9. Place the events in the correct order:
1. DNA polymerase adds nucleotides in the 5' to 3' direction
2.Replication fork is formed
3. DNA polymerase attaches to the primer
4. Okazaki fragments are bound together by ligase
5. DNA helicase unwinds DNA
ligaset

Answers

Answer 1

The correct order of events of DNA replication is as follows:

DNA helicase unwinds DNAReplication fork is formedDNA polymerase attaches to the primerDNA polymerase adds nucleotides in the 5' to 3' directionOkazaki fragments are bound together by ligase

DNA REPLICATION:

DNA replication is the process by which the DNA of a living organism is multiplied into two identical copies.

DNA is a double-stranded molecule, hence, it must first be separated into two single strands in order to be replicated.

The following are the orderly steps involved in DNA replication:An enzyme called DNA helicase unwinds DNA into single strands. A Y-shaped structure called replication fork is formed by the two single strands.DNA polymerase attaches to the primer, which is a short segment of RNA. DNA polymerase adds nucleotides to the leading strand of DNA in the 5' to 3' directionOkazaki fragments, which are small fragments of DNA are bound together by ligase enzyme and added to the lagging strand.

Learn more at: https://brainly.com/question/16464230?referrer=searchResults


Related Questions

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

when you breathe in air you bring oxygen into your lungs and blow out. A.Carbon dioxide B.oxygen C.carbon monoxide D.hydrogen​

Answers

Answer:

Carbon dioxide

Answer:

Carbon Dioxide

Explanation:

PLEASE HURRY I AM TIMED!!!
Are aliens real? Explain your answer.

Answers

Answer:

No, not according to any sciences (unless you mean aliens as in immigrants)

Explanation:

There is no way that we are the only living thing in the entire world. There has to be another species out there.  They might be wondering if there is another living thing out in space too.

HELP ASAP
A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period. Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October. People born in October were more relaxed and could better handle stress. Is the scientist’s research considered science?
Yes, because the scientist conducted his research for an extended period of time.
Yes, because the scientist followed the scientific method.
No, because the scientist conducted his research with 100 people
No, because the scientist followed personalities which is pseudoscience.

Answers

Answer:

No, because the scientist followed personalities which is pseudoscience.

Explanation:

A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period

Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October.

People born in October were more relaxed and could better handle stress

Is the scientist’s research considered science?

No, this are beliefs not necesarily true.

please help meeeeeeeeeee

Answers

Answer:

D

Explanation:

D like the person above

Arrange these energy sources from highest to lowest percentage of worldwide use. 1, Nuclear 1. Coal * Hydroelectric​

Answers

Explanation:

hydro coal nuclear i think it would like thst

The arrangement of the energy according to the highest to the lowest percentage of worldwide use is coal, hydroelectric and nuclear. The arrangement is 2, 3, and 1.

What is energy?

Energy is a quantitative property that is used in doing any work. The energy is always transferred from one form to another form. It is present in the conserved form.

The energy which is used majorly is coal, then hydroelectricity, which is made by water then the nuclear power plant.

Thus, the arrangement is 2. Coal, 3, hydroelectric, 1. Nuclear energy.

Learn more about energy, here:

https://brainly.com/question/12396199

#SPJ2

20 points and brainliest! Explain how you got the answer!

Answers

Answer:

No of groups studied

As All other factors will effect the result ofvthe experiment.

But no matter how many groups you take to study they will show the same result

HOPE YOU GOT IT!

MARK ME AS BRAINIEST

which layer of the earth is made out of melted metal?

Answers

The outer core. A molten nickle- iron alloy.

How are chromosomes affected by aging

Answers

Answer:

delaying cell senescence, apoptosis, and death

Explanation:

Answer:

the enzyme telomerase adds specific DNA sequence repeats to the chromosome ends that are lost through cell division, thus restoring telomere length and delaying cell senescence, apoptosis, and death

Explanation:

How does evolution result in reproductive success?

Answers

Answer:

Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.

What are the 3 main types of star "corpses"? plz hurry

Answers

Answer: white dwarfs, neutron stars, and black holes

Explanation:

Two offspring from same parents can have different phenotypes. How is this possible?​

Answers

Answer:

Genes come in different varieties, called alleles. Somatic cells contain two alleles for every gene, with one allele provided by each parent of an organism. However, an allele that is hidden, or not expressed by an organism, can still be passed on to that organism's offspring and expressed in a later generation.

Explanation:

Overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

What is heterozygote?

Heterozygote is defined as a person, animal, or other thing possessing a pair of different alleles of a specific gene, one of which is dominant and the other recessive. One normal allele and one mutated allele, or two distinct mutated alleles, can make up a heterozygous genotype.

The explanation is connected to the fact that each parent has two different gene pools. Furthermore, only 50 percent of each parent's DNA is transferred to their offspring. and that the portion that is passed down is random. Every child has a unique set of genes thanks to the interaction of all these influences.

Thus, overdominance, in instance, happens when a heterozygote exhibits a more extreme phenotype than either of its parents.

To learn more about heterozygote, refer to the link below:

https://brainly.com/question/12891396

#SPJ2

Please help me due tonight!

Answers

Answer:

Meiosis I ==> Interphase - Prophase - Metaphase - Anaphase - Telaphse - genes

Meiosis II ==> Prophase - Metaphase - Anaphase - Telaphase - genes

unlike mitosis which has only one form

the final phase of mitosis characterized by the separated chromosomes reaching the poles
of the cell. The nuclear membrane and nucleolus begins to reappear around each set of
chromosomes

Answers

Answer:

Telophase

Explanation:

Researchers have found that mitochondria and chloroplasts in eukaryotic cells have their own DNA. This DNA is different from the DNA in a eukaryotic cell's nucleus. Chloroplasts and mitochondria use their own DNA and ribosomes to make some organelle-specific proteins.

What statement is best supported by this information?

A.
Modern cells could exist without mitochondria and chloroplasts.
B.
Early prokaryotic cells engulfed eukaryotic cells, which later became mitochondria and chloroplasts.
C.
Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.
D.
Mitochondria and chloroplasts could exist outside of modern cells.

Answers

Answer:

B.

Explanation:

Answer: Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.

Explanation: just did the test its right.

How is evaporation related to precipitation?

Answers

Since Precipitation is rain evaporation is water which is turning in to gas and goes to the air or atmosphere

The folded plasma membrane inside the cell is the ______.
A: endoplasmic reticulum
B: mitochondria
C: vacuole
D: vesicle

Answers

A is the answer because this the only thing that folds

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-

submit this form. Not you? Switch account
* Required
3. How do the biotic factors in an ecosystem depend on the abiotic factors

Answers

Answer:

biotic factors depend on abiotic factors for survival

Explanation:

i need some help on this i dont know can someone plz help me

Answers

Answer:

D is your answer I believe

Look at the plant in the picture below.
This plant is vascular but does not produce seeds. To which of the following groups does this plant belong?
A. flowering plants
B.
conifers
C.
ferns
D.
mosses

Answers

The answer is C. At first I thought it was D but it actually belongs to clubmosses

The following groups of plant belongs to ferns.

What are the characteristics of ferns?

A fern is a member of a group of vascular plants that reproduce via spores and have neither seeds nor flowers.

In their natural environment, most ferns grow in humid forests or on the bank of a water source, so they generally require very moist soil. Even fern varieties that become drought tolerant as they mature usually require moist soil at planting time.

Similar to flowering plants, ferns have roots, stems and leaves. However, unlike flowering plants, ferns do not have flowers or seeds; instead, they usually reproduce sexually by tiny spores or sometimes can reproduce vegetatively, as exemplified by the walking fern.

Learn more about ferns:

https://brainly.com/question/9505707

#SPJ2


Which of the following characteristics of carbon is responsible for the variety of carbon-based molecules on Earth?

Answers

Answer:

It can form bonds.

Explanation:

(I'm in ap bio  so I know a lot, lol, hope that helps)

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......

A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False

Answers

Answer:

Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.

Answer:

False

Explanation:

all you need is in the photo ​

Answers

Answer:

Aerobic means 'with air' and refers to the body producing energy with the use of oxygen. This typically involves any exercise that lasts longer than two minutes in duration. ... Anaerobic means 'without air' and refers to the body producing energy without oxygen.

Explanation:

hope this helps if not i'll try to figure out the answer for you

What is the difference between a detritivore and a decomposer?
A.While detritivores consume animals, decomposers only consume plants.
B. While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.
C. While detritivores consume both plants and animals, decomposers only consume dead animals.
D. While detritivores are heterotrophic, decomposers are autotrophic.

Answers

What are detrivores?

Detritivores are organisms that feed on the organic waste of dead plants and animals

What are decomposers?

Decomposers are organisms that break down dead or decaying organisms; they carry out decomposition, a process possible by only certain kingdoms, such as fungi. Decomposers are the organisms that decompose dead plants and animals.

Difference between detrivores and decomposers

Option C is the the correct answer

While detritivores consume both plants and animals, decomposers only consume dead animals.

Read more about organisms

https://brainly.com/question/25832580

Answer:

While detritivores feed on dead organic matter, decomposers actually break down dead or decaying organisms.

Explanation:

The answer explains itself. It is accurate information. :) Have a good day!

WILL MARK BRAINLIEST!!!!Which of the following processes express the information encoded by DNA
and RNA?
A. Transcription and translation
O B. Asexual and sexual reproduction
C. Photosynthesis and respiration
D. Mitosis and meiosis

Answers

Answer:

C

Explanation:

Thats the tea

Hope this helps ;)

The process that expresses the information encoded by DNA and RNA is Transcription and translation, so option A is correct. Transcription is the process by which the genetic information stored in DNA is transcribed into RNA.

Transcription is the process by which the genetic information stored in DNA is transcribed into RNA. It involves the synthesis of an RNA molecule using one strand of DNA as a template. The resulting RNA molecule, known as messenger RNA (mRNA), carries the genetic information from the DNA to the site of protein synthesis. Translation, on the other hand, is the process by which the information encoded in mRNA is used to synthesize a specific protein. It takes place in ribosomes, where transfer RNA (tRNA) molecules interpret the genetic code on the mRNA and bring the corresponding amino acids to assemble the protein chain.

Learn more about transcription and translation here.

https://brainly.com/question/29979094

#SPJ2

Why do you think that some definitions of forest have a certain percentage of the land that must be covered in trees?

Answers

Answer:

30 percent tree cover - 2000 - 2009JPEG ... of forest cover vary widely—as much as 6 percent of Earth's land area, or the equivalent area of China.

Explanation:

Which other food items were digested by lactase, the enzyme that breaks down milk?

Answers

Answer:

im not sure what you mean by this question but ill answer the best way i can!

Explanation:

Bread and baked goodsMilk chocolate and some candiesSalad dressings and saucesBreakfast cereals and cereal barsInstant potatoes, soups, rice and noodle mixesLunch meats (other than kosher)Cheese flavored crackers and other snacks

these are foods containing lactose in them, which lactase breaks down.

hope this helps!

Other Questions
Lanc le 26 novembre 2011, le Rover Curiosity de la Nasa est charg d'analyser la plante Mars. il a atterri sur la plante rouge le 6 aot 2012, parcourant ainsi une distance d'environ 560 millions de kilomtres en 255 jours. quelle est la dure du vol? 2008 crisis question. plz help do in few mins Would you have worked for a joint-stock company? Why or Why not? Which best characterizes Russia in the early 1900s?The government was attempting to repair an aging infrastructure.The wealthy class was growing due to a boom in employment.The military was using force to subdue uprisings caused by famine.The economy was stalled because there was nothing to export. HELP ASAP!!Which of the following depicts early city life?Running water was a great benefit.There was a remendous lack of space.It was very inexpensive to live in the city.City life made one feel independent. Robert's got a quick handHe'll look around the room he won't tell you his planHe's got a rolled cigaretteHanging out his mouth, he's a cowboy kidYeah, he found a six shooter gunIn his dad's closet, in a box of fun thingsAnd I don't even know whatBut he's coming for you, yeah, he's coming for youAll the other kids with the pumped up kicksYou better run, better run, outrun my gunAll the other kids with the pumped up kicksYou better run, better run faster than my bulletAll the other kids with the pumped up kicksYou better run, better run, outrun my gunAll the other kids with the pumped up kicksYou better run, better run faster than my bulletDaddy works a long dayHe's coming home late, yeah, he's coming home lateAnd he's bringing me a surpriseCause dinner's in the kitchen and it's packed in iceI've waited for a long timeYeah, the slight of my hand is now a quick pull triggerI reason with my cigaretteThen say your hair's on fireYou must have lost your wits, yeahAll the other kids with the pumped up kicksYou better run, better run, outrun my gunAll the other kids with the pumped up kicksYou better run, better run faster than my bulletAll the other kids with the pumped up kicksYou better run, better run, outrun my gunAll the other kids with the pumped up kicksYou better run, better run faster than my bulletAll the other kids with the pumped up kicksYou better run, better run, outrun my gunAll the other kids with the pumped up kicksYou better run, better run faster than my bulletAll the other kids with the pumped up kicksYou better run, better run, outrun my gunAll the other kids with the pumped up kicksYou better run, better run faster than my bulletAll the other kids with the pumped up kicksYou better run, better run, outrun my gunAll the other kids with the pumped up kicksYou better run, better run faster than my bullet What mass of potassium would react with excess chlorine to produce 156 g of potassium chloride?____ K + ____ Cl2 ____ KCl 3. Which equation illustrates the associativeproperty of addition?A. (x + y) + 3 = x + (y + 3)B. 3(x + y) = 3x + 3yC. x + y = y + xD. x + 0 = x 10 points ill give brainliestttttttttttttttttt Warmer temperatures at the Earth's poles could change atmospheric circulation and wind patterns. Propose a solution for how communities near the poles can prepare for these changes in wind. Which of the following was an accomplishment of the New Deal? A Wealth was radically redistributed. B Farmers received a guaranteed 40 acres of land. C Impoverished children were provided with free college education. D Government provided work programs for the unemployed. Select the following three roles in a business that do not carry personal liability for any judgments against the company.the owner in a sole proprietorshipa limited partner in a partnershipa general partnera corporation shareholderthe CEO of a major corporation A water taxi travels around an island in a path that can be modeled by the equation y=0.5(x-14)^2 . A water skier is skiing along a path that begins at the point (6,4) and ends at the point (8,4)Write a system of equations to model the problem. Is it possible that the water skier could collide with the taxi? Explain Find the slope intercept equation of the line a man is twice as old as his son. 20 years ago the sum of their age is 85 Which type of evidence is not permitted to be shipped by mail to a crime lab?A) Strands of fiber, stained with bloodB) A shirt that showed signs of gunshot resideC) A bomb a suspect intended to use in a crimeD) Blood samples intended to be analyzed for DNA comparisons QS and TV are parallel lines.Which angles are alternate exterior angles?the options are ill give brainliest Qu aspectos del pas ha seleccionado el autor para incluir en su poema?