A mini-boat launched in 2020 by students in new hampshire was lost at sea before recently turning up in what european nation, whose capital is oslo?.

Answers

Answer 1

The nation with its capital as Oslo where a mini-boat launched in 2020 turned up at was Norway.

Where is Oslo?

Oslo is the capital of the Scandinavian nation of Norway which is located in Northern Europe.

In the year 2020, a mini-boat was launched by American students and the tides took it to the North Sea where it was discovered in Norway.

In conclusion, this was Norway.

Find out more on Scandinavian nations at https://brainly.com/question/26268624.


Related Questions

Applying the first formulation of the categorical imperative to the act of lying to a friend would show that the action is impermissible because :___________.
a. the action's maxim cannot be universalized.
b. performing the action would treat the friend as an end, not as a means.
c. performing the action would treat the friend as a means to an end.
d. the action's maxim can be universalized.

Answers

Applying the first formulation of the categorical imperative to the act of lying to a friend would show that the action is impermissible because :___________.

a. the action's maxim cannot be universalized.

What is the name of the best selling gum in the united states?.

Answers

Answer:

The name is Wrigley's Double Mint.

Dr. Smith is exploring the effects of bullying on children's self-esteem. In order to conduct her research, she decides to interview children at a local school about their experiences with bullies. What are the units of analysis for this study?
a. The children being interviewed
b. Bullies
c. The local school
d. All of the above
e. None of the above

Answers

Answer:

its A

Explanation:

______ is a phenomenon in which a person who is deprived of REM sleep during one night experiences greatly increased amounts of REM sleep the next night.

Answers

The answer is REM Rebound

What happens during a drought?
A. Sea levels rise and winds force large amounts of water over land and people.
B. A strong storm with powerful winds and heavy rains occurs.
C. There is a long period of time with little or no rain.
D. Severe heat lasts for several days or weeks.
there's im doin a test there's gonna be a lot ​

Answers

Answer:

D

Explanation:

droughts are caused by a large amount of heat and lack of water

D.
Would be the correct answer

Everyone says the oldest son seems to have the “perfect family”. Is this true? Explain.

Answers

not necessarily

the oldest usualy has to learn everything whilst the younger siblings can just watch and learn this rule aplies to pritty much everything i. life

Which statement best expresses the central idea of "The Morns Are Meeker Than They Were"? help me fast i need this rn
A Nature is unchanging.
B Nature is forever changing.
C Nature is unremarkable.
D Nature is mysterious.

Answers

i’m pretty sure the answer would be B because it is the one that makes the most sense.

Answer:

Oh its B "Nature is forever changing."

Explanation:

I know someone already answered this but I wanted to chime in too :)

HELP ASAP!!
why you think this inequality led to unrest in France and contributed to revolution?

Answers

Answer: Large expenditures by the French monarchy caused dissatisfaction among the people who began to view its leaders wasteful while they suffered due to poor economic state of the nation. This in turn led to national unrest and ultimately the Revolution.

Explanation:

*economics*
True or False, The marginal cost of production is the constant in cost that
comes from making more of something?

Answers

Answer:

I'm inclined to think yes because the marginal cost of production is the change in total production cost that comes from making or producing one additional unit

The marginal cost of production is the constant cost that comes from making more of something is the true statement.

What is the marginal cost?

Marginal cost is the concept of economics, it is defined as the additional cost incurred for making the additional unit of output.

It is the addition made to the total cost, it is also called the firm's supply curve when it is constant. It is constant when the total cost of any product is constant.

The formal Marginal cost is:

[tex]\text{MC}=\dfrac{\triangle \rm{TC}}{\triangle Q}[/tex]

Where MC is marginal cost and TC is the total cost.

Therefore, the above statement is true.

To learn more about the marginal cost, refer to:

https://brainly.com/question/7781429

Giving brainiest if answered correctly! <3
thank you.

Answers

Answer:

the church hope this helps

the Roman Catholic Church

How should you remove a beaker from a hot plate after heating it?.

Answers

Answer: One of the students should place a wire gauze on the lab station to set the beaker on. Using the beaker tongs, one of the students should gently remove the beaker from the hot plate and set it down on to the wire gauze.

13) People who travel to places
within their home region are
called

Answers

Answer: Migrants

Explanation:

An immigrant travels across foreign border while a migrant travels within their own region.

Which was the most casual category of regency clothing?.

Answers

Answer: The correct answer is Undress

Explanation: I don't mean undress like that way but in the Regency Clothing way

“Undress” simply meant casual, informal dress in the Regency period. This type of dress was worn from early morning to noon or perhaps as late as four or five, depending on one's engagements for the day. Undress was more comfortable, more casual, much warmer, and cheaper than Half Dress or Full Dress.

Where are tornadoes most common in the united states.

Answers

Answer:

Most tornadoes are found in the Great Plains of the central United States – an ideal environment for the formation of severe thunderstorms. In this area, known as Tornado Alley, storms are caused when dry cold air moving south from Canada meets warm moist air traveling north from the Gulf of Mexico.

Despite South Africa's status as the second-largest economy in Africa, 25% of the nation's population lives on what amount per day

less than $1.00
less than $2.00
about $5.00
about $10.00

Answers

Answer:

some say its 5 dollars and some say its a dollar i believe the dollar

Explanation:

Professors will likely expect you to read the textbook before class, take notes during class, and study between classes. These expectations are unwritten assumptions, which sociologists refer to as: Unreasonable expectations Group norms Hidden rules Primary roles

Answers

The information regarding Professors expecting an individual to take notes, etc is known as hidden rules.

What are hidden rules?

Hidden rules simply means the lessons that are taught informally and unitentionally in a school.

In such a case, Professors will likely expect you to read the textbook before class, take notes during class, and study between classes.

These expectations are unwritten assumptions, which sociologists call hidden rules.

Learn more about rules on:

https://brainly.com/question/5707732

Is there going to be a second season of ginny and georgia.

Answers

Answer: Yes! On April 19, Netflix confirmed Ginny & Georgia was renewed for a second season.

Answer: YES!!! ON JANUARY 5 IM SO EXCITED!!!!!!!!!!!!!!!!1

Explanation:

Hammurabi's political success resulted from his:_________
A. destruction of the Sumerian concept of urban kingship.
B. conquest of Egypt.
C. destruction of existing Mesopotamian culture and establishment of the ascendancy of Babylonian culture.
D. linking of the Semitic concept of the tribal chief with that of the Sumerian urban kingship.

Answers

Answer:

C

Explanation:

He conquered the Gutians, the Elamites, and the Cassites, as well as Semitic states to the west and the Assyrian Empire. Afterwards he finally controlled the whole Mesopotamia which contributed to the rise of Babylon.

Hammurabi's political success resulted from his destruction of existing Mesopotamian culture and establishment of the ascendancy of Babylonian culture. Hence, option C is correct.

How was Hammurabi successful?

The balance of power in Mesopotamia was moved from the south to the north by Hammurabi, who conquered southern Babylonia, expanded a tiny city-state into a sizable territorial state, and left it there for more than a thousand years.

During and during his rule, the nickname "Hammurabi-ili," which means "Hammurabi is my god," spread. In texts dated shortly after his passing, Hammurabi is mostly remembered for three accomplishments: bringing about peace, bringing about justice, and bringing about victory in battle.

The ancient Babylonian monarch Hammurabi is most known for the Code of Hammurabi, which was inscribed on human-sized stone pillars that he placed in the towns of his kingdom, more than 3,800 years after he came to power.

Thus, option C is correct.

For more information about Hammurabi's political success, click here

https://brainly.com/question/495826

#SPJ2

A choppy stop-start pattern of operant responding is associated with the ________ schedule of reinforcement.

Answers

Answer: Fixed-Interval

Explanation:

Globally, sea levels have risen by _____ inches over the past 100 years.
to who ever answers this gets brainlist and 100 points

Answers

Answer:

it’s risen approximately 8 inches globally

Anna works as a sales executive. She has difficulty meeting her productivity targets, but she has high readiness levels and her work exceeds quality standards. However, her manager considers her to be a poor performer due to her issue with productivity. In the given scenario, the manager’s evaluation of Anna's performance is an example of the _____.
a) fundamental
b) attribution error
c) halo effect
d) self-serving bias
e) perceptual defense

Answers

In this case, the manager’s evaluation of Anna's performance is an example of the halo effect".

What is halo effect?

The "halo effect can be described as an effect which occurred when one trait of a person is used as a yardstick to make overall judgment of that person or thing.

That's in the case of Anna was seen as someone having difficulty meeting her productivity targets.

Learn more about halo effect" at;

https://brainly.com/question/26493584

First Amendment Congress shall make no law respecting an establishment of religion, or prohibiting the free exercise there of; or abridging the freedom of speech, or of the press; or the right of the people peaceably to assemble, and to petition the Government for a redress of grievances. Based on the First Amendment, which statement can you assume to be true about the Founding Fathers? (4 points)
A. They believed government would not make laws that affected rights.
B. They were concerned the people would not rally behind a single religion.
C. They were concerned about the government having too much power.
D. They believed the proper role of citizens was to leave politics to their leaders.

Answers

Answer:

C. They were concerned about the government having too much power.

Explanation:

The founding fathers were concerned that the government would have too much power.

what kind if water is drinkable?​

Answers

Answer:

all kind of water is not drinkable if that's possible then problem of water shortages will short

Answer:

mineral-infused kind

Explanation:

hope this helps

Which effective encoding strategy is an attempt to help us encode information in ways that our brains are designed to use?.

Answers

A Adaptive memory strategies

Two cultural views that affect relationships negatively

Answers

Answer:If someone wants to marry with a woman from another culture, it would be hard to.

And also because some countries hate each other so marriages can't be accepted

Explanation:

The Security Classification Guide (SCG) states: (C) Cpl Rice and Sgt Davis are attending the joint exercise. (U) The exercise begins 1 May. (C) The name of the exercise is Jagged Edge. (S) The name of the attendees and the name of the exercise. The new document states: *(C) Cpl Rice and Sgt Davis will both be attending the Jagged Edge exercise. *Note: The compilation of attendees and the name of the exercise within the same document is classified as SECRET per the SCG. What concept is used to derivatively classify the statement in the new document?

Answers

There are different kinds of concept. The Revealed By concept is often used to derivatively classify the statement in the new document.

What is a security classification guide?

This is often known to be a record of all the original classification decisions made that is often employed as a source document when developing  classified documents.

The OCAs are admonished to often publish security classification guides to boast a well derivatively standardized and good classification management program.

learn more about security classification guide from

https://brainly.com/question/14294203

What does Snow White have to do with German nationalism?

Answers

Answer:

During the nineteenth century, the idea of a distinct German people with a common language and a homeland in Central Europe was more than an ambition of political leaders.  They were written to create an imagined past that would give German-speakers a unified history and culture.

Explanation:

The rates of ____________________________ among anxiety disorders are high because they share the common features of anxiety and panic.

Answers

Answer:

The answer is

comorbidity

Explanation:

The paces of comorbidity among tension issues are high since they share the normal highlights of uneasiness and frenzy.

Hope this helped! :^)

Every Friday, Dr. Cruz would give a quiz in his video gaming design class. Students quickly learned to be nervous on Friday mornings, just before each quiz. Halfway through the semester, Dr. Cruz stopped giving quizzes on Fridays because he did not wish for students to hate him and over time the students' anxiety began to diminish with each passing week in which there was no quiz until they no longer felt anxious on Friday mornings. The decrease in the students' anxiety may be attributed to the process of what Pavlov referred to as:

Answers

Answer:

Extinction

Explanation:

Pavlov referred to this behavior as extinction. It is the gradual weakening of a conditioned conditioned response that causes the behavior to decrease or disappear.

A DUI will be on your permanent driver license record for __________ years. A. 25 B. 50 C. 75 D. 100

Answers

Answer:

25

Explanation:

a dui stays on your record for 25 years

A DUI will be on your permanent driver license record for  25 years. Hence option A is correct .

What is DUI (Drive Under Influence) ?

Driving while influence (DUI) is the crime of doing so while being affected by drink or other inappropriate  (including prescription medications and recreational) to the point where it is unsafe for the person to operate a motor vehicle.

Also known as  Drive under influence (UK/Ireland), driving while influence (DWI), inappropriate driving, operating a vehicle while influence (OWI), operating a vehicle while under the influence of inappropriate products  (OVI) in Ohio, or impaired driving (Canada).

The phrase for the violation changes from legal to informal terms and from one jurisdiction to another. Driving under the influence is the common name for the specific  violation in the United Jurisdictions, while other states also use the terms "driving while influence" (DWI), "operating while impaired" (OWI), or "operating Vehicles can include farm machinery and horse-drawn carriages, along with bicycles.

Learn more DUI (Drive Under Influence) here

https://brainly.com/question/11594591

# SPJ 5

Other Questions
CSI Miami: Using DNA to Solve a RobberyThe year is 2023. You are a detective for the Miami Dade Police Department. Youre on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the mans blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run. Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person. On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.methionine-leucine-proline = Protein that causes DARK SKINmethionine-leucine-leucine = Protein that causes LIGHT SKINvaline-proline-proline-lysine = Protein that causes GREEN EYESproline-leucine-valine-proline = Protein that causes BLUE EYESproline-lysine-proline-proline = Protein that causes BROWN EYESlysine-arginine-threonine-valine-serine-serine = BLOND HAIRlysine-arginine-threonine-valine-serine-cystine = BLACK HAIRlysine-arginine-threonine-valine-serine-valine = BROWN HAIRasparagine-isoleucine-arginine = CURLY HAIRasparagine-asparagine-isoleucine = STRAIGHT HAIRleucine-arginine-glutamic acid-arginine = BIG NOSEleucine-asparagine-arginine-glutamic acid = SMALL NOSEleucine-asparagine-asparagine-glutamic acid = MEDIUM NOSEproline-tyrosine-tyrosine-(stop) = SMALL EARSproline-proline-tyrosine-(stop) = MEDIUM EARS proline-tyrosine-phenylalanine-(stop) = BIG EARS Step 1: Decode the DNA into mRNAStep 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with. DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC | | |AUGmRNA:Protein Sequence: 1. Methionine 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?Step 5: Answer the following wrap-up questions:1) When you performed step 1, what enzyme were you imitating?2) In step 2, what molecule would have brought the amino acids that the codons asked for?3) In step 2, what molecule would have helped the amino acids line up and attach to one another?4) In step 2, what connected the amino acids together? What does In Truth's day-star mean in Edgar Allan Poe poem A Dream Which quotation from "Harrison Bergeron" by Kurt Vonnegut Jr. Best develops the theme that attempting to make people "equal every which way" is a dangerous and harmful goal? Question 3 options: "All this equality was due to the 211th, 212th, and 213th Amendments to the constitution, and the unceasing vigilance of agents of the United States. " "Then other people'd get away with it and pretty soon we'd be right back to the dark ages again, with everybody competing against everybody else. " The musicians scrambled back into their chairs, and Harrison stripped them of their handicaps, too. " "Every twenty seconds or so, the transmitter would send out some sharp noise to keep people like George from taking unfair advantages of their brains. ". PLSSS HELP IF YOU TURLY KNOW THISS You sell triangular flags made from felt. How much felt do you need to make 60 flags? Bill's chocolate bar is 69% cocoa. If the weight of the chocolate bar is 83 grams, how many grams of cocoa does it contain? Round your answer to the nearest tenth. Le dimanche 27 aot, Katy Perry (1)(donner) un concert au stade de France. a/C' (2)(tre) son premier concert parisien-Il y en a trois autres au programme, et il n'y (3)(avoir plus une seule place de libre l'intrieur, le public (4)(attendre) la star avec impatience quand tout coup, Katy Perry (5)(faire) son apparition. Elle(6)(sortir) d'une boule disco et elle (7)(commencer) sonspectacle. Les fans (8)(adorer)!Verbs in pass compose or imparfait. President Woodrow Wilson a. promoted racial equality. b. promised to respect Latin Americas independence. c. stopped U.S. investment in Latin America and the Caribbean. d. aligned with Dollar Diplomacy. e. designed a program to instill American values in Latin American schools. List three reasons why a study may be considered invalid. A neutral atom of Fluorine has seven valence electrons. How many valence electrons are present in the ion F-1? Conflict avoidance in relationship can someone explain the answer plz Which of the following is formed when minerals and extreme heat and pressure are combined? PLS I WILL GIVE YOU 23 POINTS IF YOU ANSWER ME CORRECTLYThe diagram shows 3/4 of a fraction strip shaded. Mary erases some of the shadings to show 5/8. Explain the steps she took to shade 5/8 of the fraction strip. Sean is filling his truck with gasoline. He knows the total cost, C, will be proportional to thenumber of gallons of gasoline, g, that he puts into the gas tank. After putting 8.5 gallons in.the tank, the cost is $23.63.(a) Find the ratio of the cost to the gallons as(b) What is the real world meaning of youra unit rate. Show the division as a fraction answer in (a)?and then state the answer with appropriateunits.(c) If c is the cost and g is the number ofgallons bought, write a proportioninvolving c and g and then solve it for c.(d) If Sean puts 17 gallons of gasoline intohis truck, what is his cost? Justify. 57 women make up an all female choir in a church.Two women are chosen to sing together for a duet.How many possible pairs could be chosen for the duet? Why is physical activity so important in preventing heart disease? Svetlana and her mother are very similar. Both have blonde hair, a love of scrapbooking, blue eyes, and a thin nose. Which statement most likely describes Svetlanas traits? Svetlana inherited her love of scrapbooking from her mother, but her blue eyes come from her environment. Svetlana inherited her blue eyes from her mother, but her love of scrapbooking comes from her environment. Svetlana inherited her thin nose from her mother, but her blonde hair comes from her environment. Svetlana inherited her blonde hair from her mother, but her thin nose comes from her environment. German troops could have entered France by going through Switzerland. Use what you know about both political and physical geography to explain why it made more sense for them to go through Belgium both carbohydrates and fats provide erorgy, why is it that you get a sugar high,ut not a fat high?