosphere gets colder as the air gets thinner at higher altitudes.

Answers

Answer:

Lapse rate

Explanation:

AHHHHSHYNJTNXT WHYYYYY

HURRY. Why is transcription said to be unidirectional?

Answers

Answer:

Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.

Explanation:

Why might Ponyboy have idolized Pual Newman?

Answers

Ponyboy might have idolized Paul Newman because Paul Newman played many rebellious characters who Ponyboy could relate to. Some characters he played were “Fast Eddie” in The Hustler and a Southern chain gang member in Cool Hand Luke.

Rivers that have developed over a long period of time are found in wide valleys with flat, low-lying bottoms. These valleys were
created by the removal of rock and soil through the process of _____.
OA. deposition
B
C. erosion
•D. weathering
glaciation

Answers

Option C i thinkkkkk

The cell part that helps with cell division is the ________​

Answers

Answer:

centrioles

Explanation:

Every animal-like cell has two small organelles called centrioles. They are there to help the cell when it comes time to divide. They are put to work in both the process of mitosis and the process of meiosis.

What is the energy source that allows photosynthesis to occur?

Answers

Answer:

[tex]\boxed {\boxed {\sf The \ sun }}[/tex]

Explanation:

Photosynthesis is a special process that certain organisms (plants, algae, and some bacteria) undergo to create "food".

This turns light energy, carbon dioxide, and water into glucose and oxygen. The glucose becomes the food for the organism, because it is turned into ATP during cellular respiration. The ATP is energy that fuels the processes, like growth, repair, and transport.

This process occurs because of the sun. It provides the light energy needed for the reaction. Organelles inside of the cells, called chloroplasts, contain a pigment (chlorophyll) that captures this energy.

1. Describe how the rotation of Earth on its axis affects the tides. Be sure to include the evidence that supports your answer.

Answers

Answer/Explanation:

During low elevated tides, the Earth itself is pulled marginally toward the moon, making elevated tides on the contrary side of the planet. Earths pivot and the gravitational draw of the sun and moon make tides on our planet. As the sea swells toward the moon, an elevated tide is made.

But because the Earth rotates, circulating air is deflected. Instead of circulating in a straight pattern, the air deflects toward the right in the Northern Hemisphere and toward the left in the Southern Hemisphere, resulting in curved paths. This deflection is called the Coriolis effect.

which level of the food chain is most affected by biomagnification

Answers

Answer:

animals near the top of the food chain are most affected because of a process called biomagnification. Many of the most dangerous toxins settle to the seafloor and then are taken in by organisms that live or feed on bottom sediments.

Explanation:

Have a great one!

Other Questions
Choose all the expressions that are equivalent to 3(2 + 11) 32 + 3113(2) + 3(11)3(2) + 116 + 116 + 333 + 22 I need help please. Only answer if you know What is the author's purpose in including the idea of France in first two sentences of paragraph 7? * 5 points Compared with a longer work, a one-act play: A. Does not follow a traditional plot trajectory. B. Has more complex characters. C. Includes longer stage directions. D. Has much shorter exposition. Last year there were m members in a photography club. This year the number ofmembers has increased by 10%. The expression m + 0.1m represents the number ofmembers in the club this year. What is this expression written in simplest form? what is the mean, mode, median, and range of the numbers 24, 31, 12, 38, 12, and 15 You are rolling a 6-sided number cube with thenumbers 1 through 6. Which of the following representthe probability of rolling an even number?01/61/2 1 You see a lot of logo designs in everyday life. Which logo do you think is the best and why? Give reasons for your answer. Discuss the design characteristics used by the designer to create the logo. The volume of the world's oceans is nearly 1.510^9 cubic kilometers. Write this number in scientific notation. Select a synonym for the word serious. plain earnest playful obvious How easy is it for a poor person to get a loan? Why? (3 -1) y=1/3x-3 write an equation of the line that passes through the given point and is parallel to the given line Helppp me faststttttt plzzzzz Identify the parts of the sentence (subject, verb, direct object, indirect object) in the sentence below:AlboThe students watched a video about the Civil Rights Movement in Social Studies class. The local movie theater decided to raise the ticket prices 75% . The original ticket prices were $12 . Set up the percent equation to find the amount by which the ticket prices rose. Then find the amount. A store receives customer satisfaction ratings that range between 0 and 100. In the first 13 ratings the store received, the average customer satisfaction rating was 75. What is the least value the store can receive for the 14th rating and still be able to have an average of at least 84 for the first 21 ratings? someone help. find the value of a and b whoever solves this with explanation gets brainliestdont scam how did the colonists express their discontent The Republican party would likely oppose all of the following causes EXCEPT:A.lower taxes for the wealthyB.more government interventionC.less power to the statesD.shrinking the military -Er and -ir verb conjugations have the same endings except in the _____ and _____ forms.ustedes, vosotrosyo, vosotrosnosotros, usted (el, ella)nosotros, vosotros