A carpenter builds a tree house in the shape of a rectangular
prism. The tree house has a base that measures 8 feet long and 6
feet wide, and its volume is 312 cubic feet.
What is the height of the tree house?

Answers

Answer 1

Answer:

6.5 feet

Step-by-step explanation:

V = lwh

Plug-in the numbers given and solve for h

312 = 8(6)h

312 = 48h

312/48 48h/48

h = 6.5 feet


Related Questions

The radian measure of an angle that is 125° 25' 50° is
O A. 2.25 radians
B. 2.20 radians
C. 2.19 radians
D. 3.49 radians

Answers

Answer:

C. 2.19 radians

Step-by-step explanation:

hope it helps you

Which equation has the solution x = 5?


Select each correct answer.


18−2x=9

32−4x=12

11 + 6x = 22

25x+4=9

x5+5=6

3x + 1 = 9

Answers

32-4x=12
is the only one i see that x = 5

The price for 3 protein bars $3.75, and the price of 3 fruit cups is $1.50. Write the equation
that represents the relationship between the number of protein bars, x, and fruit cups, y,
that you can buy with $15.50.

How many fruit cups can you buy with 4 protein bars?

Answers

Answer:

7 fruit cups

Step-by-step explanation:

$3.75/3x + $1.50y = $15.50

So, if you have 4 protein bars, the equation would read:

1.25x + 1.5y = 15.5

1.25(4) + 1.5y = 15.5

5 + 1.5y = 15.5

1.5y = 10.5

y = 7

Very confused what’s the answer?

Answers

Answer:

T

F

F

Step-by-step explanation:

I took the test

HELP AND HURRY UP pleas

Answers

Answer:

y=0

Step-by-step explanation:

a horizontal line is equal to y being 0.

The points N(-4,3)(−4,3), O(-4,-3)(−4,−3), and P(5,3)(5,3) form a triangle. Plot the points then click the "Graph Triangle" button. Then find the perimeter of the triangle. Round your answer to the nearest tenth if necessary.

Answers

The perimeter of the triangle = 25.8 units.

What is the Perimeter of a Triangle?

Perimeter = the sum of the length of all three sides

Given:

N(-4,3)

O(-4,-3)

P(5,3)

Perimeter of triangle NOP = NO + OP + NP

Find NO:

NO = |3 - (-3)| = 6 units

Find NP:

NP = |-4 - 5| = 9 units

Using the distance formula, find OP:

OP = 10.8 units

Therefore, Perimeter of the triangle = 10.8 + 9 + 6 = 25.8 units.

Learn more about perimeter of triangle on:

https://brainly.com/question/24382052

A CEO wondered if her company received either more or less complaints from its workers on Monday than any other day. She figured that if it were truly random, 20% of the complaints should have been filed on Monday. She randomly selected 50 complaints and checked the day that they were submitted. In those complaints 13 were submitted on a Monday. The CEO conducts a one-proportion hypothesis test at the 5% significance level, to test whether the true proportion of complaints submitted on a Monday is different from 20%. (a) Which answer choice shows the correct null and alternative hypotheses for this test?

Answers

Answer:

test statistic: 1.061    p-value: 0.289

Step-by-step explanation:

solve the following please!
with steps

Answers

Answer:

X=-7

Step-by-step explanation:

X*5-4=3(X*3+8)

5x-4=9x+24

-4=4x+24

-28=4x

-7=x

1. Find the area.
7in
5in
3in

Answers

First we need to find the length of the missing triangle side which we can do with Pythagorean theorem
A2+B2=C2
5^2+3^2= x^2
25+9=x^2
34=x^2
You square booth sides and end up with a decimal of 5.831 rounded for the missing side.
Area for a rectangle is length times width so we multiply 7x5.831=40.817
Area of a triangle is the height times the base divided by 2 so 5.831x3= 17.493
Then you add those to together for the total area of the shape 40.817+17.493=58.31
58.31 is your approximate answer.

How many triangles can be formed with segments measuring 4.72 yd, 6.31 yd, and 1.67 yd?

none

one

more than one

Answers

Answer: Sometimes, two or more different triangles can be made with three given measures. For example, here are two different triangles that can be made with an angle measuring and side lengths 6 and 8. Notice the angle is not between the given sides.

Step-by-step explanation:

Kimberly has a credit card with a 19% APR and a balance of $4,350. With her current monthly payment, Kimberly will be able to pay off the credit card in a mere 16 months. But when Kimberly's car breaks down, she is forced to charge an additional $1,600 to her credit card. How much will Kimberly's minimum monthly payment increase if she still wants to pay off her credit card in 16 months? a. $100. 00 b. $113. 99 c. $309. 90 d. $423. 89.

Answers

Answer:

19%=0.19+$4,350/16=$272+$1,600=$1872+0.19=1872.19/12=$156+$4,50=

$375.50

Answer: C. $309.

Step-by-step explanation:

Answer:

✅ b. $113.99

i took the test⬇️

1. Find the area.
7in
5in
3in

Answers

Answer:

Step-by-step explanation:

Identify the transformations of the graph

Answers

Answer:

Ans is D

Step-by-step explanation:

Can someone please solve these up to 8? ( if you can do up to 13 even better)

Answers

Answer:

1. some rectangles are squares

2. all rhombuses are quadrilaterals

3. no squares are triangles

4. some rectangles are regular quadrilaterals (squares are rectangles)

5. some quadrilaterals have four congruent angles

6. no rectangles are rhombuses

7. all squares are regular quadrilaterals

8. some parallelograms have four congruent angles

3/5 x 1/3 Show your work as well

Answers

Answer:

1/5 to simplest terms

Step-by-step explanation:

[tex]\frac{3}{5}[/tex]×[tex]\frac{1}{3}[/tex]
To do this you simply multiply the numerators and you multiply the denominators:
3×1=3 (numerator)
5×3=15 (denominator)
[tex]\frac{3}{15}[/tex] = 1/5
To do the last step of making 3/15 to 1/5 I divided top and bottom by 3, that is how you simplify a fraction

Create a rule to find the nth term.
4096, 2048, 1024, ...

Answers

Answer:

n=4096+(n-1)*-2048

Step-by-step explanation:

Landon has 76 dinosaurs, but he gives his sister 13 of them to play with. Then he put his dinosaurs into 9 groups. How many dinosaurs are in each group?

Answers

Answer:

7 groups

Step-by-step explanation:

76-13 is 63

63 divided by 9 is 7

Answer:

7

Step-by-step explanation:

Subtract 13 dinosaurs from the 76 original dinosaurs

76-13 = 63

Now divide them into 9 groups

63/9 = 7

There are 7 dinosaurs in each group

5. What is the distance from V to W? V=8 cm W 15 cm m<VW= 90​

Answers

Answer:

17 cm

Step-by-step explanation:

If the angle between V and W is 90°, then this implies that V and W are legs of a right triangle (and the distance between them is the hypotenuse).

Use Pythagoras' Theorem a² + b² = c², where a and b are the legs and c is the hypotenuse of a right triangle.

Let D = distance between V and W:

⇒ V² + W² = D²

⇒ 8² + 15² = D²

⇒ 289 = D²

⇒ D = √289

⇒ D = 17

Therefore, the distance from V to W is 17 cm

[tex]\huge \boxed{\sf 17\ cm}[/tex]

Pythagoras discovered that the square of the hypotenuse of a right-angled triangle, where one of the angles is 90 degrees, equals the sum of the squares of the other two sides.

[tex]\sf a^2 + b^2=c^2\\\\8^2 + 15^2=c^2\\\\ \sqrt{8^2 + 15^2} =c\\\\17=c[/tex]

what is the nearest tenth of 448,655.75, 4,478 and 27,591.769064

Answers

Answer:

The nearest tenths of 448,655.75, 4,478 and 27,591.769064 is 7

Rohan draws a circle of radius 10 cm with the help of compass and scale. He also draws two chords, AB and CD in such a way that AB and CD are 6 cm and 8 cm from the centre O. Now, he has some doubts that are given below. Help him out by answering these questions:

a)what will be the chord of ab?
b)what wil be the chord of cd?​

Answers

Answer:

a) 16 cmb) 12 cm

Step-by-step explanation:

Connect the center with A and C:

OA = 10 cm or OC = 10 cm

Use Pythagorean to find half of AB:

[tex]AB/2=\sqrt{10^2-6^2} =\sqrt{64} =8[/tex][tex]AB = 16[/tex]

Similarly, find the length of CD:

[tex]CD/2=\sqrt{10^2-8^2} =\sqrt{36} =6[/tex][tex]CD=12[/tex]

Length of AB = 16 cm

h² = p² + b²

10² = 6² + b²

100 = 36 + b²

[tex]b = \sqrt{64} [/tex]

[tex]= 8 cm[/tex]

[tex]AB = 8 + 8[/tex]

[tex]= 16 cm[/tex]

A ski resort charges $55 for renting a snowboardor skis
and $1 per hour for a lift ticket. If Julian spent a total of
$121, how many hours was he there?

Answers

Answer: 66 hours

Step-by-step explanation:

$121 - 55$(one time payment) = 66 hours

1 * 66 = 66

Answer:

66 Hours

Step-by-step explanation:

Let X represent the number of hours

Step 1 Equation:
55 + 1x = 121

Step 2 Inverse Operation:
121 - 55 = X
121 - 55 = 66

Step 3 Answer:
X = 66

Step 4 Check:
55 + 1(66) = 121

(x + 2)(x/4 - 7) multiple the following algebraic expressions

Answers

answer:

[tex]\frac{x^2}{4}-\frac{13x}{2}-14[/tex]

steps:

[tex]\left(x\:+\:2\right)\left(\frac{x}{4}\:-\:7\right)[/tex]

[tex](x)(\frac{x}{4})-7x +\frac{2x}{4} -14[/tex]

[tex]\frac{x^2}{4} -7x+\frac{2x}{4} -14[/tex]

[tex]\frac{x^2 -28x + 2x -56}{4}[/tex]

[tex]\frac{x^2 -26x -56}{4}[/tex]

[tex]\frac{x^2}{4}-\frac{13x}{2}-14[/tex]

[tex](x + 2) ( \frac{x}{4} - 7)[/tex]

[tex](x) ( \frac{x}{4} ) − 7x + \frac{2x}{4} - 14[/tex]

[tex] \frac{ {x}^{2} }{4} - 7x + \frac{2x}{4} - 14[/tex]

[tex] \frac{ {x}^{2}-28x+2x-56 }{4} [/tex]

[tex]\frac{{x}^{2} - {26}^{2} - 56}{4} [/tex]

how to find x in a parallelogram?

Answers

Answer:

Step-by-step explanation:

the shape is a parallelogram => angle E = angle G & angle F= angle D;

=> 11x-2=132

11x=134

x=12,(18)degree

Find the perimeter and area of this triangle below.

Area: Perimeter:

Answers

Answer:

area = 79.1cm²

perimeter = 41cm

Answer:

Area of triangle=b*h*1/2

Area of triangle having-

Base- 14cm

Height/Altitude-11.3cm

Area= 14*11.3*1/2

=158.2/2

=79.1cm square

Perimeter of Triangle= side+side+side

=15+14+12

=29+12

=41cm

Step-by-step explanation:

-

solve: y = 3x - 4
y = x + 2

Answers

Answer:

y = 5

Step-by-step explanation:

Isolate x to plug in to other equation

y   =   x  +  2

-y-x     -y-x

(- x = -y + 2) / -1

x = y - 2

Plug into other equation

y = 3(y-2) - 4

Distribute

y = 3y-6-4

y = 3y-10

-3y  -3y

(-2y = -10)/-2

y = 5

Milo is making 1 1/2 batches of muffins for a bake sell. If each batch of muffins calls for 1 3/4,how many cups of flour will he need ?

Answers

Answer:

2 5/8

Step-by-step explanation:

Because she has one whole batch of cookies that will require 1 3/4 of flour. Since the remainder is a 1/2 batch, you would have to half the 1 3/4. Halfing 1 3/4 is 7/8. You add 1 3/4 + 7/8 and you get 2 5/8.

if the legs of a triangle are 6cm and 5cm, find the area of the triangle

Answers

15 cm^2


A= 5*6/2= 30/2= 15 cm^2

Answer:

A = 15cm^2

Step-by-step explanation:

A = bxh/2

A= 5x6/2

A=30/2

A=15cm^2

A checking account earns 2.5% simple interest. How much would be earned by an account with $3,400 in after 3 years? *

Answers

Answer: $3,400*2.5%*3=$255

Find the perimeter. Simplify your answer.

Answers

Answer: 20c^2+7c-6 (ADD LIKE TERMS)

Answer:

[tex]p=20c^{2} +7c-6[/tex]

Step-by-step explanation:

[tex]p=5c^{2} +15c^{2} +8c+c-2c+6-9-3[/tex]

[tex]p=20c^{2} +7c-6[/tex]

Hope this helps

The volume of a right circular cylinder is 1100 cm3 and the radius of its base is 5 cm. Calculate its curved surface area.

(A) 410 cm2 (B) 125 cm2 (C) 440 cm2​

Answers

Answer:

c

Step-by-step explanation:

t r r rt t t 4 4. 54. 54. 54 4. rr. rt t. t

Answer: A

Step-by-step explanation: πr2 h =  1100 cm³

Here r = 5

(22/7) ⋅ (5)2 ⋅ h  =  1100

h  = 2/7

Curved surface area of cylinder  =  2 πr h

=  2 ⋅ (22/7) ⋅ 5 ⋅ (2/7)

=  440 cm²

So, the curved surface area of cylinder is  440 cm²

Other Questions
Which organelle do alga need in order to conduct photosynthesis?. What action-reaction forces are involved when a rocket engine fires? Why doesn't a rocket need air to push on? GIVING BRAINLIEST FOR BEST ANSWER!Solve one and three fourths times two fourths.A) Fourteen sixteenthsB) Fifteen sixteenthsC) Seventeen sixteenthsD) Eighteen sixteenths In what ways can poetry be useful in better understanding both others and ourselves? What types of planning can be done to improve a nations economy? A nation can undergo planning or planning in order to improve its economy. Consider a gas at STP in a container of 22. 4 L. What is the approximate value of n according to the ideal gas law? 0. 5 1 2008. 31 224. Look at the screen shot when german troops entered Austria, Hitler announced the Anschluss or unification of Austria and germany Fast food restaurants are often robbed by employees or former employees. True or false can someone help me on these questions please!! the questions are give an example of how the principal progression could be applied to this workout overtimeAnd if your primary goal was to increase flexibility would this work out be a good example of the principal of specificity?why or why not What is the historical significance of theSupreme Court case McCulloch v. Maryland(1819)? The English bill of rights laid the foundation What is the value of the expression below when y=5y=5?4y to the second power-7y-6PLEASE HELP MEH!!!!!! What three formats/objects function in precisely the same way to create an image?A. A pinhole camera, a large format camera and a Camera Obscura.B. All of the other answers.C. A Camera Obscura, Talbot's Mouse Trap camera, and a large format camera.D. None of the other answers. find the measure of the indicated angle Which form of poetry expresses feelings or ideas about a topic?Group of answer choices1. lyric poetry2. narrative poetry3. musical poetry4. tragic poetry Please help if you answer correctly I will give brainliest thank you!!!!!!!! A field is a rectangle with a perimeter of 960 feet. The length is 400 feet more than the width. Find the width and length of the rectangular field. CSI Miami: Using DNA to Solve a RobberyThe year is 2023. You are a detective for the Miami Dade Police Department. Youre on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the mans blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run. Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person. On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.methionine-leucine-proline = Protein that causes DARK SKINmethionine-leucine-leucine = Protein that causes LIGHT SKINvaline-proline-proline-lysine = Protein that causes GREEN EYESproline-leucine-valine-proline = Protein that causes BLUE EYESproline-lysine-proline-proline = Protein that causes BROWN EYESlysine-arginine-threonine-valine-serine-serine = BLOND HAIRlysine-arginine-threonine-valine-serine-cystine = BLACK HAIRlysine-arginine-threonine-valine-serine-valine = BROWN HAIRasparagine-isoleucine-arginine = CURLY HAIRasparagine-asparagine-isoleucine = STRAIGHT HAIRleucine-arginine-glutamic acid-arginine = BIG NOSEleucine-asparagine-arginine-glutamic acid = SMALL NOSEleucine-asparagine-asparagine-glutamic acid = MEDIUM NOSEproline-tyrosine-tyrosine-(stop) = SMALL EARSproline-proline-tyrosine-(stop) = MEDIUM EARS proline-tyrosine-phenylalanine-(stop) = BIG EARS Step 1: Decode the DNA into mRNAStep 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with. DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC | | |AUGmRNA:Protein Sequence: 1. Methionine 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?Step 5: Answer the following wrap-up questions:1) When you performed step 1, what enzyme were you imitating?2) In step 2, what molecule would have brought the amino acids that the codons asked for?3) In step 2, what molecule would have helped the amino acids line up and attach to one another?4) In step 2, what connected the amino acids together? What does In Truth's day-star mean in Edgar Allan Poe poem A Dream