Answer the following questions: 1. What are ethical values? How do these help character formation? ​

Answers

Answer 1

Answer:

Character education holds that widely shared, pivotally important, core ethical values such as caring, honesty, fairness, responsibility, and respect for self and others, form the basis of good character.

Answer 2

Answer:

Look what. i. said. in another question u wrote

Explanation:


Related Questions

direct trade definition​

Answers

Answer:

Direct Trade is a form of sourcing practiced by certain coffee roasters,tea sellers,etc.

The Texas Constitution was most directly influenced by ____________.

Answers

Answer:

The U.S. Constitution

Explanation:

Improved attention and alertness, reduces anger and anxiety, and pain relief are all effects of ______ on the body.

Answers

Answer:

I think the answer may be stress but I am not sure

Explanation:

If you are not sure anything to do with human psychology might give you a more accurate answer.

Read the excerpt from "Binding Memories.”

Bound by a spine
strong enough to hold entire worlds

What is the denotation of the word "strong” in this context?

powerful
muscular
courageous
skilled

Answers

Answer:

Powerful :)

Explanation:

From the excerpt, the denotation of the word "strong" in this context is powerful. The correct option is a.

What is an excerpt?

An excerpt is a passage that has been cited verbatim from a book, novel, poetry, short story, essay, speech, or other literary work and is used to illustrate a point to the reader. The word excerpt first became in use in the 15th century and comes from a Latin word that means plucked out. The words quotation, quote, fragment, and extract are all synonyms for an excerpt.

There are various reasons why authors use excerpts. Three categories can be made out of these. An extract can be used by a writer to support their feelings or ideas about a subject. Second, a writer can utilize an extract to draw the reader's attention to and help them recall what they want them to grasp.

Finally, a writer may use an excerpt if they want to critique it or provide their comments on it.

Learn more about excerpt, here:

https://brainly.com/question/29708851

#SPJ7

why did the in re gault case reach the supreme court

Answers

Answer:

The proceedings for juveniles had to comply with the requirements of the Fourteenth Amendment.

Explanation:

The proceedings of the Juvenile Court failed to comply with the Constitution. The Court held that the proceedings for juveniles had to comply with the requirements of the Fourteenth Amendment.

Which era of Egypt marked the appearance of the pyramids? (1 point) 1.The Central Kingdom 2.The New Kingdom 3.The Old Kingdom 4.The Middle Kingdom

Answers

3. The Old Kingdom

explanation: it was around 2686 BC

how many characters did tom hanks play in the polar express

Answers

Answer:

he played 5

Explanation:

he played 5 characters

Superstitious behavior is a phenomenon that breaks traditional rules of conditioning. Please select the best answer from the choices provided T F.

Answers

Answer:

A

Explanation:

True

in a typical roman family, what was a typical job for the wife?

Answers

Answer:

The wives had to work for a living. The typical jobs were agriculture,markets,crafts.

Explanation:

"The world is a common house for all". Justify it.

Answers

The world is a common house for all because, fish live in the world and therefore it is their house, plants live in the world and therefore the world is a house for plants as well, humans live in the world and therefore it is our house as well. Even objects like a pair of scissors are in the world. All things live in the world therefore, the world is a common house for all.

Explanation:

If all things can and do live in the world then the world is a common house for all.

Answer:

    We reflected on how earth, Our common home, Cares for us through its living systems(Sun, Air, Soil, Water, Companionship of all). And like all homes, Human share a common desire to protect this home of homes throughout the world are coupled with views from space. "The earth is common house for all"

                         The earth has never been a common house for all even so today.

                                    .....................

biological views of psychological disorders focus on which three main categories?

Answers

Answer:

The biological perspective views psychological disorders as linked to biological phenomena, such as genetic factors, chemical imbalances, and brain abnormalities; it has gained considerable attention and acceptance in recent decades

Explanation:

hope this helps !!

What is the full meaning of
SOCRATES
10k
40 seconds
Starts now

Answers

answer:a person study the mening of life

Explanation:

person stady of life

A psychological test that measures what we intend it to measure is said to be:

Answers

A psychological test that measures what we intend it to measure is said to

be valid.

A test which is accurate in measuring something is said to be valid . A valid

test must

Have a high level of accuracyMeaningfulAppropriate

On the other hand tests which doesn't accurately measure or doesn't

measure what we intend it to is said to be invalid.

Read more about Valid test on https://brainly.com/question/5078914

Which type of reinforcer assessment involves allowing the learner access to many items at one time and observe what they interact with the most

Answers

The type of reinforcer assessment which involves allowing the learner access to many items at one time and observe what they interact with the most is known as:

Free operant

Based on the free operant reinforcer assessment, there is the careful observation of the items which a person interacts with the most without any external interference.

In this type of reinforcer assessment, the aim is to find out the thing which is most favored by a user when he is given the option to make his choice from a wide range of options.

Read more about free operant here:

https://brainly.com/question/25492313

Offensive strategies include preventing the other team from scoring. Please select the best answer from the choices provided. T F.

Answers

Answer:

true what more do u need

Explanation:

Answer:

False

Explanation:

help me please please please argue the assertion 'useful is the person who relies not only on reason and science but also on love and feeling' relying also on the book Fausti please help ​

Answers

Answer:

one should always take in any and all information and retain what you feel is useful or not and follow your instructions from your guide from within

What can a driver do from a shared left turn lane?

Answers

Answer:

What is a shared left turn lane and how do you use it safely? A shared left turn lane allows traffic travelling in either direction to enter the lane and make left turns. You use it properly by not entering too soon, watching out for cars coming out of side streets and entrances, and by only using it for left turns.

Explanation: This is from what my borther told me because he just passed hid Driver's Ed test and this is what I know from real world sims.

From a shared left turn lane a driver can "turn off or turn onto a multi-lane road/highway."

What is the shared left turn lane?

Shared left turn lanes mean that all vehicles moving in either direction can use this lane to turn left. You cannot pass on a road when two solid, double yellow lines divide the roadway.

How do you know it is a shared turn lane?

The center left-turn lane is marked by a solid yellow line on the outside and a broken yellow line on the inside. The solid yellow line on the outside means that you cannot use the shared center lane for passing.

What is a multi-lane road/highway?

Any road with more than one lane in either direction is called a multi-lane road. Lines painted on the road separate traffic into lanes. Roads with more than one lane going in each direction are called 'multi- lane ' roads. Most multi- lane roads have two lanes for each direction.

Hence, the answer was given and explained above.

To know more about shared left turn lane and multi-lane road refer:

https://brainly.com/question/5134248

#SPJ2

         

How is territory organized politically and why?

Need answer ASAP PLSSSSSSS

Answers

Answer:

A state is a politically organized territory with a permanent population, a defined territory, and a government.

Explanation: i hope this is what you were looking for. yw.

Objects are usually easier to remember because they are ______, whereas concepts tend to be harder to remember because they are ______.

Answers

Answer:

Tangible, Intangible

Explanation:

Tangible objects can be perceived using a different amounts of senses while concepts are perceived using lesser senses.

3. Which of the following is not a factor of production?
a. capital resources
b. labor resources
c. natural resources
d. money resources

Answers

Answer:

Labour Resources

Employers demand labor because workers are an important part of the production process. Workers use tools and equipment to turn inputs into output. Without workers, employers couldn't produce goods and services and earn profits.

Explanation:

Hope this helps !!

"Nepalese should have the feeling of coexistence rather than self-existence". clarify it with examples​

Answers

Answer:

2

Explanation:

Because if you add 1  to 8 you get 9 then subtract 9 by 7 then and your answer is 2

Select the answers that best match for that political party's beliefs.

Answers

I am on that to i need halp as well

who is known as guthiyar and thakali ?​

Answers

Answer:

Each member of the guthi is known as a guthiyar and have responsibilities according to the current leadership formation within the group. Thakali people are an ethnolinguistic group originating from the Thak Khola region of Mustang District in the Dhaulagiri zone of Nepal.

Explanation:

NEED HELP ASAP PLZ

If you impose tax on goods, which good should be taxed high, and why?

Answers

No idea how this is social studies most likely items that are expensive would be taxed higher the government would be like oh yes this person has money to buy expensive things make them pay more

Which information can a star chart provide?


the distance from Earth to the nearest star

the distance from Earth to the nearest star

the locations of the North and South Poles

the locations of the North and South Poles

the distance an object is compared to the horizon

the distance an object is compared to the horizon

the locations of constellations at different times during the year

Answers

Answer:

The location of the North and South poles

A star chart or star map, also called a sky chart or sky map, is a map of the night sky. Astronomers divide these into grids to use them more easily. They are used to identify and locate constellations and astronomical objects such as stars, nebulae, and galaxies.

Explanation:

Hope this helps !!

Art and architecture reflect the contemporary life-style.justify this statement with example​

Answers

Answer:

They are the place of historical and cultural importance. They represent livelihood of people, tradition, culture, civilization, and originality. They symbolize the craftsmanship of our ancestors and how people used to make the art and architecture in early days.

Art needs an appropriate built environment within which it can be showcased to greatest effect, while architecture needs art to turn bricks, steel and concrete into a space in which people want to live, to learn, to shop and to work.

I NEED HELP PLEASE HELP ME

Answers

what was the overall purpose for the emancipation proclamation?

Answer: The Emancipation Proclamation was an executive order issued by Abraham Lincoln on January 1, 1863. It proclaimed the freedom of slaves in the ten Confederate states still in rebellion. It also decreed that freed slaves could be enlisted in the Union Army, thereby increasing the Union's available manpower.

So I think it would be: to end slavery everywhere in union

Feel free to correct me if I’m wrong!

Achievements of the Umayyad Caliphs

Answers

Answer:

Establishing Arabic as the official language throughout the empire

Explanation:

The process by which an agency or government (usually a state) grants permission to individuals to practice a given profession by certifying that those individuals have attained specific standards of competence is known as : _________

a. credentialing.
b. accreditation.
c. certification.
d. licensure.

Answers

answer: b. accreditation

Antonio wants to examine the sales in a restaurant during a period of time from 2 hours before to 2 hours after the peak dinner time and graph his results. If the peak dinner time is considered to be at 6 p. M. , what would be the domain for the graph Antonio is creating?.

Answers

The domain of the graph that Antonio is creating is all the x-values or inputs and would show 4 p.m. (2 hours before the peak dinner time), 6 p.m. (peak dinner time), and 8 p.m. (2 hours after the peak dinner time).

When making or evaluating a graph, the domain shows the x-values from left to right. The opposite of the domain of a graph is the range.  The range shows the y-values from down to up.

In this graph by Antonio, the y-values would show the sales values or units that the restaurant recorded at 4 p.m., 6 p.m., and 8 p.m., respectively.

Thus, the domain of Antonio's peak dinner time graph will show all the x-values or inputs about the three-time intervals.

Learn more about the domain of a graph here: https://brainly.com/question/21394181

Other Questions
As part of the Monroe Doctrine, the United States demanded that Europeanpowers:O A. stop participating in the trading of enslaved people.B. establish democratic forms of government.C. give up all of their Caribbean colonies.O D. stop interfering with affairs in the Americas. A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation? Draw the following vector: 350 N, 30 south of east [1 cm = 50 N] 1. One atom contains 29 protons and 34 neutrons. Another atom of the same element has a mass number of 65. How many protons and neutrons does this unknown atom have?A. 28 protons, 37 neutronsb. 29 protons, 36 neutronsC. 29 protons, 35 neutronsD. 31 protons, 34 neutrons 14. Which has the lowest ionization energy?A. beryllium (Be) B. strontium (Sr) Calcium (Ca) D. magnesium (Mg) Simplify this question Look at the circuit given below. It consists of a cell, a bulb with two terminals X, Y and wires. P, Q, R and S are positions marked. What is the direction of the flow of current? a) PQXYRS b) SRYXQP c) SPQXYR d) PSRYXQ WILL REPORT WRONG OR TROLL ANSWERS Which word in the passage most clearly shows the speaker's bias against the candidate? Senator Roberts has no experience as a county commissioner, and she is clearly hopeless. A. commissioner B. clearly C. hopeless O D. experience SUBMIT how long does it take from the time beans are planted until they are harvested Help help help please pelsss please You are pulling a child in a wagon. The rope handle is inclined upward at a 60 angle. The tension in the handle is 20 N.Part AHow much work does the rope do on the wagon if you pull the wagon 200 m at a constant speed? how to solve the following system y=(1/2)x^2+2x-1 and 3x-y=1