A trolley charges $3.00 just to get in the car and $1.00 for each mile traveled. How much would it cost to travel 5 miles? 8 miles? 20 miles?

Answers

Answer 1

Answer:

5 miles = $8

8 miles = $11

20 miles = $23

Step-by-step explanation:

If admission is 3 dollars, then we already know that is the minimum we have to pay. The rest of the money we spend on the trolley depends on how many miles we travel on it. If each mile is 1 dollar, then we can use a variable to represent the number of miles since there are numerous possible answers.

The basic equation to represent the scenario is:

3 + x

Since x represents the amount of miles traveled, we can replace it with 5, 8, or 20.

3 + 5 = 8 dollars

3 + 8 = 11 dollars

3 + 20 = 23 dollars


Related Questions

multiply 2 by r, then multiply 9 by the result

Answers

Answer:

2×r=2r

2r×9=18r

Hope this helps:)

Answer:

9(2r)

Step-by-step explanation:

2×r =2r

9×2r can be written as 9(2r)

We could write this as 18r but it is best to leave it at 9(2r)

If angle 4 has a measure of 42° in the given diagram, what is the measure of angle 6?

Answers

Answer:

138 degrees

Step-by-step explanation:

its a cointerior angle so the angles add up to 180

so 180 - 42 = 138

Answer:

138°

Step-by-step explanation:

If angle 4 has a measure of 42° in the given diagram, what is the measure of angle 6?

T is a flat angle (180°)

angle 4 = angle 8

angle 2 = angle 6

180 - 42 = 138°

please help me ASAP!!!!

Answers

here I found it online

.......ya

hope this helpa

What is the value of x?







Enter your answer as a decimal in the box.

Answers

Answer:

22.5

Step-by-step explanation:

[tex]\frac{15}{6} = \frac{x}{9}[/tex]

cross multiply

15x = 6*9

15x = 54

devide 15 from both sides

x =  22.5

can someone help me?​

Answers

Answer:

5,184

Step-by-step explanation:

multiply each unit by 6 and then you end up with 12, 24, and 18. Then you multiply all these answer by each other and get 5,184.

It’s probably 4 or 25 I’m not sure I’m trying to ask another answer

what is 8 ÷ 3/4 ? and 11 ÷ 2/5?

Answers

Answer:

10 2/3 = 10.6667

27 1/2 = 27.5

Step-by-step explanation:

8 ÷ 3/4

Convert any mixed numbers to fractions.

Then your initial equation becomes:

[tex]\frac{8}{1}[/tex] ÷ [tex]\frac{3}{4}[/tex]

Applying the fractions formula for division,

[tex]=\frac{8*4}{1*3}[/tex]

=[tex]\frac{32}{3}[/tex]

Simplifying 32/3, the answer is

[tex]10 \frac{2}{3}[/tex]

Decimal Form = 10.6667

=================================================================

11 ÷ 2/5

Convert any mixed numbers to fractions.

Then your initial equation becomes:

[tex]\frac{11}{1}[/tex] ÷ [tex]\frac{2}{5}[/tex]

Applying the fractions formula for division,

[tex]=\frac{11*5}{1*2}[/tex]

=[tex]\frac{55}{2}[/tex]

Simplifying 55/2, the answer is

27 1/2

Decimal Form = 27.5

[RevyBreeze]

Yesterday, there were q variants of a strain of bacteria. Today there are q^2 variants of the bacteria. There are 900 variants today. How many variants were present yesterday?

Answers

Answer:

30

Step-by-step explanation:

Since there are 900 today, and the variants square each day, we can take the square root of 900.

[tex]\sqrt{900} =30[/tex]

900 = q^2, so q = 30, so yesterday there were 30 variants

9 X = 36 : i suck at find the missing factor pls HELP

Answers

9x = 36
All you have to do is divide the 9 on both sides.
This will equal x=4
X=4
You have to divide 9 by both sides so 36 divided by 9 is 4.

Find the product. -2x(x2 - 3) -2 x3 - 6 x -2 x2 6 x 6 x3 -2 x3 6 x.

Answers

Product of two polynomials can be done by distribution of multiplication over addition. The product of  [tex]-2x(x^2 - 3)[/tex] is [tex]-2x^3 + 6x[/tex]

What is distributive property of multiplication over addition?

Suppose a, b and c are three numbers. Then we have:

[tex]a(b + c) = a\times b + a\times c[/tex]

(a(b+c) means a multiplied to (b+c). The sign of multiplication is usually hidden when using symbols and both quantities which are in multiplication are written together without space)

The product result of the given expression is

[tex]-2x(x^2 - 3) = -2x^{1 + 2} + 6x = -2x^3 + 6x[/tex]

It is because when bases are same and there is multiplication, then powers add up, so we have: [tex]a^b \times a^c = a^{b+c}[/tex]

Thus,

The product of  [tex]-2x(x^2 - 3)[/tex] is [tex]-2x^3 + 6x[/tex]

Learn more about product of polynomials here:

https://brainly.com/question/9106484

My little brother spent $53 on comic books and magazines. He bought 17 items. If comic books cost $4 and magazines cost $3, how many of each item did my brother buy?

Answers

Answer:

comic books = 2

magazines = 15

Step-by-step explanation:

Let c = number of comic books bought

Let m = number of magazines bought

He bought 17 items, so

c + m = 17

Comic books cost $4 each and magazines cost $3 each.

He spent $53 on comic books and magazines, so

4c + 3m = 53

Rearrange c + m = 17 to make m the subject:

m = 17 - c

Substitute  m = 17 - c  into  4c + 3m = 53  and solve for c:

4c + 3(17 - c) = 53

⇒ 4c + 51 - 3c = 53

⇒ c = 2

Substitute c = 2  into m = 17 - c to and solve for m:

m = 17 - 2 = 15

Find the value of x.(all lengths are in cm).

Answers

Answer:

Step-by-step explanation:

This is a basic right angle problem relating to Pythagoras theorem as one approach.

we know.

[tex]a^2+b^2=y^2[/tex]

(letting the hypotenuse of the left triangle as y)

then,

[tex]7^2+8^2=y^2\\y=\sqrt{113}[/tex](neglecting negative root)

now since you know the value of y use the same formula to find the value of x. Keep in mind the identification of opposite , adjacent and hypotenuse sides.

Elena's aunt bought her a $150 savings bond when she was born. When Elena is 20 years old, the bond will have earned 105% in interest. How much will the bond be worth when Elena is 20 years old?

Answers

Answer: $307.5
Step-by-step explanation:
Here, Elena's aunt bought her a $150 savings
bond when she was born.
That is, the initial amount = $150
And, When Elena is 20 year old, the bond will
have earned 105% in interest.
Therefore, The bond be worth when Elena is
20 years old,A = 150 + 150x105
#A= $307.5
Therefore, after 20 years the the bond
worth $307.5.

(Hope this helped!!)

The worth of the bond is $307.50.

What is the worth of the bond?

The worth of the bond is the sum of the bond when it was bought and the interest earned on the bond.

Worth of the bond = interest rate + value when the bond was bought

Interest = 105% x $150

1.05 x $150 = $157.70

Worth of the bond = $157.70 + $150 = $307.50

To learn more about interest, please check: https://brainly.com/question/26164549


A wooden box has the shape of a rectangular prism. The inside of the box is also a rectangular prism. What is the volume of the solid part of the box?

Answers

Answer:

1560

Step-by-step explanation:

25 x 8 x 10 - 22 x 5 x 4 = 2000 - 440 = 1560

helpppp asap please!!!!

Answers

Answer:

   Angle at x is 75°

Step-by-step explanation:

Data :

  Angle at A = 65°

  Angle at B = 40°

According to  the porperty of triangle we know that total interior angle a triangle has is 180° irrespect of type or size

              A + B + C = 180

      65 + 40 + C = 180

        C = 180 - 65 - 40 = 75°

Mark brainliest if you understand

after 18 years, Rajesh will be 4 times as old as he is now. His present age is.....​

Answers

Answer:

his present age is 6??

Step-by-step explanation:

correct me if im wrong^^

What is the area of this parallelogram?

A=1912 ft²

A = 42 ft²

A=6112 ft²

A=7134 ft²

Answers

Answer:

[tex]A=71\dfrac34 \ \ \textsf{ft}^2[/tex]

Step-by-step explanation:

Area = base x height

⇒ A = 10.25 x 7 = 71.75 = 71 3/4 ft²

Answer:

71 3/4 ft²

Step-by-step explanation:

the area is the product of the base (10 1/4) and height (7)

10.25 x 7 = 71 3/4 ft²

Write the point slope form of the equation of the line through the given point and slope

Answers

Step-by-step explanation:

the point-slope form in general is

y - y1 = m(x - x1)

where (x1, y1) are the coordinates of a point, and m is the slope.

so, we have

y - -1 = 4/3 × (x - 3)

or simplified

y + 1 = 4/3 × (x - 3)

Answer:

[tex]y + 1 =\frac{4}{3} (x-3)[/tex]

Step-by-step explanation:

Pre-Solving

We are given that a line contains the point (3, -1), and has a slope of [tex]\frac{4}{3}[/tex].

We want to write the equation of this line in point-slope form.

Point-slope form is given as [tex]y-y_1=m(x-x_1)[/tex], where m is the slope and [tex](x_1 ,y_1)[/tex] is a point.

Solving

Since we are already given the slope and the point of the line, we can plug these values into the formula to get the equation.

Let's start with the slope; replace m with [tex]\frac{4}{3}[/tex] in the formula.

[tex]y-y_1=\frac{4}{3}(x-x_1)[/tex]

Now, replace 3 as [tex]x_1[/tex] and -1 as [tex]y_1[/tex]. Remember that the formula has subtraction in it.

[tex]y--1=\frac{4}{3} (x-3)[/tex]

This can be simplified to become:

[tex]y + 1 =\frac{4}{3} (x-3)[/tex]

Topic: writing the equation of the line

See more: https://brainly.com/question/16888568

HELP PLEASE THERES A PIC I PUT IN​

Answers

Answer:

(3, 10)

Step-by-step explanation:

f(3) means substitute the value of x = 3 into f(x)

[tex]\implies f(3) = (3 \times 3) + 1 = 10[/tex]

Therefore, when x = 3, y = 10

So the ordered pair is (3, 10)

f^{-1}(x) is of no use here

[tex]\\ \tt\longmapsto f(x)=3x+1[/tex]

[tex]\\ \tt\longmapsto f(3)=3(3)+1=9+1=10[/tex]

Pair is (3,10)

How do I do this (Factoring polynomials, look for gcf first)

Answers

Answer:

Find the GCF of all the terms in the polynomial.Express each term as a product of the GCF and another factor.Use the distributive property to factor out the GCF.

Convert the binary number 10110011 into a decimal number.​

Answers

179 is the decimal equivalent of the binary number 10110011.
179 = 1+2+16+32+128

179 is the answer

22 POINTS !!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
NEED ANSER NOWWWW

A town is designing a rectangular park that will be 600 feet wide by 1000 feet long. On a scale drawing, the dimensions of the park are 12 inches wide by 20 inches long. A rectangular area of the park for swing sets is 0.5 inches wide by 2 inches long on the scale drawing.


What is the actual length of the swing set area of the park?


Enter your answer in the box.


The actual length of the swing set area of the park is [blank]

feet.

Answers

Answer:

The dimensions of the park on the scale drawing are 12 inches by 20 inches

The actual dimensions are given as:

Park = 600 feet by 1000 feet

Swing set = 25 feet by 100 feet

The dimension of the swing set on the scale drawing is given as: 0.5 inch by 2 inches

The above means that, the scale factor (k) is:

--- i.e. divide the scale measurement by the actual measurement

Evaluate both equations

So, we have:

Multiply the scale factor by the dimensions of the park, to get the scale measurement

Hence, the dimensions of the park on the scale drawing are 12 inches by 20 inches

Read more about scale measurements at:

brainly.com/question/24579126

Step-by-step explanation:

Amanda is looking out her window and spots a wild turkey in the yard. The turkey is 43 feet from the house at an angle of depression of 72 degrees. How high up is Amanda's window? show proof of it by making a drawing related to angle of elevation

Answers

Answer:

29 if I’m Wrong I’m sorry

Step-by-step explanation:

what is the slope of the line that passes through the points (-9,10) and (-13,13)​

Answers

Answer:

-3/4

Step-by-step explanation:

The slope of line passes through the points (-9,10) and (-13,13)​ is -3/4.

what is slope?

A line's slope is determined by how its y coordinate changes in relation to how its x coordinate changes. y and x are the net changes in the y and x coordinates, respectively. Therefore, it is possible to write the change in y coordinate with respect to the change in x coordinate as,

m = Δy/Δx

where, m is the slope

Given:

(-9,10) and (-13,13)​

So, slope= (13 - 10)/ ( -13 + 9)

slope= 3 / (-4)

slope= -3/4

Hence, the slope of line is -3/4.

Learn more about slope here:

https://brainly.com/question/3605446

#SPJ2

Researchers estimate that 21.5% of men and 17% of women smoke cigarettes.1
The rate of new cases in 2008 showed that men develop lung cancer more often than women (70.2 and 50.5 cases per 100,000 persons, respectively).2
Smoking, a main cause of small cell and non-small cell lung cancer, correlates to 90% and 80% of lung cancer deaths in men and women, respectively.3 That is, 90% of men who are diagnosed with lung cancer are active smokers, and 80% of women who are diagnosed with lung cancer are active smokers.
1. What answer do you predict? Why? (2 points)








2. Given what you know about probability, how can you determine if smoking and lung cancer are related? (2 points)







Analyze the Data:
3. What is the probability that a randomly chosen man is a smoker? (1 point)




4. What is the probability that a randomly chosen man will be diagnosed with lung cancer? (1 point)








5. Given that a man has lung cancer, what is the probability that he is a smoker? Write this event with the correct conditional notation. (2 points)



6. What is the probability that a randomly selected man will be a smoker and be diagnosed with lung cancer? (2 points)








7. For a randomly selected man, are the events diagnosed with lung cancer and smoker independent events? Support your answer with probabilities. (2 points)











Consider the Case for Women:
8. For a randomly selected woman, are the events diagnosed with lung cancer and smoker independent or conditional? Support your answer with probabilities. (4 points)
















Making a Decision:
9. What can you conclude about smoking and lung cancer? Are they conditional or independent events? (2 point)




10. Some people who have never smoked develop lung cancer. Does this disprove the evidence? (1 point)

Answers

Answer: Given what i know about probability, you can determine if smoking and lung cancer are related by testing a group of smokers and non smokers and finding out the percent of each that develope lung cancer and the percent that dont for both

Step-by-step explanation:

Help me with geometry please

Answers

Answer:

waait Im ma wriiting

Step-by-step explanation:

hope it helps

All Philippines Tamaraw are Mammals
What is the statements

Answers

Answer:

The tamaraw or Mindoro dwarf buffalo (Bubalus mindorensis) is a small hoofed mammal belonging to the family Bovidae. It is endemic to the island of Mindoro in the Philippines, and is the only endemic Philippine bovine.

PLSSSS HELP ASAP!!!!!

Answers

It's 360 feet (The person above)

Answer:

360 ft squared

Step-by-step explanation:

you have 3 (2 shapes but one is done twice)

2 rectangles and a larger rectangle

the 2 rectangles

3 is the width, and 15 is the length

15*3 = 45 * 2 (for the other one)

and you get 90ft squared

then you have the larger rectangle. it is 15 feet wide and 18 in length (15+3)

15*18 = 270

270 ft squared + 90 ft squared = 360 ft squared

1. What is the measure of

Answers

Every triangle is equal to 180degrees
So since one is 70 and the other is a right angle which is equal to 90 that means
180-70=110 110-90=20

Answer=20degrees

Need help with math! Margin of error

Answers

Answer:

See below

Step-by-step explanation:

Problem 4

[tex]H_0:p=0.40\\H_a:p>0.40[/tex]

Problem 5

[tex]H_0:p=0.42\\H_a:p<0.42[/tex]

Make sure to read the problems and translate it into math

A clearance rack is marked as 60% off the regular price to be taken at the register. If a jacket on the clearance rack is marked $239. 99, what will it ring up for at the register? a. $14. 40 b. $60. 00 c. $96. 00 d. $143. 99.

Answers

[tex]\begin{array}{|c|ll} \cline{1-1} \textit{a\% of b}\\ \cline{1-1} \\ \left( \cfrac{a}{100} \right)\cdot b \\\\ \cline{1-1} \end{array}~\hspace{5em}\stackrel{\textit{60\% of 239.99}}{\left( \cfrac{60}{100} \right)239.99}\implies 143.994~\hfill \underset{\textit{sale price}}{\stackrel{239.99-143.994}{\approx 96}}[/tex]

Other Questions
In what ways can poetry be useful in better understanding both others and ourselves? What types of planning can be done to improve a nations economy? A nation can undergo planning or planning in order to improve its economy. Consider a gas at STP in a container of 22. 4 L. What is the approximate value of n according to the ideal gas law? 0. 5 1 2008. 31 224. Look at the screen shot when german troops entered Austria, Hitler announced the Anschluss or unification of Austria and germany Fast food restaurants are often robbed by employees or former employees. True or false can someone help me on these questions please!! the questions are give an example of how the principal progression could be applied to this workout overtimeAnd if your primary goal was to increase flexibility would this work out be a good example of the principal of specificity?why or why not What is the historical significance of theSupreme Court case McCulloch v. Maryland(1819)? The English bill of rights laid the foundation What is the value of the expression below when y=5y=5?4y to the second power-7y-6PLEASE HELP MEH!!!!!! What three formats/objects function in precisely the same way to create an image?A. A pinhole camera, a large format camera and a Camera Obscura.B. All of the other answers.C. A Camera Obscura, Talbot's Mouse Trap camera, and a large format camera.D. None of the other answers. find the measure of the indicated angle Which form of poetry expresses feelings or ideas about a topic?Group of answer choices1. lyric poetry2. narrative poetry3. musical poetry4. tragic poetry Please help if you answer correctly I will give brainliest thank you!!!!!!!! A field is a rectangle with a perimeter of 960 feet. The length is 400 feet more than the width. Find the width and length of the rectangular field. CSI Miami: Using DNA to Solve a RobberyThe year is 2023. You are a detective for the Miami Dade Police Department. Youre on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the mans blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run. Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person. On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.methionine-leucine-proline = Protein that causes DARK SKINmethionine-leucine-leucine = Protein that causes LIGHT SKINvaline-proline-proline-lysine = Protein that causes GREEN EYESproline-leucine-valine-proline = Protein that causes BLUE EYESproline-lysine-proline-proline = Protein that causes BROWN EYESlysine-arginine-threonine-valine-serine-serine = BLOND HAIRlysine-arginine-threonine-valine-serine-cystine = BLACK HAIRlysine-arginine-threonine-valine-serine-valine = BROWN HAIRasparagine-isoleucine-arginine = CURLY HAIRasparagine-asparagine-isoleucine = STRAIGHT HAIRleucine-arginine-glutamic acid-arginine = BIG NOSEleucine-asparagine-arginine-glutamic acid = SMALL NOSEleucine-asparagine-asparagine-glutamic acid = MEDIUM NOSEproline-tyrosine-tyrosine-(stop) = SMALL EARSproline-proline-tyrosine-(stop) = MEDIUM EARS proline-tyrosine-phenylalanine-(stop) = BIG EARS Step 1: Decode the DNA into mRNAStep 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with. DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC | | |AUGmRNA:Protein Sequence: 1. Methionine 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?Step 5: Answer the following wrap-up questions:1) When you performed step 1, what enzyme were you imitating?2) In step 2, what molecule would have brought the amino acids that the codons asked for?3) In step 2, what molecule would have helped the amino acids line up and attach to one another?4) In step 2, what connected the amino acids together? What does In Truth's day-star mean in Edgar Allan Poe poem A Dream Which quotation from "Harrison Bergeron" by Kurt Vonnegut Jr. Best develops the theme that attempting to make people "equal every which way" is a dangerous and harmful goal? Question 3 options: "All this equality was due to the 211th, 212th, and 213th Amendments to the constitution, and the unceasing vigilance of agents of the United States. " "Then other people'd get away with it and pretty soon we'd be right back to the dark ages again, with everybody competing against everybody else. " The musicians scrambled back into their chairs, and Harrison stripped them of their handicaps, too. " "Every twenty seconds or so, the transmitter would send out some sharp noise to keep people like George from taking unfair advantages of their brains. ". PLSSS HELP IF YOU TURLY KNOW THISS You sell triangular flags made from felt. How much felt do you need to make 60 flags?