Answer:
1. hydrophilic/"water-loving," 2. hydrophobic/"water-hating"
Explanation:
whatisphotosynthesis
Answer:
Photosynthesis is the procedure in which plants (organisms with procaryotic cells) convert water, sunlight, carbon dioxide (the air animals produce from exhaling) and nutrients from the soil into their food.
Answer:
photosynthesis is the process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water
What is the role of NADPH in CO₂ reduction?
A redox pathway is represented by the dark reactions. As CO2 is reduced to glucose, NADPH gets oxidized to NADP+.
NADPH does it lessen CO2?During the Calvin-Benson cycle, carbon dioxide from the atmosphere is transformed into glucose. Utilizing the electrons made accessible by the oxidation of NADPH, calls for the total reduction of CO2. So, a redox pathway is represented by the dark reactions. As CO2 is reduced to glucose, NADPH was oxidized to NADP+.
What function does NADPH perform?All organisms require nicotinamide adenine dinucleotide phosphate (NADPH) as an important electron donor because it supplies the reducing energy needed for anabolic processes and redox balance. NADPH homeostasis is controlled by a variety of signaling channels and various metabolic enzymes that change adaptively in cancer cells.
Does NADH lessen CO2?The equilibrium predicted per thermodynamic considerations, which is likewise attained from the formic acid side, is obtained during the enzyme-catalyzed CO2 reduction by NADH. The Michaelis constant with CO2 is around 40 mM, reflecting the enzyme's poor affinity for this substrate.
To know more about NADPH visit:
https://brainly.com/question/14870384
#SPJ10
10 One reason a fish that lives in the ocean may have
trouble living in a freshwater lake is that
(1) there are more carnivores in freshwater
habitats
(2) salt water holds more dissolved nitrogen than
fresh water
(3) more photosynthesis occurs in fresh water
than in salt water
(4) water concentration in the fish is affected by
salt levels in its environment
Answer:
(4)
the freshwater will, through osmosis, enter the fish, causing its cells to swell, and the fish will die.
Plssssss mark as brainliest
Water concentration in the fish is affected by salt levels in its environment.
Why a fish that lives in the ocean may have trouble living in a freshwater lake?Fish that live in the ocean have adapted to the high levels of salt in the water, and their bodies have developed mechanisms to maintain the proper balance of water and electrolytes. When these fish are placed in a freshwater lake, the low salt concentration causes water to enter the fish's body, leading to an imbalance in the fish's internal fluids and potentially causing harm or death.
This is known as osmoregulation. This is the main reason why a fish that lives in the ocean may have trouble living in a freshwater lake.
Learn more about adaptation, here:
https://brainly.com/question/29768035
#SPJ2
you heat kill "virulent" type iiis pneumococcus, homogenize this mixture and then treat it with rnase. next, you incubate this mixture with "avirulent" type iir pneumococcus and then inject the bacteria into live mice. do you expect the mice to get sick? why or why not?
Pneumococcus of type IIIS (virulent) is killed by heating the mixture, which is subsequently homogenized and the bacteria are subsequently injected into living mice.
When the IIIS bacteria are treated with DNase and heated to death. DNA will then breakdown as a result of DNase. The living IIR bacteria cannot undergo any changes or transformations as a result of this DNA. Mice won't perish. Because DNA is the transforming principle and the DNase degrades DNA, this occurs. DNA is responsible for turning virulent organisms into non-virulent ones.Any infection brought on by the pneumococcus, also known as Streptococcus pneumoniae, is known as pneumococcal disease (noo-muh-KOK-uhl). Ear, sinus, and bloodstream infections can all be caused by pneumococcal infections, as well as pneumonia.Of healthy individuals, 5 to 90% may have the bacteria in their nasopharynx.To know more about virulent here
https://brainly.com/question/13552511
#SPJ4
The process of mitosis is sometimes compared to the asexual reproduction of simple organisms because of the similarities that they share. Which of the following is a similarity that mitosis and asexual reproduction share?
Answer:
cell divide to form a new species
Both mitosis and asexual reproduction both divide cells to form a new species.
What do you mean by mitosis and asexual reproduction?Asexual reproduction is a type of reproduction that does not involve the fusion of gametes or change in the number of chromosomes.
Mitosis is a part of the cell cycle in which replicated chromosomes are separated into two new nuclei. Cell division by mitosis gives rise to genetically identical cells in which the total number of chromosomes is maintained.
Therefore, some organisms can use mitosis to reproduce asexually. The offspring of asexual reproduction are genetically identical to each other and to their parent. Most single-celled, microorganisms reproduce asexually by duplicating their genetic material and dividing in half.
Learn more about mitosis and asexual reproduction:
https://brainly.com/question/1632
#SPJ2
jeremy, a patient in the neurology unit, is having a seizure (uncontrolled activity of brain neurons). to stop the seizure, his nurse administers a drug through his intravenous line. this drug is one of a group of drugs called benzodiazepines. benzodiazepines enhance the action of the neurotransmitter gaba by increasing how strongly it binds to its receptors. gaba, in this case, is an inhibitory neurotransmi
In the given case, an inhibitory neurotransmitter opens ion channel for chloride ions, for the entry of neurons, which hyperpolarizes the neurons, and it makes neurons less likely to do action.
What are neurons?The components of the nervous system are known as neurons; these branch-like cells resemble the roots of a plant and hold the information that is absorbed by electrical impulses and transported to various parts of the brain.
The brain and hypothalamus are parts of the central nervous system, and all of the neuron cells are part of the peripheral nervous system.
Thus, the correct options are e, a, and c.
To learn more about neurons, refer to the link:
https://brainly.com/question/24217914
#SPJ1
The question is incomplete. Your most probably complete question is given below:
Jeremy, a patient in the neurology unit, is having a seizure (uncontrolled activity of brain neuronte stop the seizure, his nurse administers a drug through his intravenous line. This drug is one of a good of drugs called benzodiazepines. Benzodiazepines enhance the action of the neurotransmitter GABA by increasing how strongly it binds to its receptors. GABA. In this case, is an inhibitory neurotransmite that opens ions channels that allow to enter neurons. As a result, the neurom This makes it likely that neurons will fire an action potential and to helps end the seizure
hyperpolarize
potassium ions
less
more
chloride ions
depolarize
sodium ions.
which best explains the relationship between flying dragons and trees? a. flying dragons rely on trees for a food source, but not for shelter. b. flying dragons live exclusively in trees except to lay eggs. c. flying dragons burrow into the tree without causing damage to the tree. d. flying dragons use trees for reproduction, but get their food and shelter on the ground.
Answer: late answer but for the other people its B.
Explanation: Flying dragons live exclusively in trees except to lay eggs.
Explain why there are rings of cartilage around the trachea.
Answer:
The primary function of the rings is to support the trachea from collapsing in on itself when there is no air being inhaled/exhaled.
Hope that helps
Heart disease is the leading cause of death among both men and women in the United States.
It is usually caused when a sticky substance called plaque builds up in the arteries. Often, the
only symptoms of heart disease are chest pain or discomfort.
Why do you think heart disease is so prevalent in the United States? How could heart
disease affect other
organ systems?
Heart Diseases prevalent in the United States due to the leading causes of High blood pressure, a High Cholesterol level, diabetes, Overweight and obese, Alcohol overuse are the key factors.
Heart disease could affect other organs as if the heart is weak, blood could not be circulated and pumped properly thus fluid will start filling in kidneys, lungs, stomach, etc. cause swelling in ankles in feet or legs.
Coronary heart disease is most common cause of death, data suggests that over 20.1 million adults age 20 and older have CAD. CAD can occur when arteries that supply blood and oxygen to heart becomes clogged due to fatty materials called plague. Such factors results sudden Cardiac arrest.
Learn more about Heart disease here https://brainly.com/question/24053461
need help for the other 3 questions, thank you!
1. The other complementary strand of this DNA strand will be:
TAATTTGCTAGGTAGCGTCCA
2. TAA TTT GCT AGG TAG CGT CCA
The amino acid sequence of this strand will be: Stop codon, Phenylalanine, Alanine, Arginine, Stop codon, Arginine, Proline.
3. There are 7 codons in this gene.
4. There are 7 amino acids in this protein.
What are amino acids?Special chemical compounds known as amino acids are used by living things to build proteins. Nitrogen, oxygen, hydrogen, and carbon make up the majority of the elements in amino acids. Twenty distinct types of amino acids are used in the creation of proteins in our body. Some amino acids are actually made by our bodies, while the rest must come from diet.Transcription is the first stage of protein synthesis. At this point, the cell copies (or "transcribes") the DNA. Because it makes use of ribonucleic acid, a different kind of nucleic acid, the copy of DNA is known as RNA. The next procedure is known as translation, and it makes use of RNA.Translation is the following stage in the production of a protein. This is the process by which the RNA is changed (or "translated") into a series of amino acids that constitutes the protein.A complicated mechanism in the cell called the ribosome performs the translation process, which creates the new protein from the RNA instructions.To learn more about Amino acids, refer to:
https://brainly.com/question/14583479
#SPJ13
Please I need help!
If glycogen or starch were hydrolyzed, the result would be the same. Many _________ molecules (name the specific molecule) would be the result.
If glycogen or starch were hydrolyzed, the result would be the same. Many glucose molecules would be the result.
What is hydrolysis?The term hydrolysis carries with it the ide of cutting down into pieces. Image that I have this long stick that I have made by the process of jogging a lot so small sticks together. As I joining the long sticks, I have been able to make this stick that is very much long. ow I want to get back the smaller sticks that I have joined, all I need to do is to use a little knives to cut out all the sticks from the points that they were joined.
This is exactly the idea that has to do with hydrolysis. It is the breakdown of a macromolecule into the small monomers that form it. Having said this, let us remind each other that starch and glycogen are both made of glucose.
It then follows now that the hydrolysis of starch and glycogen would produce many molecules of glucose.
Learn more about hydrolysis:https://brainly.com/question/24213349
#SPJ1
write the definition of plant cells.
-must be full of nessecary info
-must include 3 paraghs
Plant cells are eukaryotic cells that have a real nucleus and specific organelles to perform specialized functions. However, plant cells do have a number of organelles that are distinct from those found in other eukaryotic cells.
What are the benefits of eukaryotic cells?Because they can sustain multiple habitats within of a single cell, eukaryotic cells can carry out complex metabolic reactions that prokaryotic cells cannot. In reality, this contributes significantly to the fact that eukaryotic cells can grow to sizes that are several times bigger than those of prokaryotic cells.
What four types of eukaryotic cells are there?Plants, animals, fungus, and protists are a few examples of eukaryotic cells. Their genetic material is organized by chromosomes. The Golgi body, organelles, golgi apparatus, and nucleus are all present in eukaryotic cells.
To know more Eukaryotic cells visit:
https://brainly.com/question/11351358
#SPJ9
Scientist captured tagged and released 100 wild dogs. two years later scientist captured 45 wild dogs and 10 were already tagged. what is the population of wild dogs
The population of wild dogs is 135.
From the data given above:
The scientist's first capture = 100 dogs
The scientist's second capture 2 years later = 45
10 out the 45 wild dogs the scientist captured 2 years after had already been tagged 2 years before.
Therefore:
Total population = No of wild dogs captured, tagged and released + No of wild dogs captured 2 years later - No of wild dogs that were already tagged during the second capture
Total population = 100 + 45 - 10
Total population = 135
Learn more on population from:
https://brainly.com/question/27991860?referrer=searchResults
#SPJ4
What do aerobic respiration and anaerobic respiration have in common?
Both begin with glycolysis.
• Both
occur In mitochondria.
• Both require oxygen to proceed.
• Both end with the electron transport chain.
Answer:
both occur in mitochondria
Explanation:
both require oxygen to proceed
Answer:
both occur in mitochondria
Explanation:
edge 2023
There are sensory receptors located in human skin that register specific stimuli such as _________. a. happiness b. pain c. tickles d. relief please select the best answer from the choices provided a b c d
There are sensory receptors located in human skin that register specific stimuli such as b. pain
The sensory receptors contain specific nerve endings in them that detect certain changes in environmental stimuli. After the sensory receptors have detected a change in the stimuli, the neurons carry this message to the central nervous system which interprets the message from the neurons and sends a response via the effector neurons.
The sensory receptors present in the skin can help us detect pain when we hit something or when a certain part of the body faces damage. There are other stimuli that can also be detected by the skin due to the sensory receptors such as hotness, coldness etc.
To learn more about sensory receptors, click here:
https://brainly.com/question/25753221
#SPJ4
Answer: b
Explanation:
because it is
place these events in the correct order as they would occur in the production of atp fueled by the energy collected by photosystem ii. begin with the first event to occur at the top of the list.
In photosystem II Electrons pass along the ETC Hydrogen ion gradient is established Hydrogen ions flow through ATP synthase.
Photosystem II is the first membrane protein complex in oxygenic photosynthetic organisms in nature. It produces atmospheric oxygen to catalyze the photo-oxidation of water by using light energy. It oxidizes two molecules of water into one molecule of molecular oxygen.
Photosystem II generate ATP in the light reactions of photosynthesis. Electrons are transferred sequentially between the two photosystems, with photosystem I acting to generate NADPH and photosystem II acting to generate ATP. PSII comes first in the path of electron flow, but it is named as second because it was discovered after PSI.
To learn more about Photosystem II , here
brainly.com/question/13211869
#SPJ1
officials want to collect a dna sample from a suspect, and to this end gather blood, saliva, hair, and fingernail clippings (all from this individual). dna from which of these materials will demonstrate the same sequence of nucleotides?
The aim of collecting a suspect's blood, saliva, hair, and fingernail clippings is to obtain a DNA sample (all from this individual). The nucleotide sequence in this person's DNA will be consistent throughout all of their cells.
Describe DNA.DNA, commonly referred to as deoxyribonucleic acid, is the genetic material carried by humans and nearly all other organisms. Nuclear DNA, which makes up the majority of DNA, is located in the cell nucleus, with very little DNA being present in the mitochondria (where it is called mitochondrial DNA or mtDNA).
The DNA of an individual can be found in almost all of their cells. The cell nucleus contains the majority of the DNA. All samples of this person's blood, saliva, hair, and fingernail clippings contain the same DNA sequence. The 3 billion bases that make up human DNA are identical in more than 99 percent of people.
Therefore, in order to obtain a DNA sample from a suspect, officials must first collect blood, saliva, hair, and fingernail clippings (all from this individual). The nucleotide sequence in this person's DNA will be consistent throughout all of their cells.
To learn more about DNA from the given link
https://brainly.com/question/16099437
#SPJ9
the river near a community floods occasionally and damages homes. The town wants to investigate why the river floods. Which three factors are most important for the town to investigate?
There are three factors that are most important for the town to investigate:
Provide Education.Create flood plains and overflow areas for rivers.Create Detention Basins.The main impact of floods. Widespread flooding can threaten lives inundate property and businesses destroy property damage critical infrastructure and disrupt access to essential public services. The effects of flooding are often long-lasting and can be very costly disruptive, and distressing for affected communities.
The most livable cities have quality public health and education systems excellent housing and excellent public transportation infrastructure. Lack of green space air pollution noise and unsafe neighborhoods contribute to the prevalence of depression in urban areas. This explains why students and young professionals are attracted to inner-city locations.
Learn more about The town investigate here:-https://brainly.com/question/13304495
#SPJ1
What is an example of a molecule that functions in insulation and buoyancy?
Answer:
Lipids!!!!!!!!!!!!l!!!¡!
Lipids are an example of a molecule that functions in insulation and buoyancy.
What are Lipids?Lipids are defined as a broad group of naturally occurring molecules which include fats, waxes, sterols, fat-soluble vitamins, monoglycerides, diglycerides, phospholipids, and others. Key roles of lipids include storing energy, signaling and serving as structural components of cell membranes.
Lipids include fats, oils, waxes, phospholipids, and steroids. Lipids are described as a family of organic compounds, composed of fats and oils whose molecules generate high energy and are responsible for various functions within the human body.
Thus, Lipids are an example of a molecule that functions in insulation and buoyancy.
Learn more about Lipids, here:
https://brainly.com/question/3498396
#SPJ2
Water boils and becomes a gas at 100°c .What are the states of sodium ,chlorine and sodium chloride at 100°c ?
Answer:
NaCl will be left after 100C. Because sodium will actively react with water and disappear. Chlorine is gaseous at room temperature. Water will evaporate and sodium chloride will left because of condensation.
Explanation:
Hope it helps! =D
difference between sustainable agriculture and organic agriculture?
Organic farming is focused on the inputs used in production while sustainable farming is focused on the physical treatment of the land .
Organic farming is agriculture that makes healthy food, healthy soils, healthy plants, and healthy environments a priority, along with crop productivity.
Sustainable agriculture relies solely on natural processes for input and recycles nutrients on-site to eliminate the use of non-renewable resources. The main goals of sustainable agriculture are environmental health, economic profitability, and social and economic equity. sustainable agriculture mainly focus to meet society's food and textile needs in the present without compromising the ability of future generations to meet their needs.
To learn more about Sustainable agriculture , here
brainly.com/question/23857554
#SPJ1
genotype and allele frequencies describe the gene pool of the population. can only be calculated where there are two alleles at a locus. describe the genetic structure of the population. are always determined by counting every individual in the population. are used to know how many individuals live in the population.
Genotype and allele frequencies describe the genetic structure of the population., and describe the gene pool of the population.
An organism's genotype is made up of all of its genetic components. The term "genotype" can also refer to the alleles or variants that a person possesses in a specific gene or genetic region. By dividing the total number of copies of all the alleles at that specific genetic locus in the population by the number of times the allele of interest is observed in a population, an allele frequency can be computed.
A fraction, a percentage, or a decimal can be used to express allele frequencies. From the time of embryonic development to adulthood, an individual's genotype determines their inherited potentials and restrictions.
To know more about genotype refer to: https://brainly.com/question/12116830
#SPJ4
iron carbonate (??) - iron oxide (56g) - carbon dioxide (44g)
The mass of iron carbonate is 291 g along with the mass of iron oxide whose mass is 56 g and carbon dioxide whose mass is 44 g.
What is mass , and it's unit gram and what is the mass of iron carbonate?As always studies mass if the amount of matter present in the given object and asset.Also it is truly said that greater the mass of the body ,smaller is the change produced by applying force on the body.Everything we , our eyes witnesses around have a certain amount of mass as a contained quantity.This is only due to mass that we call a body light weighed or heavy body.The mass of iron oxide is 56 gram as FeO = Fe+O = 56 gram , likewise carbon dioxide have the mass 44 gram.To know more about mass visit:
https://brainly.com/question/19694949
#SPJ9
Which of the following is the most serious effect of water pollution for humans?
a.
infectious diseases
b.
algal blooms
c.
toxic food chain effects
d.
low-oxygen water
n the chemical equation for photosynthesis, carbon dioxide and water are converted to glucose and oxygen.
6CO2 + 6H2O ® C6H12O6 + 6O2
Which component could be added to complete this chemical equation?
light energy
ATP and NADPH
chemical energy
rubisco
In order to complete this reaction in the way that it have been Shown in the question, then we need to add the components; ATP and NADPH
What is photosynthesis?The term photosynthesis is used to define the process by which the green plants produce their own food in the presence of sunlight and chlorophyll. In this process, there is the combination of the carbon dioxide and the water molecules which is catalyzed by light from the sun.
We are now trying to see what is going to complete the reaction as shown. We must know that the reaction requires ATP and NADPH to be complete.
Learn more about photosynthesis:https://brainly.com/question/1388366
#SPJ1
Answer: ATP and NADPH
Explanation: W
You know that all eleven body systems work together in the human body. What would happen if a system stopped working?
Can someone help me identify what the parts of this (40x) magnified (thicket creeper) leaf is??
The parts of the above leaf magnified are called "veins" or Phloem. A more scientific group name is "Vascular Structure"
What comprises the vascular structure of a leaf?The xylem, which transfers water and dissolved nutrients from the roots to the leaves, and the phloem, which delivers food from the leaves to all sections of the plant, are the two principal vascular tissues.
The phloem is the vascular tissue in responsible of organic nutrition transfer and distribution. The phloem serves as a signaling system as well as a structural role in the plant body.
It is normally made up of three types of cells:
sieve components, parenchyma, and sclerenchyma.Learn more about leaves:
https://brainly.com/question/1071271
#SPJ1
when a double-stranded dna molecule is exposed to high temperature, the two strands separate, and the molecule loses its helical form. we say the dna then has been denatured. (denaturation also occurs when dna is exposed to acid or alkaline solutions.)
The A-T-rich regions denature first because-
A-T base pairs only have 2 hydrogen bonding.
C-G base pairs have 3 hydrogen bonding.
What is hydrogen bonding?Instead of forming a covalent bond with an atom of hydrogen, hydrogen bonding is a specific form of dipole-dipole attraction between molecules. It comes about as a result of the attraction between a hydrogen atom that is covalently attached to a very electronegative atom, like an N, O, or F atom, and another extremely electronegative atom. Strengths of hydrogen bonding per mole range from 4 kJ to 50 kJ. The fact that water has a high boiling point (100 °C) compared to the other group-16 hydrides, which have significantly weaker hydrogen bonds, is specifically due to intermolecular hydrogen bonding. The secondary and tertiary structures of proteins and nucleic acids are in part due to intramolecular hydrogen bonding. It also has a significant impact on the structure of polymers, both man-made and organic.
To learn more about hydrogen bonding with the help of given link:
https://brainly.com/question/1426421
#SPJ9
The complete question is-
"When a double-stranded DNA molecule is exposed to high temperature, the two strands separate, and the molecule loses its helical form. We say the DNA has been denatured. (Denaturation also occurs when DNA is exposed to acid or alkaline solutions.)
a. Regions of the DNA that contain many A-T base pairs are the first to become denatured as the temperature of a DNA solution is raised. Thinking about the chemical structure of the DNA molecule, why do you think the A-T-rich regions denature first?"
Good grades are not as important as experience when it comes to building a career in marine science.
True
False
Answer: The correct answer is false
Explanation:
College degrees and solid GPAs are important to many professional careers within marine science. This answer was confirmed correct on edge as well!
suppose an organism is extirpated from a local environment. In what way might other organisms be affected? Provide examples to support your answer.
An ecosystem's species are linked by intricate "food webs" of eaters and eaters. When a species goes extinct, neither its predators nor its prey can consume it anymore. These populations change, and others are affected. Such "cascades" of impact can be unpredictable and occasionally fatal. This would happen if an organism is extirpated from a local environment.
What does extirpated means?Extirpation is the local extinction of a species or organism, where it/they stop existing in a specific location yet still survive elsewhere. For the survival of a species, what does extirpation mean? We limit the genetic diversity of organisms by eradicating local populations through human-mediated activities. Expungement brought on by excessive hunting, fishing, agriculture, pollution, the introduction of invasive species, and the destruction of habitat. The current loss of biodiversity brought on by humans cannot be reversed by speciation until hundreds of thousands of years have elapsed since the evolution of new species is a lengthy process. The International Union for Conservation of Nature (IUCN) formally proclaimed magnificent forest frogs to be extinct in 2020. Unlike some species that have vanished entirely as a result of natural disasters, this species' extinction was also a result of human activity.
Examples include the whooping crane, the swift fox, and the leatherback sea turtle. a species of wildlife that once lived freely in Canada but is now extinct. Examples include the population of grey whales in the Atlantic Black-footed ferret, fish, and gravel chub a species of animal that is extinct.
To know more about extirpated, visit:
https://brainly.com/question/17404308
#SPJ9