Act II Sc ii & iii
Short Answer Directions: Answer the following questions in complete sentences.
1) When Juliet appears on the balcony, what does Romeo compare her to?
2) In a sentence or two, explain what Juliet says about names.
3) In the Balcony Scene, why is Juliet embarrassed?
4) Juliet asks how Romeo got into her place. The orchard walls are high, and Romeo's life
would be in danger if her relatives were to find him there. What is Romeo's response to these
questions?
I
5) Juliet will send someone to Romeo on the following day for what purpose?
6) What does Friar Laurence mean when he says to Romeo, Young men's love then lies/not
truly in their hearts but in their eyes"?
7) Why does Friar Laurence agree to perform the marriage ceremony for Romeo and Juliet?

Answers

Answer 1

As Romeo stands in the shadows, he looks to the balcony and compares Juliet to the sun. He then asks the sun to rise and kill the envious moon. Romeo had always compared Rosaline to the moon, and now, his love for Juliet has outshone the moon.

In a sentence or two explain what Juliet says about names. Juliet is expressing that it does not matter what a person's name is, a rose would stil be a sweet smelling flower if it were called by another name. SHe is comparing Romeo to a rose and states that it is just a name and not the person within.

Juliet is super embarrassed until she realizes that it's Romeo hiding in the bushes. This is bad news, because if her family finds Romeo, they'll kill him. Luckily, she gets over her shock fast enough to enjoy the most romantic love scene in the history of Western literature.

Juliet asks how Romeo got into her place. The orchard walls are high, and Romeo's life would be in danger if her relatives were to find him there. What is Romeo's response to these questions? Romeo states that he flew on "love's wings" meaning it was love that allowed him to leap over the orchard wall .

The Nurse calls for Juliet, and Juliet goes inside for a moment. When she reappears, she tells Romeo that she will send someone to him the next day to see if his love is honorable and if he intends to wed her.

What does Friar Laurence mean when he says to Romeo, "Young men's love then lies not truly in their hearts, but in their eyes? Friar Lawrence is stating that young men often "lust" after the beauty of women; in other words, MEN FALL IN LOVE WITH THE WAY WOMEN LOOKS AND NOT THE PERSON THE WOMAN TRULY IS.

When Romeo asks Friar Lawrence to marry him and Juliet, Friar Lawrence agrees because he thinks their marriage might bring about the end of the feud between their two families. He states, “For this alliance may so happy prove / To turn your households' rancor to pure love”

To know more about Julius Caesar , visit

https://brainly.com/question/1324420

#SPJ1


Related Questions

Which two pieces of evidence support the idea that coal is underutilized? This was on study island about coal

Answers

Only 5% of coal is utilized, and 95% of it is lost, as stated in Sentence A. In contrast, sentence C claims that half of the coal is not recovered by conventional coal mining methods.

The correct option is A) and C)

Only 5% of the electricity generated by coal is used for traction on railroad tracks, and 95% of that power is lost, which is one of the two pieces of evidence indicating coal is underutilized.

The current method of mining coal only extracts about half of the available coal, and some coal is left inaccessible.

What steps include the mining of coal?

To remove coal, coal miners primarily employ two techniques.

Large machinery used in surface mining remove the topsoil and overburden, or layers of rock, to reveal coal seams. In mountaintop removal, which is a type of surface mining, the mountaintops are dynamited and cut off to get access to coal seams.

To know more about coal mining visit:

https://brainly.com/question/11997318

#SPJ4

I understand that the question you are looking for is:

Which two pieces of evidence support the idea that coal is underutilized?

A. only five percent of the power is used in traction on railway lines and the fact that ninety-five percent of it is lost

B. Americans are richly blessed with natural resources and coal, an important factor in human civilization, will run out soon.

C. the present coal-mining practice does not extract more than half of the available coal and the fact that it leaves some parts of coal out of reach

D. we treat coal as though it will never run out and the fact that some coal fields in Iowa are already exhausted

on the last page of the book, from what specifically does montag begin to recite words from and think about?

Answers

As Montag reads, he begins to know what Clarisse meant once she same that she knew the approach that life is to be fully fledged.

As Montag remembers from the text, “To everything, there's a season. A time to interrupt down, and a time to make up.” we see each within the novel's final pages. Montag confesses to the creator that he memorized several of the Book of Books. The creator tells him that a person named Harris knows the verses from memory; however, if something ever happens to Harris, Montag can become the book.

As he clings to the planet, Montag mentally photos Mildred even as she's near to meeting her death. He suddenly remembers that he met her in Chicago. Afterward, Montag thinks of the Book of Books and repeats it himself.

To learn more about Montag, visit here

https://brainly.com/question/12621639

#SPJ4

What existing perspectives give relevance and urgency to the problem?

Answers

Finding the best answer is the second phase in the problem-solving process; the first step is to identify the issue at hand.

What strategy works the best to solve the majority of problems?

The logical approach, one of the most popular methods for solving problems, is a multi-step procedure that is effective for a variety of issues. It may be beneficial to start with the rational method before moving on to other problem-solving procedures because many other approaches replicate or build off of its seven steps.

What are the three methods for solving problems?

Three approaches to problem solving in teams are descriptive, functional, and prescriptive. Descriptive problem solving examines how teams solve problems, functional problem solving identifies the behaviors of effective problem solving, and prescriptive problem solving suggests methods and approaches to enhance team problem solving (Beebe & Masterson, 1994).

Why are decision-making and problem-solving important?

Both problem-solving and decision-making abilities are crucial since they can enable you to deal with a variety of workplace situations. They work well together and may be used to many of the same problems. Critical thinking is required for both decision-making and problem-solving.

Know more about perspectives:

brainly.com/question/13107415

#SPJ1

What is the significance of the gun placement at the foot of the flagpole animal farm

Answers

Answer:The rebellion is complete

Explanation:In Chapter Four, the gun (which once belonged to Mr. Jones) is placed at the foot of the flagstaff. This is significant because it symbolizes that the rebellion is complete: the animals have not only overcome Mr. Jones but have also overcome his attempt to retake control of the farm.

Answer: The gun symbolizes the successful fight against the humans.

Explanation: Hope This Helps, Have A Good Day. <3

From: Kelliciou

Determine which of the following is used to provide support for an opinion.(1 point)

beliefs
facts
details
feelings

Answers

Answer:

B. Facts

Explanation:

To prove something you must use facts so you sound logical and not like a rambling bafoon!

How should points related to an argument be presented? (1 point)
Responses

in order of importance
in order of importance

as solutions to a problem
as solutions to a problem

as fresh arguments
as fresh arguments

in addition to an explanation from you

Answers

The points that are related to an argument to be presented are a proposition, a thesis, statements of reason, as well as supporting information, proofs, and refutations.

What is an argument?

Writing is always for a reason. It could be done for entertainment, to express feelings, educate, or for any number of other purposes. One of those goals could be to outline an argument that uses data on a specific subject to persuade others to accept or support the idea.

Therefore, a proposition, a thesis, assertions of reason, as well as supporting facts, proofs, and refutations are all points relevant to an argument to be given.

To learn more about the argument, refer to the link:

https://brainly.com/question/29336007

#SPJ1

could someone help me American literature

Answers

According to American literature;

1. Slaves relied on spirituals as a part of the oral tradition to pass on information

2. "Gourd" is a code for the Big Dipper to help slaves escape to northern states.

3. Frederick Douglass was a slave sold to the Auld family and watched over Little Thomas.

4. The quote that shows Douglass using imagery is;

"That cheerful eye, under the influence of slavery, soon became red with rage; that voice made all of sweet accord, changed to one of harsh and horrid discord; and that angelic face gave one to that of a demon." (Douglass 176)

5. Frederick enticed the young school-aged children to show him their books by giving them bread from his plantation.

Who is Fredrick Douglass?

Fredrick Douglass was man sold to slavery from a young age to the family of Hugh Auld. He was passionate about learning and freedom. He escapes slavery to become a reputable writer and a advocate of slave abolition.

Learn more about slavery here:

https://brainly.com/question/9331183

#SPJ1

1. Choose the answer that best match to work in italics
the legion of soldiers adventure on the small group of rebels
1. Calvary
2. Line
3. Multitude
4. School
2. Choose the answer that best match to work in italics
The complicated schemes eventually led to the demise of the crime spree
1. Approval
2. end
3. Return
4. Zeal

Answers

The Multitude of soldiers adventure on the small group of rebels. Hence option 3 is correct.

The complicated schemes eventually led to the end of the crime spree

Hence option  2 is correct.

How many soldiers are in a legion?

The divisions were made into 'legions,' or groups. 4,000 to 6,000 men made up each legion. Centuries, or groups of 80 men, were subsequently subdivided into a legion. A "centurion" was a person who oversaw an entire century.

Therefore, an exact or almost exact equivalent of another term, morpheme, or phrase in a given language is referred to as a synonym. Beginning, starting, commencing, and initiating, for instance, are all synonyms for one another in the English language.

Learn more about synonyms from

https://brainly.com/question/869158
#SPJ1

See correct question below

Choose the answer that best match to work in italics

the legion of soldiers adventure on the small group of rebels

1. Calvary

2. Line

3. Multitude

4. School

2. Choose the answer that best match to work in italics

The complicated schemes eventually led to the demise of the crime spree

1. Approval

2. end

3. Return

4. Zeal

Answer:

the legion of soldiers adventure on the small group of rebels.

the answer is (MULTITUDE)

The complicated schemes eventually led to the demise of the crime spree.

the answer is (APPROVAL)

Explanation:

Read the excerpt from "The Gift of the Magi."

Jim stopped inside the door, as immovable as a setter at the scent of quail. His eyes were fixed upon Della, and there was an expression in them that she could not read, and it terrified her. It was not anger, nor surprise, nor disapproval, nor horror, nor any of the sentiments that she had been prepared for. He simply stared at her fixedly with that peculiar expression on his face.

In this excerpt, Jim’s character is developed

Answers

Answer:

A) indirectly, through his lack of action.

Explanation:

In this excerpt from "The Gift of the Magi," Jim's character is shown through his lack of action. He stopped and gazed at Della, which reveals he is indirectly developing his character. Keywords like "immovable" and "fixedly" show that nothing happens in the whole passage.

Options:

A) indirectly, through his lack of action.

B) directly, through his physical appearance.

C) directly, through his personality that is concerned with change.

D) indirectly, through his lack of feelings for Della.

3. How does the speaker feel about the road he
didn't take? Cite evidence from the text to
support your answer.

HELP PLEASE, ILL MARK BRAINLIEST AND U GET POINTS (poem in picture)

Answers

on lines 15-20 it shows that the speaker feels doubt for the path he didn’t take, wondering if it was the correct path since not many people travel with it. hope this helped! :)

oh and on line 7 the speaker thinks the other path is the “better claim”

Which two 2-word phrases are signed using the first letters of each respective word in the phrase?.

Answers

The two two-word phrases signed by the first letter of each respective word in the phrase include Vice Principal and Physical Education. VP or PE respectively.

Sign languages ​​use visual and manual modalities to convey meaning through body movements as well as spoken words. Sign language is represented by manual articulations combined with non-manual markings. Sign language is a full-fledged natural language with its own grammar and vocabulary.

Language relies on visual cues from facial expressions, hands, eyes, and movement to communicate. Sign language is used primarily by deaf and hard of hearing people, but many hearing people also use it.

There are multiple types of sign language. Over 300 different sign languages ​​are in active use around the world.

The phrases are vice-principal and physical education. VP or PE.

To know more about Sign Language visit:

brainly.com/question/17878013

#SPJ4

How do you analyze paragraphs of text to see how they are structured?

Will give brainliest

Answers

We can see here that the ways one can analyze paragraphs of text to see how they are structured are:

Identification of the topic and the purpose.Locating the use of signal and transition words.Evaluating the text structure used.

What is a paragraph?

A paragraph is a separate section of writing that discusses a single subject or argument. Although they are not needed by the orthographic norms of any language with a writing system, paragraphs are a common way to structure lengthy prose passages. Paragraphs are known to make up passages and texts.

Whenever one wants to analyze a paragraph, it is important to also know the idea  the paragraph is portraying. Identifying the topic and how signal words are used will go a long way.

Learn more about paragraph on https://brainly.com/question/27073860

#SPJ1

How many known moons does Saturn have?



27 moons.


56 moons.


It has no known moons

Answers

Answer:

56 (?)

Explanation:

According to most sources:

"Saturn has 83 moons. Sixty-three moons are confirmed and named"

Saturn has been known to have a variable amount of moons-- or to put it simply; Saturn is believed to have a ton of moons, both discovered and undisovered-- this also means that the number will grow with every new confirmation.

As of now, Saturn has 63 moons but given the options, 56 is both the closest and most reasonable.

Unfortunately, I do not know the lesson and what it taught so if you are still confused and have the option it might be helpful to re-read.

Why do people like smaller breed cats more than bigger breeds? Give a paragraph explanation! Brainly to the best answer!

Answers

Antelope and other breeding-territory animals cannot be housed in crowded enclosures. Cheetahs were revered as pets by the ancient Egyptians, but they couldn't reproduce without complicated courtship rituals, which included running very far together. As a result, they were never domesticated.

What do you mean by Breed?

A breed is a particular group of domestic animals with uniform look, uniform behavior, and/or other traits that set it apart from other members of the same species.

Big cats and domestic cats are not as dissimilar as you might believe, despite a vast difference in size, habitat, and lifestyle. Even though you wouldn't want to be confined to the same space as a large cat, these powerful predators share many traits with your small, seemingly friendly pet cat.

Therefore, Antelope and other breeding-territory animals cannot be housed in crowded enclosures.

Learn more about Breed, here;

https://brainly.com/question/3158444

#SPJ1

HELP ME!
Suneeta is writing a paper and wants to use part of the quotation below.

Wrigley Houston states, "Today's teens are so reliant on technology that learning to drive is no longer a high priority. They would rather spend their time texting, gaming online, or using social media sites instead of learning to drive. Studies show that over 20% of 16 year olds socialize online more than they do in person."


How should the above quotation be rewritten to show that the second sentence has been omitted?

A.

Wrigley Houston states, "Today's teens are so reliant on technology that learning to drive is no longer a high priority. They would rather spend their time texting, gaming online, or using social media sites instead of learning to drive. . ."

B.

Wrigley Houston states, "Today's teens are so reliant on technology that learning to drive is no longer a high priority. . . . Studies show that over 20% of 16 year olds socialize online more than they do in person."

C.

Wrigley Houston states, "Today's teens are so reliant on technology that learning to drive is no longer a high priority. . . Studies show that over 20% of 16 year olds socialize online more than they do in person."

D.

Wrigley Houston states, "Today's teens are so reliant on technology. . . . They would rather spend their time texting, gaming online, or using social media sites. . . . Studies show that over 20% of 16 year olds socialize online more than they do in person."

Answers

Wrigley Houston states, "Today's teens are so reliant on technology that learning to drive is no longer a high priority. . . . Studies show that over 20% of 16 year olds socialize online more than they do in person."

Which state is Houston in USA?

About Houston. The satellite view shows Houston, one of the busiest seaports in the United States and largest city in the state of Texas. It is the fourth most populous city in the United States. Houston is located on the gulf coastal plain in south-eastern of the state.

Is Houston a good place to live?

Prized for its diversity, Houston is considered one of the best places to live in Texas due to its quality of life and welcoming atmosphere. Best known for its space exploration, energy industry, and affordable cost of living, it is no wonder why Houston has become a top destination for relocation.

To know more about Houston visit:

https://brainly.com/question/15367209

#SPJ1

in which part of your data narrative would you include information about charging stations and the need to increase battery range? 1 point plot setting big reveal aha moment

Answers

False . This details will be included in the plot. In order to build tension in the data story, the plot, or conflict, is used.

It would incorporate two concepts for Gaea's circumstance: Why it's critical that Gaea extend the battery range of its automobiles by 2025, as well as some of the difficulties caused by a scarcity of vehicle charging outlets. You will probably lose control of the story if you share dashboards with stakeholders. This is because you won't be present to explain the meaning of your facts and convey your main point and so we use plots.

The complete question :

Next, you decide on your data narrative’s characters, setting, plot, big reveal, and aha moment. During the narrative, you want to communicate to your stakeholders about the challenges associated with the current lack of vehicle charging stations and why it's important for Gaea to increase its cars’ battery range by 2025.

Information about charging stations and the need to increase battery range will be part of the setting of your data story.

True

False

To know more about plot refer the below link :

brainly.com/question/17889058

#SPJ4

The race was about to start. Katie stepped onto the track. The other runners lined themselves up as well. Katie really wanted to win the race. "Only you yourself can make this happen!" Katie assured herself.

Which word from the passage is an intensive pronoun?

Answers

Answer:

"Yourself"

Explanation:

The word "yourself," which is an intense person, is used to stress that only Katie can win the race. This word makes the subject stand out and shows that the person has the power to reach their goals. This is an attempt to explain what an intense pronoun is. 

Intensive words are used to stress the subject or object of a sentence, bringing out their individuality and special skills. By saying "yourself," the text emphasizes Katie's personal drive and desire to win the race, as well as the fact that she can only win through her own efforts. Understanding how heavy words work helps you see how they can make a person's actions and achievements seem more important.

Here's a link to more information about intense pronouns: http://www.brainly.com/question/28106301

Read the excerpt from act 1, scene 3, of Julius Caesar.

[CASSIUS.] Now know you, Casca, I have moved already
Some certain of the noblest-minded Romans
To undergo with me an enterprise
Of honourable dangerous consequence.
And I do know by this, they stay for me
In Pompey’s Porch. For now this fearful night
There is no stir or walking in the streets;
And the complexion of the element
In favour’s like the work we have in hand,
Most bloody, fiery, and most terrible.

What impact does the storm have on the plot?

Answers

The answer is: a violent storm.However, he suggests the brutal weather taking place in Rome prevents people from walking in the street, which in the end is favorable for the bloody, savage deed they are to perform.

What does the storm symbolize in Julius Caesar?In Act 1, Scene 3 of Shakespeare's "Julius Caesar," Cassius summons Casca to Pompey's porch to gather with the rest of the men in their scheme to execute Caesar. However, he suggests the brutal weather taking place in Rome prevents people from walking in the street, which in the end is favorable for the bloody, savage deed they are to perform.When Casca informs Cassius that a party of senators intends to crown Caesar as king the following day, Cassius makes the decision to end his life rather than become Caesar's subject.He informs Casca that he has already lined up some of the most honorable Romans for "some business."Cinna approaches, having joined this "business."Cassius genuinely thinks Caesar aspires to be a despot.

To learn more about Julius Caesar refer

https://brainly.com/question/12003333

#SPJ1

PERSONAL RESPONSE: Does the text's argument that success may be more dependent on practice than on natural ability correspond to what you have read, seen, experienced, or believe to be true? In what way is your own perspective on the topic similar or different? Respond to points made in the text with evidence from your reading and personal experience. This is in the story The Outliers: The Story of Success.

Answers

The definition of a successful life is one in which the individual feels they have either maximised their potential and environmental influences or have been able to overcome challenges.

What is Success ?

Success, in my opinion, is more dependent on effort than it is on innate talent. This is due to the fact that in order to succeed at a particular activity, we must dedicate ourselves to it and continually stimulate it by engaging in that activity. This can be seen in a variety of situations, including athletes who require rigorous training to succeed, musicians who must put in a lot of study time to succeed, and even ourselves who must work hard to achieve our goals.

Natural talent can aid in this process, but talent on its own is insufficient because talent that isn't used is lost and weakened.

Learn to know more about success: https://brainly.com/question/24959987

#SPJ1

Type the word in correct spelling. (star)

Answers

Answer:

Star

If you read it backward you get Rats.  

Explanation:

2. At the end of page 371, the reader is given a synopsis of the events
occurring in Ithaca while Odysseus is on his journey home. Describe the
conflicts faced by his family while he is gone.

Answers

Odysseus' wife Penelope must ward off suitors who covet Odysseus' riches and property, which is one of the issues the family must deal with. They are also preparing to murder Telemachus, his son, in the meantime.

Why does Odysseus struggle to get home?

War hero Odysseus looks forward to going home after taking part in the Trojan War. He had no idea the difficulties he would encounter on the way home. One has a celestial foe, and the other has mortal foes. On his return journey, Odysseus enrages a number of gods.

The Sirens, Scylla, and Charybdis were three enemies that the hero Odysseus had to contend with in Homer's epic poem "The Odyssey" as he made his way back to Ithaca. Odysseus receives guidance from the goddess Circe on how to handle them.

To learn more about Odysseus

https://brainly.com/question/6522443

#SPJ1

Rewrite each line of the excerpt from "Beowulf" below in your own words.

Wide, I heard, was the work commanded,
for many a tribe this mid-earth round,
to fashion the folkstead. It fell, as he ordered,
in rapid achievement that ready it stood there,
of halls the noblest: Heorot he named it
whose message had might in many a land.
Not reckless of promise, the rings he dealt,
treasure at banquet: there towered the hall,
high, gabled wide, the hot surge waiting
of furious flame. Nor far was that day
when father and son-in-law stood in feud
for warfare and hatred that woke again.

Answers

Hello,

I hope you and your family are doing well!

I heard that a great task had been given,

to build a hall for many tribes on this earth,

and it was accomplished quickly, as he commanded,

so that it stood there, the noblest of halls.

He called it Heorot,

whose message had power in many lands.

He was true to his word, giving out treasure at the feast,

and the hall rose high, with wide gables, ready for the fierce surge of flames.

It was not long after that the father and son-in-law were at war

because of the hatred and conflict that had been reawakened.

---

Please consider giving this 5 stars and brainliest if you find it helpful.

Happy Holidays!

6. (recoiled) The boy​

Answers

Answer:

Recoiled: Suddenly spring or flinch back in disgust, horror or fear.

Identify the following.

Where is he going? 

fragment
simple sentence
complex sentence

Answers

The answer is simple sentence

FAST ALL POINTS
Select one of the following landmark cases to research:
Hazelwood v. Kuhlmeier
Tinker v. Des Moines
Korematsu v. United States
Research your selected case on United States Courts and Oyez, or two other valid and credible sources.
Review the rubric for this assignment, and complete the 02.10 Advanced On the Case one-pager here. You can find a completed example here.
Submit your completed worksheet to 02.10 Advanced On the Case.

Answers

It creates mystery and interest. In the excerpt, the narrator couldn't guess what Gatsby is actually thinking or what his intention is this situation will create a sense of mystery and interest for the readers who will make the readers keep reading in order to know what's actually happening.

Which excerpt from The Great Gatsby is the best example of foreshadowing?

He stretched out his arms toward the dark water in a curious way, and, far as I was from him, I could have sworn he was trembling. Involuntarily I glanced seaward — and distinguished nothing except a single green light, minute and far away, that might have been the end of a dock. When I looked once more for Gatsby he had vanished, and I was alone again in the unquiet darkness.

Of course I knew what they were referring to, but I wasn’t even vaguely engaged. The fact that gossip had published the banns was one of the reasons I had come East. You can’t stop going with an old friend on account of rumors, and on the other hand I had no intention of being rumored into marriage.

Therefore, It creates mystery and interest. In the excerpt, the narrator couldn't guess what Gatsby is actually thinking or what his intention is this situation.

Learn more about unquiet darkness on:

https://brainly.com/question/6325287

#SPJ1

To Woolridge, what is the importance of imagery

Please tell me what paragraph you found it in

Answers

The purpose of images in poetry is to convey the poet's message in a powerful, vivid and highly visual language.

What is the importance of imagery?

A poet uses words to create images in our minds that help us interpret poetry as he sees it. You'll be prompted to document yourself so you can read and relate to it, and sometimes the images can be terrifying, like Ted Hughes' "Vampires." Sometimes the images are delicate and beautiful, like in Shakespeare (Sonnet 18), "Shall I liken you to a summer's day?" Sometimes poets use metaphor for comparison, sometimes they use personification, sometimes they use metaphor. Everything has a visual effect on us to shock or delight.

Therefore, The purpose of images in poetry is to convey the poet's message in a powerful, vivid and highly visual language.

To know more about imagery, visit:

https://brainly.com/question/25938417

#SPJ1

Write a formal message of condolence using the following Rita Karki - 46 Years - died of cance helpbul, sociable - a leader of the community - active- miss her very​

Answers

Answer:

Explanation:

It is a huge loss for our community today. We have lost one of our great leader. Rita Karki was the most sociable and helpful person I have ever met. She was a true gem. She is an inspiration to a lot of people around the globe. She fought bravely against cancer. Even when she was in the most critical state, she was truly a kind, honest and wonderful person. Her loss is ours as well as her family's.

She was the forerunner of many activities of the community. She will be missed by each and everyone of us. All our prayers and condolences goes with the family. She will always be remembered.

Write down the important events of the story to build a fire by jack London in order

Answers

The important events of the story to build a fire by jack London in order is On a cold, windy afternoon, he travels to his camp against the advice of a seasoned miner. He slips on some ice and gets his feet wet, necessitating the construction of a fire to dry off and warm up. Unfortunately, his fire goes out, and the man freezes to death.

What is story ?

A narrative, story, or tale is any account, whether nonfictional or fictional, of a series of related events or experiences. Narratives can be presented through a sequence of written or spoken words, through still or moving images, or through any combination of these.

A man is traveling through the great North American wilderness with only his dog for company, in temperatures of seventy degrees below zero. A misstep sends his foot through the ice as he crosses a frozen stream. He knows he must build a fire to keep himself warm or face death.

Thus, The important events of the story to build a fire by jack London in order is On a cold, windy afternoon, he travels to his camp against the advice of a seasoned miner.

To learn more about the story, follow the link;

https://brainly.com/question/9148951

#SPJ1

8
What is an example of something that is both a morpheme and a phoneme?
O A.
the pronoun "I"
OB.
an image of a scarab
OC.. the word "astronaut"
O D. the prefix "anti-"

Answers

Answer:

A. the pronoun "1"

Explanation:

Which statement accurately describes how to
properly use a semicolon to join independent
clauses?

Answers

Answer:c

to join independent clause you need to be a citizen and meet a lot of other expectation

Other Questions
if such a laser beam is projected onto a circular spot 1.8 mm in diameter, what is its intensity in w/m2? The width of a claroom i 4meter le than the length. It area i 45cm*45cm. Find the dimenion of the claroom sonata form consists of three main sections, exposition, development, andquestion 10 options:introductionrecapitulationmotivestransition a nurse teaches an adolescent client with asthma to independently administer breathing treatments. which principle should the nurse keep in mind when planning the teaching session? 1. compute total variable cost per unit. 2. compute total fixed costs. 3. prepare a flexible budget at activity levels of 12,000 units and 16,000 units. Can anyone help me out. Really need this turned in Solve x for this diagram why did the framers of the constitution put the principles of checks and balances and separation of powers in the constitution? can someone help me on this thank you and help me as soon as possible please. the following figure shows the general steps that occur when a researcher uses the crispr-cas9 system to modify a protein-encoding gene in a eukaryotic cell with the goal of modifying the protein product. drag the descriptions of the steps to their appropriate locations on the figure. Based on your knowledge of the compounds and the visible light spectra, label thecompounds in increasing energy order of energy of the light that was emitted.Lowest EnergyLithiumCopperHighest EnergyCalciumPotassiumBariumSodiumStrontium The classroom outside bag had 5 frisbees in it. If 25% of the outside toys are frisbees, then how many total toys are in the bag? Suppose your gross monthly income is $6,500 and your current monthly payments are $525. If thebank will allow you to pay up to 38% of your gross monthly income (less current monthly payments)for a monthly house payment, what is the maximum loan you can obtain if the rate for a 25-yearmortgage is 8.65%? 7.) Given the following triangle, what is the value of x and the value of y ? Venezuela declares independence from Spain. A chemist measures the temperature of a solution in C. The measurement is denoted C, and is normally distributed with mean 40C and standard deviation 1C. The measurement is 1.8C32. What is the distribution of F? a) F N(104,3.24) b) F N(104,1.80) c) F N(40,3.24) d) F N(40,1.80) Which sentence best supports the claim that Oceanians will not leave any type of legacy behind after death?Select one:a. Her feelings were her own, and could not be altered from outside.b. Whatever happened you vanished, and neither you nor your actions were ever heard of again.c. They were governed by private loyalties which they did not question.d. They were not loyal to a party or a country or an idea, they were loyal to one another. what is the concentration of a solution prepared by mixing 5.00 ml of deionized water with 3.00 ml of a 1.31 m solution? 1. Which two important latitudes cross the continent of North America? Classify these sequences based on their potential to modify protein products. The plain letters in the sequences represent protein coding regions, and the bold letters represent noncoding regions.TACCTTAATT TACCTTAATTATTGAGACCGT GAGACCAGT