Are axolotl prokaryotic

Answers

Answer 1

Answer:

The axolotl, Ambystoma mexicanum, also known as the Mexican walking fish, is a neotenic salamander related to the tiger salamander. Although colloquially known as a "walking fish", the axolotl is not a fish but an amphibian. The species was originally found in several lakes, such as Lake Xochimilco underlying Mexico City. Axolotls are unusual among amphibians in that they reach adulthood without undergoing metamorphosis. Instead of developing lungs and taking to the land, adults remain aquatic and gilled.

Explanation:

Answer 2

Answer:

prokaryotic

Explanation:

I just took the test!


Related Questions

Searches related to what are some of the factors foresters have to consider before making decisions? help meeeee

Answers

forest fires,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,,

Can someone help me with the question please.

Answers

Answer:

B Sun > Algae > Shrimp > Red drum

lee and Celia are lab partners. While Celia pours a chemical into a graduated cylinder, some of the chemical splashed onto her arm . What should happen next?

Answers

Answer:

Celia should tell the teacher and wash her hands and arms twice.

Explanation:

She should tell the teacher because if she is unsure of what to do, the teacher can help her. If there is no teacher present, she should wash her hands and arms twice to remove as much of the chemical as possible. Then she should call a poison help or chemical help center if she is unsure of what to do next.

.... she should lesson to her teacher

Researchers have found that mitochondria and chloroplasts in eukaryotic cells have their own DNA. This DNA is different from the DNA in a eukaryotic cell's nucleus. Chloroplasts and mitochondria use their own DNA and ribosomes to make some organelle-specific proteins.

What statement is best supported by this information?

A.
Modern cells could exist without mitochondria and chloroplasts.
B.
Early prokaryotic cells engulfed eukaryotic cells, which later became mitochondria and chloroplasts.
C.
Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.
D.
Mitochondria and chloroplasts could exist outside of modern cells.

Answers

Answer:

B.

Explanation:

Answer: Early eukaryotic cells engulfed prokaryotic cells, which later became mitochondria and chloroplasts.

Explanation: just did the test its right.

list one part of the cell theory in your own words, explain what it means

Answers

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process


2. Name 2 parasitic flatworms.

Answers

Explanation:

Both flukes and tapeworms are parasites with vertebrate hosts, including human hosts. Flukes live in the host's circulatory system or liver. Tapeworms live in the host's digestive system.

Answer:

any two flatworms are

1. tapeworm

2. liverworm

Explanation:

hopes it could help you

Which of the following is a requirement for a population to be in Hardy-Weinberg equilibrium?

A) The population must be very small
O
B) immigration must outpace emigration
O
C) each allele must be equally beneficial
O
D) There must be a high mutation rate

Answers

I think the answer is B. Immigration must outpace emigration. Hope this helps!

Hardy-Weinberg equilibrium is the principle of the genetic variation being constant. Each allele must be equally beneficial for a population to be in equilibrium. Thus, option C is correct.

What is the requirement of Hardy-Weinberg equilibrium?

Hardy-Weinberg equilibrium states the invariant nature of genetic variation when there are no disturbing factors in a population. For an equilibrium condition, the population should have a large size. Each allele must be equally beneficial so that there is no genetic drift.

There should be no immigration or emigration of the organism in a particular population as it affects the generation and individuals. Also, there must be no spontaneous mutations for the variation to occur.

Therefore, each allele must be equally beneficial for equilibrium.

Learn more about Hardy-Weinberg equilibrium here:

https://brainly.com/question/16823644

#SPJ5

If a male organism has 40 chromosomes in each body cell, how many chromosomes does a female of the same sex have in each of her body cells?

Answers

Answer:

40

Explanation:

they're usually the same

How does evolution result in reproductive success?

Answers

Answer:

Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.

Answer this please I promise 30 points + mark as brainliest ( only relevant answers )

Answers

Answer:

A) Group X = Rose ,mango tree,marigold,palm tree

B) This is the answer of group X =Rose ,mango

This is the answer of group Y =Fern ,pine trees

Explanation:

Answer:

jen, from my heart im saying i lu.v u for real

its been almost 5 months weren't having the same old c.hat we used to have.

ik that ur scared to c.hat with  me since the day ur mom caught u

but still the old memories keep coming into me how many times i try to forget u, i still lu.v u jen still lu.v u

and as i made u a promise that one day we'll meet, i still keep thqat word and that day even if its just one day, we're gonna enjoy the max we could

i'll be waiting for that moment and i hope u would be too...

still lu.v u :(  .......


What is a significant benefit of studying fossils?

Answers

Fossils give clues about environmental changes where the organism lived, fossils can be used to date the time period of rocks and rock layers when the organism lived, fossils can give clues of changes in the organism's body structure over time.

1. DNA: ATACGAAATCGCGATCGCGGCGATTCGG
mRNA:
Codon:
Anticodon:
Amino Acids:

Answers

Answer:
mRNA: UAUGCUUUAGCGCUAGCGCCGCUAAGCC

CODONS: AUG-GAA-AUG

AMINO ACIDS: METHIONINE-LEUCINE


Explanation: hope this helps
i am so confused is this an actual question or is it just random letters?-

all you need is in the photo ​

Answers

Answer:

Aerobic means 'with air' and refers to the body producing energy with the use of oxygen. This typically involves any exercise that lasts longer than two minutes in duration. ... Anaerobic means 'without air' and refers to the body producing energy without oxygen.

Explanation:

hope this helps if not i'll try to figure out the answer for you

A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False

Answers

Answer:

Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.

Answer:

False

Explanation:

A plant is placed near a window. Instead of growing straight up, the plant grows to the side. What is this plant demonstrating? (1 point)
A)phototropism
B)dormancy
C)thigmotropism
D)gravitropism

Answers

The answer is c
If not then i am sorry in advance

A plant is placed near a window. Instead of growing straight up, the plant grows to the side. This plant demonstrates phototropism. Therefore, option A is correct.

What is phototropism?

A plant can maximize photosynthetic light absorption in the aerial portion and water and nutrient uptake in the roots by using phototropism, or the differential cell elongation displayed by a plant organ in response to directed blue light.

Auxin is a hormone found at the ends of leaves and stems that reacts to light. It enables the plant to grow in a way that is favourable to the light source.

When a plant is placed near a window. Instead of growing straight up, the plant grows to the side. Then, this plant demonstrates phototropism. Therefore, option A is correct.

Learn more about phototropism, here:

https://brainly.com/question/24567669

#SPJ2

Answer 15 and 16 correctly and I will mark as brainliest

Answers

Answer:

I think its A and G

Answer:

15. B.

16. H

Explanation:

what is a cell that is the source of other cells

Answers

Answer:

stem cells

Explanation:

HELP ASAP
A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period. Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October. People born in October were more relaxed and could better handle stress. Is the scientist’s research considered science?
Yes, because the scientist conducted his research for an extended period of time.
Yes, because the scientist followed the scientific method.
No, because the scientist conducted his research with 100 people
No, because the scientist followed personalities which is pseudoscience.

Answers

Answer:

No, because the scientist followed personalities which is pseudoscience.

Explanation:

A scientist was studying the stars and their influence on the personalities of 100 people over a Four year time period

Through his investigation, he determined that people that were born during August were more strong-willed and driven than individuals born in October.

People born in October were more relaxed and could better handle stress

Is the scientist’s research considered science?

No, this are beliefs not necesarily true.

Hydrogen ions are found in_____________
which hydroxide ions are found in_______

A. Acids and bases
B. Bases and acids
C. Acids and salts
D. Bases and salts

Answers

Answer:

A

Explanation:

found in acid and bases

please answer this for me​

Answers

Answer:

Im pretty sure its A the phagocytes.

Explanation:

20 points and brainliest! Explain how you got the answer!

Answers

Answer:

No of groups studied

As All other factors will effect the result ofvthe experiment.

But no matter how many groups you take to study they will show the same result

HOPE YOU GOT IT!

MARK ME AS BRAINIEST

write a short paragraph on hydra​

Answers

Answer:

at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)

Explanation:

Hydra are simple invertebrates, with two layers of body cells. They live in fresh water. Their body is radially symmetric. They have a central cavity through which they take in food and expel waste.

You splice DNA fragments from a "foreign" source into the patient's gene so that the gene will begin manufacturing the enzyme. The foreign DNA + the new DNA

Answers

Answer:

recombinant DNA

Explanation:

In molecular biology, recombinant DNA molecules are genetic sequences formed by combining DNA material from different sources (i.e., organisms, populations, species, etc). Proteins produced from DNA recombinant molecules are known as recombinant proteins. Molecular cloning is the most widely used technique in molecular biology in order to produce recombinant DNA molecules. In this technique, a cloning vector such as, for example, a plasmid of a bacterium, is used to insert a foreign DNA fragment into another cell which is then expressed in the host cell.

1. Would you consider a Zonkey (baby created from a donkey raised with a zebra) alive? Keep in mind that a Zonkey is sterile and cannot produce its own offspring.


2. Would you consider a virus alive? It requires a host completely to live.


Answers

Answer to 1:Yes the Zonkey is alive,not all organisms can reproduce. Some people are born with rare genetics were they can't give birth,so even if the Zonkey is sterile and can't produces it own offspring it is alive.

Answer to 2:Yes a virus is alive,it attacks the host and contains/kill other cells in your body. They also can multiple. If they can multiply and even attack and kill other cells they are alive.

Compare the planets Mars and Saturn. Describe how their common characteristics are similar.

Answers

Answer:

Both Mars and Saturn have rings.

Mars And Saturn both have rights with them

when you breathe in air you bring oxygen into your lungs and blow out. A.Carbon dioxide B.oxygen C.carbon monoxide D.hydrogen​

Answers

Answer:

Carbon dioxide

Answer:

Carbon Dioxide

Explanation:

why do atoms of the same element always have the same number of protons but sometimes have different mass number? What do you call these atoms?

Answers

Answer:

However, some helium atoms have more or less than two neutrons. Atoms with the same number of protons but different numbers of neutrons are called isotopes. Because the number of neutrons can vary for a given element, the mass numbers of different atoms of an element may also vary.

please help with this question

Answers

Answer:

C

Explanation:

the answer is C bc I read this and u can site it in the text

Florida's land ecosystems include___________________. Check ALL that apply. *

prairies
forests
beaches
dunes
estuaries

Answers

Answer:

dunes, beaches, and maybe estuaries

Explanation:

i hope thats right.....

(Uhm help?) The law of conservation of energy states that when there is an energy transfer or transformation, energy is lost.

Answers

Assuming this is a true/false question, the answer would be false.

According to the law of conservation of energy, energy is neither created nor destroyed; it simply changes forms.

Unless you are saying that some energy would be lost as heat, This is true.

Answer:

ae you trying to find the meaning?

Explanation:

The law of conservation of energy states that energy can neither be created nor destroyed - only converted from one form of energy to another. This means that a system always has the same amount of energy, unless it's added from the outside. The only way to use energy is to transform energy from one form to another.

ex: the cue ball is shot at a stationary 8 ball. The cue ball has energy. When the cue ball hits the 8 ball, the energy transfers from the cue ball to the 8 ball, sending the 8 ball into motion. The cue ball loses energy because the energy it had has been transferred to the 8 ball, so the cue ball slows down.

Other Questions
. In the nation of Foxystan, a $1000 increase in consumer spending typically causes GDP to rise by $5000. The marginal propensity to save in Foxystan is equal to How does the information in the fourth sentence of the first paragraph ("Denis ... hands") connect Denis with Maltroit?ADenis appreciates Maltroit's status.BNeither man has authentic aristocratic heritage.Denis welcomes Maltroit's handshake,DBoth men demonstrate reserve and a cold arrogance.EMaltroit and Denis are family relations, Write the fraction 9/12 as a percent Can you please help This is due todayI need the equation and answer Equation/the way to do it :Answer: Graph the equation.y =2x-2 Which value is not equivalent 0.37 0.370 37/100 Why might this question trouble the nation for centuries The Sons of Liberty were a group of men who signed the Declaration ofIndependence.*TrueOrFalse The bakers fits 26 rolls on to a pan that measures 1 5/8ft2. How many square feet does the baker use for each roll Based on Webster's words, many southerners would have most likely concluded thatabolitionist forces from the North were about to invade.O northerners were going to leave the Union out of anger.the possibility of compromise on the issue of slavery still existed.the North was going to stop importing cotton from the South. evaluate 5^-1/ -9^0 to its simplest form During the First Crusade, the People's Crusade resulted in European forces:A. capturing land owned by the Church.B. being crushed by Muslim armies.C. protecting Jews from pogroms.D. capturing the city of Jerusalem. Jack is melting butter in a pan. He observes a clear liquid with many solid particles floating in it. Based on Jack's observation, what conclusion can be made about butter? O research existing data on accidents involving carscommunicate the results by telling everyone about the prototypeQuestion 3 (1 point)There is a set number of times you should go through the engineering design process- if your design isn't working by the 3rd time through, it's time to just quit and giveup.TrueFalseTo Angle EFG has a measure of 133. Triangle EFG is rotated 180 counterclockwise about point F to create triangle E'F'G'.what is the measure of angle EFG A florist is making bouquets. Draw lines to match eachdescription with the number of bouquets she can make.52 bouquets630 roses with 10 roses in each bouquet53 bouquets640 roses with 12 roses in each bouquet54 bouquets975 roses with 18 roses in each bouquet63 bouquets1,250 roses with 24 roses in each bouquet if you can do all of the correct answers i will pick the brainliest!!! plz help asap!!! The meaning of an inequality depends on the __________________of the inequality sign. In what ways does the author react differently to Anne Franks diary when she reads it as an adult? Cite evidence from the text to support your answer Five reasons Animals/species are endangered?