Mathematics High School

A pair of AirPods cost $120 at the store. A
person bought a pair and sold it online for
$150. What is the percent of increase?

Answers

Answer 1

Answer:

20 is the correct answer

A Pair Of AirPods Cost $120 At The Store. Aperson Bought A Pair And Sold It Online For$150. What Is The
Answer 2

Answer:

8%

Step-by-step explanation:

120% divided by 150%

Related Questions

Nate downloaded a free virus detection program, which reported that his computer is infected with a virus. The editors of a tech magazine reviewed the effectiveness of the free program by running it on 500 computers, with 8% of those computers known to be virus-infected. Their findings are summarized in the two-way table. Virus Reported Virus not Reported Infected 28 12 Not Infected 94 366 Which statement is supported by the data? A. The magazine's review suggests Nate should trust the program's report because the probability that the scan result is a false positive is only 7.11%. B. The magazine's review suggests Nate should use a different detection program because the probability that the scan result is a false positive is 77.05%. C. The magazine's review suggests Nate should use a different detection program because the probability that the scan result is a false positive is 22.95%. D. The magazine's review suggests Nate should use a different detection program because the probability that the scan result is a false positive is 92.89%.

Answers

Answer: 77.05%

Step-by-step explanation:

.

The magazine's review suggests Nate should use a different detection program because the probability that the scan result is a false positive is 77.05%.

From the question we are told that:

Sample size n=500

Know Virus infection r=8\%

The data can be represented in the Table below a

[tex]\begin{tabular}{lllll}S/N & Reported & Not reported & Total \\Infected & 28 & 12 & 40 \\Not Infected & 28 & 36&460\\Total &122&378&500\\\end{table}[/tex]

Therefore the False Positive can be Mathematically represented as

[tex]FP=\frac{94}{122}[/tex]

[tex]FP=0.7705[/tex]

[tex]FP=77.05\%[/tex]

In conclusion we can say that  The magazine's review suggests Nate should use a different detection program because the probability that the scan result is a false positive is 77.05%

Therefore

Option B is correct

https://brainly.com/question/22388718?referrer=searchResults

answer correctly plss
(an explanation on how to determine if the function is linear, quadratic, or an exponential function will get brainly)

Answers

Answer:

equation is -3x+4

Step-by-step explanation:

function is linear because x is always constant

PLEASE don't make a link give me the answer nd how you got it i trust you. A=__in^2

Answers

For the square:
32•48= 1536 in ^2

For the triangle: 48•12= 576/2= 288 in^2

1536+288= 1824 in^2

The Spanish version of Michelle Obama's book,
Becoming, is 528 pages long. The number of pages in
the Spanish version of the book is 32% greater than the
number of pages in the English version. How many
pages are in the English version of Michelle Obama's
book?

Answers

359 is the correct answer for the English one I think

538 divided by 6 pls help me

Answers

Answer:

89.67

Step-by-step explanation:

Maybe this answer i don’t know not 100% sure

Independent Practice


Find the second, fifth, and ninth terms of each sequence.


an=−5+(n−1)7a subscript n baseline equals negative 5 plus left parenthesis n minus 1 right parenthesis 7


A.
–4, –1, 3


B.
7, 28, 72


C.
12, 33, 61


D.
2, 23, 51

Answers

Answer:

A.

2, 23, 51

Step-by-step explanation:

Substitute 2, 5, and 9 for n in the function and simplify in each case.

a2=−5+(2−1)(7)=2 a subscript 2 baseline equals negative 5 plus left parenthesis 2 minus 1 right parenthesis left parenthesis 7 right parenthesis equals 2

a5=−5+(5−1)(7)=23 a subscript 5 baseline equals negative 5 plus left parenthesis 5 minus 1 right parenthesis left parenthesis 7 right parenthesis equals 23

a9=−5+(9−1)(7)=51 a subscript 9 baseline equals negative 5 plus left parenthesis 9 minus 1 right parenthesis left parenthesis 7 right parenthesis equals 51

It snowed 3.4 inches on Monday and 2.92 inches on Tuesday. How much did it snow on Monday
and Tuesday combined?

Answers

Answer:

6.32 in.

Step-by-step explanation:

2.92 + 3.4 = 6.32

Answer: 6.32 inches

.........................

s s s s s s s s s s s s s s s s s s s ss s s s s s s s s s ss s s s s s s s s s s s s ss s s please help‼️‼️

Answers

Answer: Point W is the answer.

Step-by-step explanation:

Answer:

the answer is w

Step-by-step explanation:

x is 2

y is -5.5

A ladder leans against a building that has a wall slanting away from the ladder at an angle of 96 degrees with the ground. If the bottom of the ladder is 23 feet from the base of the wall and it reaches a point 52 feet up the wall, how tall is the ladder to the nearest foot?

Please quick and work shown

Answers

Answer:

hm? is there any picture that they gave you or no?

Step-by-step explanation:

Write an equation of the line that passes through the given point with the given slope

Answers

Answer:

B. 1x-3

Step-by-step explanation:

slope is m = 1

y-int = (0, -3)

Hank is going on a trip. He must pack two complete outfits consisting of one shirt, one pair of pants, and one pair of shoes. In his closet, Hank has 4 shirts, 2 pairs of pants, and 2 pairs of shoes.

How many different combinations of two complete outfits can Hank pack from his closet? (Assume that the outfits have no common elements.)

A. 48
B. 13
C. 16
D. 256

Answers

Answer:

C. Is i think the answer( im not perfect dont judge)

Step-by-step explanation:

안녕하세요 나쁜 소식은 나를 위해하지 아니 아니 나를 위해 감사f요 나쁜 소식 yiu 나를 위해 하지 감사

Answer:

A. 48

Step-by-step explanation:

4x4=16

2x2=4

2x2=4

16+4+4=24

24x2=48

Therefore I think it is 48.

DISCLAIMER

(I could be wrong so this is not with 100% satisfaction)

Find the area of the semicircle. Round your answer to the nearest whole number, if necessary.



area: about
cm2

Answers

Answer:

2513.27  my dear check if correct

Step-by-step explanation:

Answer:

it 628 i hope that helps you

Step-by-step explanation:

solve for x
thank you

Answers

10 degrees. Hope this helped

What is m∠1? HELP ME PLEASE

Answers

Answer:

97

Step-by-step explanation:

exterior angle property of triangle

64+33 equals 97

in other ways

By Angle sum property of triangle, the measure of 3rd angle is 83 and

angle 1 and 3rd angle are supplementary

so,

180 - 83 = 97

A magician showed a magic trick where he picked one card from a standard deck. Determined what the probability is that the card will be a red color or a queen card?

Answers

Answer:

7 / 13

Step-by-step explanation:

The number of cards in a standard deck = 52

Number of red cards in a deck = 26

Number of queens in a deck = 4

Selecting a card at random ;

Probability of picking a red card ;

P(red card) = number of red cards / number of cards in deck

P(red card) = 26 / 52

P(queens card) = number of queens / number of cards in deck

P(queens card) = 4 / 52

Number of red queen cards = (red n queen) = 2

P(red or queens card) = P(red) + P(queens) - P(red n queen)

P(red or queens card) = 26/52 + 4/52 - 2/52

= (26 + 4 - 2) / 52

= 28 /52

= 7 / 13

34. Find the solutions to x2 = 12.

Answers

Answer:

x = 6

Step-by-step explanation:

6 x 2 = 12

Answer: look at the picture

Step-by-step explanation: Hope this help :D

2/10 + 6/100 = ?

A: 8/10
B: 8/100
C: 26/10
D: 26/100

Answers

2/10 = 20/100
20/100+ 6/100 = 26/100

Answer:

d

Step-by-step explanation:

Simplify the polynomial by combining like terms. 3.63x2 - 4.54x + 7.96x2 +9.85 -3.12x​

Answers

Answer:

11.59x² -7.66x + 9.85

Step-by-step explanation:

3.63x² - 4.54x + 7.96x² +9.85 -3.12x​

11.59x² -7.66x + 9.85

i'm pretty sure its 11.59x2−7.66x+9.85

Assignment Ordering with Square Roots Using the Number Line Side se green dot from O piot dhe number at the corres Qon Use the number line to plot the numbers. Then arrange them in order from smallest (1) to largest (4). 10.2 10.4. 3 . Thas a ponton ja numba​

Answers

Answer:

See below

Step-by-step explanation:

square root of 0.2 is around 0.4472 . . .

square root of 0.4 is around 0.6324 . . .

so, if we are ordering them from least to greatest, the order will go as follows:

1. 0.2

2. 0.4

3. square root of 0.2 (0.4472...)

4. square root of 0.4 (0.6324...)

The radius of the Ferris wheel is shown. Which is the circumference of the Ferris wheel, rounded to the nearest foot?

Answers

Answer:

785 ft

Step-by-step explanation:

Please find attached an image of the Ferris wheel used in determining the answer to this question

The circumference of a circle can be described as the linear distance round the circle

The circumference of a circle = 2nr

n = 3.14

r = radius

2 x 3.14 x 125 = 785 ft

Solve this system of linear equations. Separate
the x- and y-values with a comma.
10x + 17y = -89
5x + 7y = -34

Answers

Answer:

(3,-7)

Step-by-step explanation:

10x +17y = -89

-(10x + 14y = - 68)

3y = -21

y = -7

5x + 7(-7) = -34

5x -49 = -34

5x = 15

x = 3

A researcher wished to compare the average amount of time spent in extracurricular activities by high school students in a suburban school district with that of high schoolers in a school district of a large city. The researcher obtained an SRS of 60 high school students in a large suburban school district and found the mean time spent in extracurricular activities per week to be x1 = 6 hours, with a standard deviation s1 = 3 hours. The researcher also obtained an independent SRS of 40 high school students in a large city school district and found the mean time spent in extracurricular activities per week to be x2 = 4 hours, with a standard deviation s2 = 2 hours. Let u1 and u2 represent the mean amount of time spent in extracurricular activities per week by the populations of all high school students in the suburban and city school districts, respectively. Assume the two-sample t-procedures are safe to use.
With a level of 5%, test the hypothesis that the amount of time spent on extracurricular activities is no different in the two groups.
For the problem above, a 95% confidence interval for u1-u2 is (use the conservative value for the degrees of freedom)
a. 2 +- 0.5 hours.
b. 2 +- 0.84 hours.
c. 2 +- 1.01 hours.
d. 2 +- 1.34 hours

Answers

The answer is A okay

Please do the bottom question. 5th grade math

Answers

Answer:

7.76

Step-by-step explanation:

theres not really an explanation just add them and you'll get the answer

Answer:

7.79

Step-by-step explanation:

 4.56

+3.23

_____

 7.79

Hope this helps    :)

I’ll give the Brainliest to who answers these questions with reasonable explanations.


1. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. What is the theoretical probability of pulling a blue marble and then a yellow marble?

A. 0.0278

B. 0.1667

C. 0.3333

D. 0.0556



2. In a bag there are 3 red marbles, 2 yellow marbles and 1 blue marble. After a marble is selected, it is replaced. After 40 attempts at drawing two marbles from the bag, there were three instances where a blue marble then a yellow marble was pulled. What is the experimental probability of pulling a blue marble and then a yellow marble?

A. 0.0750

B. 0.0167

C. 0.0333

D. 0.0556

Answers

Answer:

I believe A is the right answer

Step-by-step explanation:

Answer:

question 2 is i know its not an option but its 0.075

question 1 is 0.0556

Step-by-step explanation:

i took the quiz and got it right.

The average speed of an airplane is 550 miles per hour.
Create an equation to represent the distance, d, in miles, that the airplane travels after t hours at the average speed.

Answers

Answer:

3300mi ÷ 550 mi/hr =6 hours

give me brainly or heart if it helped!

Plz Ans my question its urgent​

Answers

Box 1

x - y = 4

x - 0 = 4

x = 4

Box 2

x = 4

y = 0

(x, y) => (4, 0)

Box 3

x - y = 4

-1 - y = 4

-y = 4 + 1

y = -5

Box 4

x = 0

y = -4

(x, y) => (0, -4)

A stop sign is in the shape of a regular octagon. A regular octagon can be created using eight triangles of equal area. One triangle that makes up the stop sign has a base of 15 inches and a height of 18 inches. Calculate the area of the stop sign.
a.
1000 sq. in
c.
980 sq.in
b.
1080 sq. in
d.
1200 sq. in

Answers

Answer: the answer is B.) 1080 sq in

Step-by-step explanation: edge 2021 i took the test

You might need: Calculator
What is the area of the following circle?
Either enter an exact answer in terms of 7 or use 3.14 for I and enter your answer as a decimal.
d = 14
units2






Answers

9514 1404 393

Answer:

  49π units^2

Step-by-step explanation:

The area is given by the formula ...

  A = πr^2 . . . . . . where r is half the diameter.

For the given circle, the area is ...

  A = π(14/2)^2 = 49π . . . . square units

What is the mean for this list of numbers? 4, 8, 12, 13
Answer and Explain how you got the answer

Answers

Answer:

9.25

Step-by-step explanation:

Add up all of the numbers and then divide that answer by how many numbers you added up

Answer:

Mean = 9.25

Step-by-step explanation:

Mean = (sum of numbers)/( how many numbers)

There are 4 numbers: 4, 8, 12, 13

Mean = (4 + 8 + 12 + 13)/4

Mean = 37/4

Mean = 9.25

PLEASE HELPP ME IM GONNA FAIL

Answers

Answer:

90 degrees.

Step-by-step explanation:

They right ray point is on the 90 degree number and left ray is on zero so we find the difference.

90-0=90

so it measures 90 degrees.

Answer:

<ba=180 <bc=90

Step-by-step explanation:

Other Questions
What is range in set? when constructing an angle bisector, the compass must be used to make three arcs. do all three arcs need to have the same radius? explain. What two symbols does the Animal Farm flag have? What is mixed economy in economics? PLEASE HELP MECan someone please explain how the "-6000(1+1.1+1.1^2+...+1.1^7)" became "-6000(1.1^8/0.1)"????Thank you very much which of the following is a true statement? multiple choice a remainder interest held by the decedent at the time of death is not included in the decedent's gross estate. the value of a remainder interest depends in part on the section 7520 interest rate at the time of death. the value of a remainder interest in a life estate is independent of the age of the life tenant. the value of a life estate does not depend upon the age of the life tenant. none of the choices are true. 16 - Albinism: From Genotype to Phenotype Going through the motions...Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating cach gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 1) Each student will analyse one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLCASA2 Each student will have a different gene and be responsible for reporting their findings to the other group members 2) Fach form has an original DNA strand and 3 different mutated strandt. For cach, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AA). 3) With a colored pencil, you will then do the following . First, circle the mutation() on cach of the three mutared strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) . Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form . Using the amino acid sequences match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your date Your gener Individuale Original DNA Strand Gene: TYR (OCA1) Name: Victoria Cell Gene affected Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type Cite your evidence here for mutation type Point Com AiN One codon was erected vi bine amino aciddathram Which of the above mutations caused a change in the phenotype? How did this change occur? Which mutation did not result in a change in the phenotype? 153 Zoo Genetics Key Aspects of Conservation Biology 154 Original DNA Strand Gene: TYR (OCA1) Name: DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AUG CUCGT GU GUG VAC VOLG OG UGG AGU WC 016 Acc lucc Gcu 66 ya AAS: Met Lev Lev Ala Val Lev Terser Lev Lev Trp ser Phe bin. The ser Ala Gly His Phel Mutation 1 DNA: TACGAGGACCGACAAAACATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG mRNA: AUG CUCING GOU GUU WG WAC UGCVGUGU GA GUNLU ALA CU GLUGGANU V AAS: Met Lev ev Ala Vall Lev Torsers us by Val ser Ang Pro Pro Lev Ala lhe ser Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AGUNG GOUGOU WG VALUGU GUGUGO AGO W LAGAO ULL LOGU UW AAs: Met Lev Lev Ala Val Lev Torser Lev Lev Tre ser the Gin Thy sev nia Gry Gin Phel Zoo Genetics:Key Aspects of Conservation Biology Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AG CUCUG GU GU UGLALUGU LUG CUL UDGAU CUGAC VEL 6 GC G AAS: Met Lev Lev Ala Val Lev Torser hev Lev Trp Ser the inhhr ser Ala Gly His Phe Which exercise routine should someone follow for the first few days after recovering from an illness with symptoms that included vomiting, diarrhea, and fever?. an enclosure has an inside area of 50 m2 , and its inside surface is black and is maintained at a constant temperature. a small opening in the enclosure has an area of 0.01 m2 . the radiant power emitted from this opening is 52 w. what is the temperature of the interior enclosure wall? if the interior surface What is the hardest Filipino word? An organization whose members have a common cause for which they seek to influence public policy is called an ____. how did the Erie canal help the united states economy? give an example of culturaul diffusion found in the today explain where you would find the example and where it originated What is demand-pull caused by? 4. Give a brief summary (two or three sentences) of what you think the Chorus is talking about overall on pages 10, 11 and 12. (3 points) Why do expansionary policies lead to inflation? There are four requirements to becoming a qualified nursing assistant who can receive a delegation. Write the correct words in "c" and "d" below.a. Be either a NA-R or NA-C in the state of Washington.b. Have completed the education requirements for delegation.c. Be willing to perform the) to be delegated.d. Demonstrateto perform the specific tasks correctly without directsupervision of the delegating RN. People who favored presidential What is the example of unique number? Juan is trying to factor x + 7x+3 and makes the following table.- see picture-Juan concludes that x + 7x+3 cannot be factored using integers.a. Is Juan correct? b. Comment on Juan's strategy and improve it if possible.