AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer 1

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g


Related Questions

The β chains of HbA and HbS were treated with trypsin, and the sequence of the N-terminal tryptic peptides are as given below. Do these peptides separate from each other in an electric field if the pH is 7.0? Explain in detail the reasoning behind your answer and include your calculations for the charge of each peptide in your answer.

HbA: Val-His-Leu-Thr-Pro-Glu-Glu-Lys

HbS: Val-His-Leu-Thr-Pro-Val-Glu-Lys

Answers

Yes The two peptides will separate from each other in an electric field when the pH is 7.0

The two peptides wil drift/separate from each other when the pH is 7.0 because of the reaction of trypsin enzyme and also the difference in charge between HbA and Hbs

Considering charge of each peptide

Since The isoelectric point of normal Hba is 6.9 and Hbs possess two fewer negative charges per hemoglobin molecules

The Hbs is more hydrophobicity than HbA due to the substitution of glutamic acids of HbS by valine residue.

Considering Electrophoresis

At a lower pH level Hbs shows a slower moving band than Hba

while a higher pH level the HbS peptide is less negatively charged while the carboxyl group of HbA is more negatively charged and Hba moves faster as well as an acidic pH.

Hence we can conclude that the two peptides will separate from each other in an electric field when the pH is 7.0

Learn more about peptides : https://brainly.com/question/17089864

Help help help help buissness

Answers

Explanation:

B . Pa brainlist hope it helps I'm new here

I need help with this answer it’s a bit tricky

Answers

Answer:

organic selection

Explanation:

,,,,Organic selection

How and why does the surface of the earth change
of the earth has changed?

Answers

Answer:

How and why does the surface of the earth change

of the earth has changed?

It can be hard to describe change on the surface without bringing up the interior. Earth is a system of constantly changing interactions between interior, surface conditions, and external events.

Volcanoes bring up new material and even create land. The Hawaiian islands, for instance are a chain of volcanoes on the surface, but the underlying structure is a single magma plume. In a way, the entire chain of islands is a single volcano that breaks through different places as the crust moves over it.

On that note: plates. Earth is made of tectonic plates that constantly move. Some grind against one another, others collide, and some pull apart. Depending on direction and interaction, you get anything from mountains, to spreading valleys, oceans, and anything else you care to name. Mountains can almost be viewed as something akin to the ridges of build up ice on a window scraper.

Erosion by water, wind, sand, chemicals, and living things changes the surface too. Materials on the surface face an incredible number of forces breaking them down and dragging them away, even as those same forces in different places and situations deposit those materials in other places, building things back up.

“Stardust” is also a thing. Rocks, dust, debris, and all sorts of random, natural cra.,p is constantly hitting our atmosphere. Regardless of whether or not it stays mostly intact, some material breaks off, and most of it does tend to make it to the surface, adding tiny amounts of matter all the time. …of course something BIG enough hitting the surface can throw rocks and chunks of surface clear into space, so that’s a thing too.

Remember when I mentioned living things? Living things D.,IE! Gac.k! And when they do, they break down into organic gunk. Soil - the stuff we grow crops in - is basically minerals and dead things that are decaying into nutritious, yummy, dir.,t.

Weather changes things too. Rain erodes, but rain that soaks a rock, and then is frozen by low temperatures, breaks the rock. Too much rain can create flooding, which results in a lot of sediment moving downstream. Heat can dry things out, crack the ground, and even slowly cook one kind of soil into another. Lightning can make glass out of sand, snow can collapse weak ground, not enough rain can dry out ground that could si.nk down without the extra pressure, and too much rain can literally move mountainsides if enough water adds its weight to the rocks and dir.t.

It’s always changing, and there is always more complexity to go into when studying it. There’s seldom a single cause, or reason, or effect for anything.

Explanation:

Have a great day!

The surface of the earth is constantly changing.

Explanation:

Wind, water,and ice break down large rocks and move sediments on the surface. Some events, though, change earth's surface much more quickly. These include volcanic eruptions, earthquakes, and landslides.

Simone is creating a model to track the movement of carbon atoms in an ecosystem. Which statement best explains the role of plants in Simone's model?

Answers

Although I cannot see the model for Simone's experiment, I can offer the insight that the most likely role of plants in the model is that they consume the carbon atoms and produce oxygen.

How do plants affect the carbon in the atmosphere?Plants are known to have a great effect on the carbon levels of the atmosphere. The correlation is that the more plants are present, the less carbon is free in the air. The reason for this is that plants use carbon dioxide as a substrate to manage the process of photosynthesis.As a by-product, after consuming carbon dioxide and completing photosynthesis, plants release oxygen into the atmosphere.

Therefore, we can confirm that the most likely role of plants in the model created by Simone, is that they will consume carbon atoms in the form of carbon dioxide in order to sustain photosynthesis, which releases oxygen.

To learn more about photosynthesis visit:

https://brainly.com/question/1388366?referrer=searchResults

4. How does the life of a sperm cell vary among the mosses, ferns, gymnosperms and angiosperms?

Answers

Answer:

They evolved on land to begin with from earlier now extinct groups groups so there was no need to adapt to life on land, other than to adapt to different terrestrial environmental pressures. Land can be everything from next to a river to a hot desert to rocks to Antarctica, and plants grow in all those places.

As well, there are thousands of species that are floating aquatics or submerged aquatics, including many ferns, and even some gymnosperms grow as marginals, and many species of angiosperms, mosses, ferns, and even some gmnosperms grow as epiphytes, or as parasites, or other ways.

Which process in the cell cycle could lead to a cancerous cell?

Answers

Answer:

Cancer is unchecked cell growth. Mutations in genes can cause cancer by accelerating cell division rates or inhibiting normal controls on the system, such as cell cycle arrest or programmed cell death. As a mass of cancerous cells grows, it can develop into a tumor

Explanation:

Which of the following show similarities between organelles and organs of the body?

Answers

Answer:

Organelles are specialized structures that perform various jobs inside cells. The term literally means “little organs.” In the same way organs, such as the heart, liver, stomach, and kidneys, serve specific functions to keep an organism alive, organelles serve specific functions to keep a cell alive.

Explanation:

Consider the fact that cancer is most easily defeated when it is found early, and then consider the time and expense involved in diagnosing a potential case of cancer.

Answers

Answer:

Early diagnosis of cancer focuses on detecting symptomatic patients as early as possible so they have the best chance for successful treatment. When cancer care is delayed or inaccessible there is a lower chance of survival, greater problems associated with treatment and higher costs of care.

Explanation:

What does PONCH stand for?

phosphorus, oxygen, nitrogen, carbon, and hydrogen

phosphate, oxygen, nickel, carbon, and hydroxide

pulmonate, oxygen, sodium, calcium, and helium

phosphate, oxygen, nitrogen, carbonide, and hydrogen

Answers

Answer:

PONCH stands for : phosphorus, oxygen, nitrogen, carbon, and hydrogen.

Where does meiosis occur in male and female?

Answers

Testes in males and ovaries in females
Regarding the human reproduction process, the meiosis occurs in the seminiferous tubules of the testes of the males, whereas the process takes place in oogonia cells of the females. In males, the meiosis significantly takes place at puberty, whereas in females, it takes place at the time of birth.

If human activity continues at its present rate, what will probably happen to the levels of carbon dioxide and other gases?​

Answers

The last time there was this much carbon dioxide (CO2) in the Earth's atmosphere, modern humans didn't exist. Megatoothed sharks prowled the oceans, the world's seas were up to 100 feet higher than they are today, and the global average surface temperature was up to 11°F warmer than it is now.

The ___________________ contains receptors for monitoring the position of the head.

Answers

Answer:

Vestibular Receptors

Explanation:

Located in the ear, only in the ear. When you are talking about position of other body parts this is called proprioceptors (sense positions of like arms, legs and other body parts).

Utricle and saccule, both in the vestibule;

One important function of bones is to produce ……………….

Answers

Answer:

Red blooded cell, White blooded cell and platelets

Leukocyte, erythrocytes , platelets

the components of every food chain are​

Answers

Answer:

Explanation:

A food web consists of several components; primary producers, primary consumers, secondary consumers, tertiary consumers, and so on. Primary producers include green plants and are the foundation of the food web.

Answer:

hope the above picture helps

plz follow me too

n

I am new here .....

What is carrying capacity? What factors could influence the carrying capacity of a population?

Answers

Answer:

Carrying capacity can be defined as a species' average population size in a particular habitat. The species population size is limited by environmental factors like adequate food, shelter, water, and mates. If these needs are not met, the population will decrease until the resource rebound

Humans have increased the world's carrying capacity through migra:tion, agriculture, medical advances, and communication. The age structure of a population allows us to predict population growth. Unchecked human population growth could have dire long-term effects on our environment.tion

what are microorganisms?​

Answers

Answer:

A microorganism is a living thing that is too small to be seen with the naked eye. Examples of microorganisms include bacteria, archaea, algae, protozoa, and microscopic animals such as the dust mite.

Which of the following best describes how the amount of DNA in the cell changes during M phase?

The amount of D N A doubles as the D N A is replicated.
The amount of D N A slightly increases as a result of new organelle synthesis.
The amount of D N A does not change while the cell grows.
The amount of DNA is halved as the cell divides into two daughter cells.

Answers

Answer:

The amount of DNA doubles as the DNA is replicated

Explanation:

on the graph it shows that the DNA is x2 by the time it reaches G2

The amount of DNA is halved as the cell divides into two daughter cells. Therefore, option (D) is correct.

What is M phase?

M phase, also known as mitosis, is the phase of the cell cycle in which a cell divides into two daughter cells. M phase is divided into several stages, including prophase, prometaphase, metaphase, anaphase, and telophase. During prophase, the cell's nucleolus disappears and the chromatids (replicated chromosomes) become visible. In prometaphase, the nuclear envelope breaks down and the mitotic spindle begins to form.

During metaphase, the chromosomes line up at the equatorial plane of the cell. In anaphase, the sister chromatids are separated and move to opposite poles of the cell. Finally, in telophase, two new nuclei form and a new cell wall begins to grow between the two daughter cells. Overall, M phase is a crucial step in the cell cycle that ensures the accurate segregation of genetic material to the daughter cells.

Learn more about M phase, here:

https://brainly.com/question/210041

#SPJ2

Starting from the sun, create a food chain including three organisms.

Answers

Answer:

sun ----> plant -----> bunny

Explanation:

the sun helps the plant grow, then the bunny eats the plant.

Answer:

Sun, Plankton, Herring

Explanation:

The sun Provides energy for the plankton to conduct photosynthises, which in turn allows for herring to eat the plankton

Pleaseeee someone help me . What is the half life of Caron 14 of this problem ???

Answers

Answer:

5730 years

Explanation:

In a chemical reaction, including radioactive decay, the half-life of a species is the time taken for the substance to decrease to exactly one-half its initial value.

For a first-order reaction, the half-life of the reactant is

                                                  [tex]t_{\frac{1}{2}} \ = \ \displaystyle\frac{\ln 2}{\lambda} \ \ \ \ \ \ (1)[/tex],

where λ is the reaction's rate constant modeled by the differential equation describing the kinetics of a first-order reaction

                                               [tex]N \ = \ N_{0}e^{-\lambda t} \ \ \ \ \ (2)[/tex],

where N is the remaining amount of substance after time t and [tex]N_{0}[/tex] is the initial amount of substance before the chemical reaction proceeds.

Since the value of λ is constant, rearrange equation (1) with λ as the subject,

                                                       [tex]\lambda \ = \ \displaystyle\frac{\ln 2}{t_{\frac{1}{2}}}[/tex].

Given that only 12.5% of carbon-14 remained after 17190 years assuming that initially there was 100% of carbon -14, substitute in the values into equation (2) and solve for λ (make λ the subject of the equation),

                               [tex]\-\hspace{0.56cm}12.5 \ = \ 100e^{-\lambda \times 17190} \\ \\ \-\hspace{0.5cm} \displaystyle\frac{12.5}{100} \ = \ e^{-17190\lambda} \\ \\ \displaystyle\frac{\ln\displaystyle(\frac{1}{8})}{-17190} \ = \ \lambda \\ \\ \-\hspace{1.05cm} \lambda \ = \ \displaystyle\frac{3\ln2}{17910} \ \ \ \ \ \ \ \ \ \ (\ln \displaystyle\frac{1}{x} \ = \ -\ln x\ ; \ \ln x^{n} \ = \ n\ln x )[/tex]

Equate both λ,

                                            [tex]\displaystyle\frac{\ln 2}{t_{\frac{1}{2}}} \ = \ \displaystyle\frac{3\ln2}{17190} \\ \\ \-\hspace{0.26cm} t_{\frac{1}{2}} \ = \ \ln 2 \ \times \ \displaystyle\frac{17190}{3\ln2} \\ \\ \-\hspace{0.26cm} t_{\frac{1}{2}} \ = \ \displaystyle\frac{17190}{3} \\ \\ \-\hspace{0.26cm} t_{\frac{1}{2}} \ = \ 5730[/tex]

*Note that the above calculations demonstrated that carbon-14 went through 3 half-lives to yield a remaining 12.5% of its original amount, since

                                 [tex]100\% \ \overset{t_{\frac{1}{2}}}\longrightarrow \ 50\% \ \overset{t_{\frac{1}{2}}}\longrightarrow \ 25\% \overset{t_{\frac{1}{2}}}\longrightarrow \ 12.5\%[/tex].

Therefore, if n is the time taken for carbon-14 to half its initial amount trice to remain 12.5% of its initial amount. Then, the half-life of carbon-14 is [tex]\displaystyle\frac{n}{3}[/tex].

Did you know that your bum can make three states of matter? Solid, Liquid, ad Gas

Answers

Answer:

Nope

Explanation:

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Nope

Q2. How are rainbows formed in nature?
help po need na po mamaya

Answers

Answer:

A rainbow is caused by sunlight and atmospheric conditions.

Explanation:

I hope it helps you!

The percentage of ATP production for a strength/power athlete during an aerobic activity during the first 10 seconds of the activity would be Question 7 options: 30 20 < 15 60

Answers

During aerobic activity, high number of ATP molecules are produced due to the addition of oxygen in it.

The percentage of ATP production for a strength/power athlete during an aerobic activity during the first 10 seconds of the activity would be higher than activity of anaerobic. Aerobic respiration process produces up to 38 ATP molecules per glucose as compared to anaerobic respiration produces only 2 ATP molecules per glucose.

This shows that aerobic respiration produces 15 to 20 times higher energy as compared to anaerobic respiration so we can conclude that during aerobic activity, high number of ATP molecules are produced due to the addition of oxygen in it.

Learn more about aerobic respiration here: https://brainly.com/question/11691469

Learn more: https://brainly.com/question/26054400

our atmosphere contains 78% free

Answers

Answer:

nitrogen

Explanation:

If distance equals speed multiplied by time,
then how far does a sound travel if it has a speed
of 330 m/s, and travels for 10 seconds? Be sure to
give an answer with units.

Answers

Answer:

3300 meters

Explanation:

so the formula is in the questtion

distance=speed*time

so distance=330*10

to get the units you have to look to see that the only unit that is a distance is meters

hope this helps!

Proteins provide a lot of functions for your body. Choose a function of proteins
A. long term energy
B. short term energy
C. build muscle, hair, and nails
D. genetic information

Answers

the answer is C build muscle hair and nails

List the angles in order from smallest to largest. Note image in not drawn to scale

Answers

Answer:

maybe cab If it's wrong I'm so sorry

A good example of a positive feedback mechanism would be
(select all
that apply)
A. breast feeding
B. regulating glucose levels in the blood C.enhancement of labor contractions during parturition
D. blood clot formation
E.body temperature regulation
F. blood calcium level regulation

Answers

Answer:

enhancement of labor contractions during parturition

PLS HELP WHAT SHOULD I WIRTE?)
Write your own acrostic poem using the word "THANKFUL". You can use words or phrases for each line. Make sure to write about what you are thankful for.

Answers

Opening my eyes
And observing the skies
Feeling my mom's touch
And kissing her a bunch
As i watch her smile
Showing her mesmerizing teeth
Going out on saturdays
And watching friends on sundays
Is what i am thankful for everyday

I need help with this one

Answers

Im not 100% sure more like 37% but i think its D i was looking on the internet for some while thats the closest i got so sorry if im wrong
Other Questions
9 13 / 16 + 10 3 / 8 = SOEMONE PLEASE TELL ME DID I CLICK THE RIGHT ONE PLEASE PLEASE HELP ME Which expression is equivalent to 53p + (16p + 7p) find answerthe rounded one Work out length AC.10 cmNot drawnaccurately1207 cm Select All equivalent expressions to 4( x + 2) Voting for one party on a state level and the opposite party on a national level is known as _______ - __________. Which expression is equal to 6/7? 1/2x divided by 3=6 what is x plz help me to answer why was papyrus so important to the ancient egyptians? At a basketball game, for every basket team A scored, team B scored 4 baskets. The ratio of the number of baskets scored by team A to the number of baskets for team B is A. 1 to 3B. 2 to 3C. 1 to 4D. 4 to 1 what color will a yellow banana appear when illuminated by yellow light prepare an essay about why should we "respect towards nature and creating nature friendly environment." in easy and understandable way. which particle diagram represents a sample of oxygen gas at stp D. Saw A. Mallet B. Gouge C: Pallet 2. What is the common part in all methods of enhancing finished products? A. Preparation of all materials needed. B. Planning and creating of design. C. Smoothening of objects. D. All answers are correct. Smoking status is an example of what type of variable When the power to rule comes from the consent of the people, which is translated through elected officials, it is called Write a two-stanza poem in free verse about your suggestion on how to address social inequality during this pandemic. Would the poster still be effective if one had never read In Flanders Fields? Explain your opinion.