an adaptation is A a trait that helps an organism survive in its enivironment

Answers

Answer 1

Answer:

True

Explanation:

The given statement is true. An adaptation is any characteristic that helps an organism survive or reproduce. As the environment changes, organisms that inhabit it have to change as well in order to survive. The changes they go through can be physical or behavioral. For example, giraffes have very long necks so that they can reach the leaves of tall trees, and birds have very light bones so that they can fly. This is how species continue to thrive for a very long time.


Related Questions

During which phase of mitosis do the chromosomes pull away from the middle of the cell?

Answers

In Anaphase of mitosis chromosomes pull away from the middle of the cell.

During this period the replicated chromosomes are split and moved to the opposite poles of the cells.

What is mitosis?

It is the process by which cell replicates its chromosomes and then segregates them, producing two identical nuclei in preparation for cell division.

What are chromosomes?

It is along DNA molecule with part or all of the genetic material of an organisms.

To know more about mitosis here

https://brainly.com/question/26678449

#SPJ2

A plant or animal that carries a disease or parasite during part of its life cycle is called a(n):

Answers

Answer:

it could probably be host

Answer:

A plant or animal that carries disease or parasite during part of its life cycle is called a host

I HOPE IT HELPS ❤❤

how does water pollution harm water ecosystems?

Answers

Answer:

the animals die due to the chemicals and stuff in the water

Explanation:

Animals that live in a water ecosystem could get poisoned and die of all the pollution in the water, and all the trash that enters the waters.

construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal

Answers

Answer:

dragon warrior or whatever it is called I don't maybe I am right

True or False: Epinephrine enters
the cell after it binds to the receptor.

Answers

i believe it’s true ...

Epinephrine enters the cell after it binds to the receptor. Yes, this statement is true.

What are the functions of epinephrine?

Adrenaline, also known as epinephrine, is a hormone and medication which is involved in regulating visceral functions. It appears as a white microcrystalline granule.

Epinephrine injection is used for emergency treatment of severe allergic reactions (including anaphylaxis) to insect bites or stings, medicines, foods, or other substances.

Through its action on alpha-1 receptors, epinephrine induces increased vascular smooth muscle contraction, pupillary dilator muscle contraction, and intestinal sphincter muscle contraction.

Learn more about epinephrine:

https://brainly.com/question/3882731

#SPJ2

Anaerobes carry on whereas aerobes carry on cellular respiration

Answers

Answer:

Anaerobes carry on cellular respiration in the absence of oxygen, whereas aerobes carry on cellular respiration in the presence of oxygen.        

Explanation:

Many of the cell processes needed need some energy to occur. Cellular respiration is the process by which cells degrade organic compounds and turn them into energy. Cellular respiration follows two ways, which depend on the presence or absence of oxygen, and both of them begin with the process of glycolysis, which occurs in the cytoplasm and does not need oxygen to occur.

Aerobic Respiration

Occurs in the presence of free oxygen.Series of reactions by which pyruvic acid (product of glycolysis) turns into CO₂ and H₂O, producing many ATP molecules. Respiration occurs in the mitochondria.Takes place in two steps or stages: Krebs cycle and electron transporter chain. Glycolysis and Krebs cycle produce electrons, which then travel along the electron transporter chain while releasing energy, and ATP is produced.

Anaerobic Respiration

Occurs in the absence of free oxygenSeries of reactions by which using pyruvate (product of glycolysis) 2 ATP molecules van be produced. There are two ways in which anaerobic respiration can be produced: lactic fermentation and alcoholic fermentation. Lactic fermentation produces lactic acid and 2 ATPAlcoholic fermentation occurs in two steps, and the final products are ethylic alcohol, 2ATP, and 2 CO₂The whole anaerobic process occurs outside the mitochondria.

Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.​

Answers

Answer:

a. The ability to cure genetic diseases by replacing defective genes

Explanation:

What is the role of enzymes in the DNA replication process?
A. Enzymes read the DNA code and build a new DNA molecule from scratch.
B. Enzymes link together to form a template for a new DNA molecule to be built.
C. Enzymes split the DNA molecule into two rails and then transport corresponding nitrogenous bases to each rail.
D. Enzymes link adjacent nucleosides together, becoming an integral part of the structure of the new strands of DNA.

Answers

Answer:

B.

Explanation:

List body external and internal defenses

Answers

Answer:

External would be skin, nose hair, etc. Internal is white blood cells and bacteria that the body makes to help prevent infections.

Explanation:

I’m not sure if anyone knows this or not, can someone try and help me with this question!

Answers

Answer:

it gives them a mental picture of where they need to plant and pick the cotton

Explanation:

Hope this helps

Advantages of using tidal power include O no alr pollution
Otides are predictable
O low environmental Impact
O all of these​

Answers

Answer:

all of these :)

Explanation:

i think

Answer:

Yes The Correct answer is ( All Of These)

explanation:

If an organism is heterozygous for a particular trait, the organism
A.
has the same allele on both chromosomes in a chromosome pair.
B.
is missing alleles on the chromosomes in a chromosome pair.
C.
has different alleles on the chromosomes in a chromosome pair.
D.
has extra alleles on both chromosomes in a chromosome pair.

Answers

Answer: C.

has different alleles on the chromosomes in a chromosome pair

Explanation:

Hetero means different.

A heterozygous condition is one in which the child inherits various eye-color genes from both biological parents. For that particular gene, a heterozygous genotype exists when there are two distinct versions. Thus, option C is correct.

What is the particular trait for heterozygous organism?

When two distinct alleles of a gene (one mutant allele and one wild-type allele) are present in a diploid organism's cells, that organism is said to be heterozygous at that particular gene locus.

Heterozygosity describes a particular genotype, since the cell or organism is referred to be a heterozygote just for the particular allele in question.

The heterozygote may, however, occasionally have a phenotype that is somewhere between the phenotypes of both homozygous parents.

Therefore, has different alleles on the chromosomes in a chromosome pair.

Learn more about heterozygous here:

https://brainly.com/question/29327683

#SPJ2

The diagram shows the moving molecules in a beaker of liquid. What will happen if the molecules increase their speed?

A.
the liquid will become a solid

B.
the temperature of the liquid will increase

C.
the temperature of the liquid will decrease

D.
the molecules will gain mass

Answers

Answer:

I believe the answer to this question is B

In a series of rock layers, where do you find the oldest layers? Explain why?
Your answer
Please helppp meh!!

Answers

Answer:bottom

Explanation:

How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?

Answers

Answer:

Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.

Which belongs in each place

Answers

Answer:

1=e, 2=b, 3=c, 4=d, 5=a

Explanation:

.

What are some environmental indicators?

Answers

Biological diversity, food production, average global surface temperature and carbon dioxide concentrations in the atmosphere

Please help I'm behind

Answers

Answer:

B : Barometer

Explanation:

A barometer is a scientific instrument used to measure atmospheric pressure, also called barometric pressure. The atmosphere is the layers of air wrapped around the Earth. That air has a weight and presses against everything it touches as gravity pulls it to Earth. Barometers measure this pressure.

You should be on the lookout for tornadoes
during___
because the two often occur
together.
х
thunderstorms
winter storms
blizzards
hurricanes

Answers

The answer would be A.thunderstorms

Hope this helps

Have a great day/night

decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Answers

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

Mitosis is responsible for growth, repair, and maintenance in an organism because

a. it occurs at a faster rate than meiosis.
b. the chromosome number is reduced by half.
c. exact duplicates of each mother cell are produced.
d. it is the only process that involves replication of genetic material.

Answers

Answer:

The correct answer is c

Explanation:

USA test prep

Identify the advantages and disadvantages of internal and external fertilization

Answers

When a sperm fertilizes an egg within the female, it is known as internal fertilization. The advantages of internal fertilization are that the fertilized egg is protected from predators and harsh environments, thus ending in higher chances of survival. Also, there is a lesser chance of desiccation of gametes. Disadvantages of internal fertilization are that there are lesser number of offspring produced at a given time because it is sometimes difficult for the male and female to come into intimate contact. Additionally, the risk of sexually transmitted diseases also increases.

Every cell contains DNA. The main purpose of DNA is to store the cell’s genetic information. How does DNA control the cell?
A. DNA activates nerve signals in the nervous system
B. DNA speeds up chemical reactions and lowers activation energy
C. DNA protects the cell from invaders.
D. DNA determines what proteins are made.

Answers

Answer:

The answer is D: DNA determines what proteins are made.

Explanation:

The nucleotide sequences that make up DNA are a “code” for the cell to make hundreds of different types of proteins; it is these proteins that function to control and regulate cell growth, division, communication with other cells and most other cellular functions.This process is called protein synthesis.All known cellular life and some viruses contain DNA. The main role of DNA in the cell is the long-term storage of information. It is often compared to a blueprint, since it contains the instructions to construct other components of the cell, such as proteins and RNA molecules.

Hope this helps!! ;)

DNA controls the cell by determining what protein are synthesized by the cell. Thus, the correct option is D.

What is Translation?

Translation is the process of synthesis of proteins from the mRNA (messenger RNA) of the cell. This process occurs in the ribosome of the cell. In this process, the mRNA produced from the DNA encodes amino acids which join together to form large polypeptide and protein molecules.

mRNA are produced from DNA through the process of transcription. Transcription occurs in the nucleus of the cell. Through this process, DNA produces a sequence of mRNA which is complementary to it. This mRNA determines what proteins will be synthesized by the cell.

Therefore, the correct option is D.

Learn more about DNA here:

https://brainly.com/question/264225

#SPJ6

10. Modern telescopes make it possible for astronomers to detect planets around distant stars. Why couldn't
astronomers detect these planets before?
A. The planets are much closer than the stars they orbit.
B. The planets are much larger than the stars they orbit.
C. The planets are much farther than the stars they orbit.
D. The planets are much smaller than the stars they orbit.

Answers

Answer:

I would Say the answer is D

Explanation:

Answer:

I I think it’s D

Explanation:

D the planets are much smaller than the stars they orbit.

What abiotic factors might affect a population of fish? Check ALL that apply.

clear water
light
temperature
food

Answers

Answer:

Clear water, light, and tempature.

Explanation:

5. Why might a cell need to phagocytose?

Answers

Answer:

Phagocytosis is a critical part of the immune system. ... By knowing the enemy, the cells of the immune system can specifically target similar particles circulating in the body. Another function of phagocytosis in the immune system is to ingest and destroy pathogens (like viruses and bacteria) and infected cells.

Explanation:

True or false the main source of energy and water cycle is gravity

Answers

Answer:

False please mark me brainlest.

Explanation:

1. What Does DNA stand for?​

Answers

Answer:

deoxyribonucleic acid

DNA stands for deoxyribonucleic acid.

The energy related to the motion of an object is called ___.

Answers

Answer:

The answer is  kinetic energy

Explanation:

Kinetic energy is the correct answer

(GIVING BRAINLIEST!!)
Which common characteristic of planets do Saturn and Earth share?

A) They have rings.
B) They have moons.
C) They are made of rock.
D) They have thick atmospheres.

Answers

Answer:

THEY HAVE MOOOONNNNSSSSS

Explanation:

The answer is C. Earth doesn’t have rings. Saturn has way more moons then earths
Other Questions
36. Write the triangle congruence criterion illustratedby each pair of triangles. An online store holds a sale. Of the 400 customers who make purchases during the sale, 20 use a coupon. What percent of the customersdo not use a coupon? Your receipt for your visit at a restaurant isshown below. If you leave a 15% tip, what is thenew total amount? Explain your method.pls hurry Help please Which civilization existed primarily in a Tropical Wet Climate Zone? In tundra vegetation the soil is frozen from____ cm down what is the answer CAN SOMEONE PLEASE HELP ME WITH THIS SCIENCE QUESTION I WILL MARK YOU BRAINLIEST THANK YOU Businesses are important to a free enterprise system because they? helpppp fasttt What is the area of the shaded region A recent poll found that 76% of a random sample of 100 American movie goers thought the popcorn sold at the movie theatre was overpriced.If the sample size was increased to 10,000 American movie-goers, what effect would this have on the estimated percentage of American movie-goers whothink the popcorn is overpriced? I attached a picture down below. Please dont say 2 because I have to compare and contrast where it says directions. So please read it before you write sum Write equation of a line in point slope form that passes through (3,8) and has a slope of5? What is the answer??? 5. What would be the effect if a gene has a mutation in the location of the stop codon? (4 points) Before the passage of the Indian Removal Act, some Plains Native American tribes BLANK to Indian territory. these tribes were often looking for better hunting grounds. After the Indian Removal Act, most tribes BLANK from there lands in the southeastern United States. the U.S government usually forced these tribes to give up there lands What is the slope of the line that passes through the points listed in the table? Table: (4,3) (7,9) A. -2 B. 2 C. 3 D. 6 help hell help help gelp help paragraph about why the third amendment is important i need some help on this i dont know can someone plz help me What is the explanation for the fact that the desert sand is very hot in the day and very cool at night? 1. Sand reflects light very well. 2. Sand is a bad heat conductor. 3. Sand has a low specific heat compared to air Can someone help me?