[tex]{ \red {\sf{Define \: Transportational}}}[/tex]
2+x=19
Find x ​

Answers

Answer 1
Answer:

Easy!!

2+17=19

#hope that helps

Answer 2

Answer:

To find the answer you may

2+17=19

Explanation:

so that is the answer I'm sorry,to not give all the solutions


Related Questions

What is the theoretical amount of sodium citrate (Na3C6H5O7) produced if you react 85.0g of citric acid (H3C6H5O7) in excess amount sodium hydroxide? If you actually produced 97.3 g of sodium citrate what is the percent yield?

Answers

Answer:

i did not find the amswer sorry

Lead has an atomic number of 82. Which statement describes all neutral atoms and ions of lead?

A) Neutral atoms of lead must have 82 electrons. Ions must have 82 electrons, as well.

B)Neutral atoms of lead must have 82 protons, but ions can have more or fewer.

c) Neutral atoms of lead must have 82 neutrons, but ions can have more or fewer.

D0 Neutral atoms of lead must have 82 protons. Ions must have 82 protons, as well.

Answers

1. The neutral atoms of lead has 82 protons.

2. The ions of lead also have 82 protons.

The correct answer to the question is Option D. Neutral atoms of lead must have 82 protons. Ions must have 82 protons, as well.

Lead, Pb is a metal with an atomic number (i.e proton number) of 82

Metals can only form ions by losing their valence electron(s)

NOTE: In the formation of ions, only the electrons are involved. The protons are not involved. Thus, the protons of the neutral atom and the ion remains the same.

With the above information in mind, we can conclude that neutral atoms of lead must have 82 protons. Ions must have 82 protons, as well.

Learn more about ions: https://brainly.com/question/8527218

Answer:

C. Neutral atoms of lead must have 82 neutrons, but ions can have more or fewer

Explanation:

O Neutral atoms of lead must have 82 neutrons, but ions can have more or fewer. O Neutral atoms of lead must have 82 protons, but ions can have more or fewer.

The valence electrons of a krypton (Kr) atom in the ground state are located in the


A. first energy level (shell).

B. second energy level (shell).

C. third energy level (shell).

D. fourth energy level (shell).

Answers

Answer:

D

Explanation:

The valence electrons are the outer electrons and must be located in the outermost shell. In this case, D.

the mechanism of phosphorus fixation in the alkaline soil and acid soils​

Answers

Answer:

absorption or precipitation or by both

Explanation:

Which population will increase?

Answers

Answer:    World 5,306,425,000 6,895,889,000 7,503,828,180

1 China 1,139,060,000 1,341,335,000 1,384,688,986

2 India 873,785,000 1,224,614,000 1,296,834,042

3 United States 253,339,000 310,384,000 329,256,465

Explanation:

Which element(s) would you expect to behave similarly to Gadolinium? What properties of would you expect to be the same, what would be different?

Answers

The elements in the lanthanide series are similar to gadolinium.

The periodic table is arranged in groups and periods. Elements in the same group have similar properties. At the bottom row of the periodic table lies a group of elements that have unique properties called the lanthanides. This is where Gadolinium belongs.

The elements in the lanthanide series such as europium and terbium are similar to gadolinium. The lanthanides are similar in chemical reactivity and appearance. However, the density of the metals differ because it increases with increase in atomic number.

Learn more: https://brainly.com/question/1415109

Calculate the oxidation number for carbon in CH4

Answers

Answer:

+4

Explanation:

Oxidation number of neutral compound is 0

Oxidation number of hydrogen in methane is -1

C + (-1×4) = 0

C - 4 = 0

C = 4

Brainliest for best answer

Answers

b is answer

Explanation:

please follow me

Answer:

B is the answer

Explanation:

A is incorrect as there is 2 O2 on the RHS while there is only 1 O2 on one side

B is correct as it is going through a process called combustion and I don't feel like explaining it is too long T^T

C is incorrect as the 3 results in multiply N (3 Nitrogen) while there is only one N2

D is definitely incorrect -.-

Hope this helps

(P.S. I lost a lot of my brain cells x-x)

Identify the unit that is used for atomic masses

Answers

Answer:

Explanation: Atomic weight is measured in atomic mass units (amu), also called daltons.

Pls help!

Describe ionic and covalent bonding.

Give an example of each

Answers

Answer:

Example of ionic bonds— Sodium chloride and calcium oxide. Example of covalent bond— Water, carbon

Explanation:

ionic bond, also called electrovalent bond, type of linkage formed from the electrostatic attraction between oppositely charged ions in a chemical compound. Such a bond forms when the valence (outermost) electrons of one atom are transferred permanently to another atom.

A covalent bond consists of the mutual sharing of one or more pairs of electrons between two atoms. These electrons are simultaneously attracted by the two atomic nuclei. A covalent bond forms when the difference between the electronegativities of two atoms is too small for an electron transfer to occur to form ions.

A chemical engineer must be able to predict the changes in chemical concentration in a reaction. dC/dt = -kCn where C is chemical concentration and k is rate constant. Order of reaction is the value of n. The first order reaction that combines tert-butyl bromide and water to produce tert-butyl alcohol and hydrogen bromide is shown below; (CH3)3CBr + H2O  (CH3)3COH +HBr From the experimental data, k was estimated to be k = 0.0537 (h -1 ). Determine concentration after 1 hour, if C(0) = 0.2 mol/L

Answers

Answer:

Explanation:

Consider the general chemical reaction

                                                       [tex]\mathrm{A} \ \overset{k}{\longrightarrow} \ \mathrm{product}[/tex]  .

If [A] is the concentration of A (reactant) at any time t and n is the reaction order for the whole equation, the rate is then related to the concentration of reactant A with the following differential form of equation

                                               [tex]Rate \ = \ -\displaystyle\frac{d[\mathrm{A}]}{dt} \ = \ k[\mathrm{A}]^{n}[/tex]  .

where k is the rate constant.

*Note that the differential term [tex]\displaystyle\frac{d[\mathrm{A}]}{dt}[/tex] has a negative sign to denote that the concentration of A is decreasing over time t.

Since the chemical reaction between tert-butyl bromide and water is given to be a first-order reaction, hence n = 1, and the resulting differential equation becomes

                                        [tex]Rate \ = \ -\displaystyle\frac{d[\mathrm{A}]}{dt} \ = \ k[\mathrm{A}]^{1} \ = \ k[\mathrm{A}][/tex]

To solve this first-order linear homogenous differential equation, the method of separation of variables can be used.

[tex]\-\hspace{1cm} \displaystyle\frac{d[\mathrm{A}]}{dt} \ = -\ k[\mathrm{A}] \\ \\ \-\hspace{0.5cm} \displaystyle\frac{1}{[\mathrm{A}]} \, d[\mathrm{A}] \ = -\ k \, dt \\ \\ \int\ {\displaystyle\frac{1}{[\mathrm{A}]} \, d[\mathrm{A}] \ = \ -\int {k} \, {dt}[/tex]

         [tex]\ln{[\mathrm{A}]} \ = \ -kt \ + \ C \\ \\ \-\hspace{0.45cm} $[A]$ \ = \ e^{-kt \ + \ C} \\ \\ \-\hspace{0.45cm} $[A]$ \ = \ e^{-kt}e^{C} \ \ \ \ \ \ \ \ \ (e^{a \ + \ b} \ = \ e^{a}e^{b} \ \ \ \mathrm{by \ the \ law \ of \ indices})[/tex]

Since the term [tex]e^{C}[/tex] is a constant, let [tex]\alpha \ = \ e^{C}[/tex], hence [tex][\mathrm{A}] \ = \ \alpha e^{-kt}[/tex] or [tex]C \ = \ \alpha e^{-kt}[/tex] according to the question. Given that the initial concentration (t = 0) of tert-butyl bromide is 0.2 mol/L and k = 0.0537[tex]\mathrm{h^{-1}}[/tex], so

[tex]0.2 \ = \ \alpha e^{-0.0537 \ \times \ 0} \\ \\ 0.2 \ = \ \alpha \ \ \ \ \ (e^{0} \ = \ 1)[/tex]

Therefore, the rate equation is [tex]C \ = \ 0.2e^{-0.0537t}[/tex].

The concentration of tert-butyl alcohol after 1 hour is

[tex]C \ = \ 0.2e^{-0.0537 \ \times \ 1} \\ \\ C \ = \ 0.2e^{-0.0537} \\ \\ C \ = \ 0.190 \ \mathrm{mol/L} \ \ \ (3 \ \ \mathrm{s.f.})[/tex]

Please help me in this question about series circuit and pararell circuit

Answers

Explanation:

it is a parallel circuit.

hope this helps you.

true or false a change in state of matter would be considered a physical change​

Answers

Answer:

true

Explanation:

Because the changes in state of matter would be considered

Heart, 5 stars, and Brainiest to first right answer!

Which of these is a likely impact of stronger than normal trade winds in the Pacific Northwest of the United States?
A. Jet stream would be displaced northwards causing drought
B. Jet stream would be displaced southwards causing drought
C. Jet stream would be displaced southwards causing heavy rain and flooding
D. Jet stream would be displaced northwards causing heavy rain and flooding

Answers

I think correct answer is C.Jet stream would be displaced southwards causing heavy rain and flooding

The statement that is a likely impact of stronger than normal trade winds in the Pacific Northwest to the United States is Jet stream would be displaced southwards causing heavy rain and flooding.

According to Dalton's atomic theory, atoms
a: of different elements combine in simple whole-number ratios to form compounds
b: can be divided into protons, neutrons, and electrons
c: of all elements are identical in size and mass
d: can be destroyed in chemical reactions

Answers

According to Dalton's atomic theory, atoms of different elements combine in simple whole-number ratios to form compounds.

DALTON'S ATOMIC THEORY:

As the name implies, Dalton's atomic theory is a theory proposed by an English scientist named John Dalton in the 1900's.

The Dalton's atomic theory is composed of five main parts, which are as follows:

All matter is comprised of tiny, definite particles called atoms.Atoms are indivisible and cannot be destroyed.All atoms of a particular element are identical in size and weight.Atoms of different elements contain different mass.Atoms of different elements combine in fixed whole-number ratios when forming compounds.

Therefore, in accordance to Dalton's atomic theory, atoms of different elements combine in simple whole-number ratios to form compounds.

Learn more about Dalton's atomic theory at: https://brainly.com/question/13157325?referrer=searchResults

You have a block of an unknown metal. Which properties would be most helpful in determining what it is? If it could be

Answers

the distributive property would work best

What is the correct form of the equilibrium constant for the reaction of hydrogen and oxygen to form water? The equation is:

2H 2( g) + O 2( g) ⇌ H 2O( g)


Kc = ([H2O]/[O2] [H2])

Kc = ([H2O]/[O2] [H2]2)

Kc = ([H2O]/[O2] [H22])

Kc = ([H2O]2/[O2] [H22])

Kc = ([H2O]/[O2] [2H2])

Answers

Kc = ([H2O]/[O2] [H2]2

Heart, 5 stars, and Brainiest to first right answer!

Which climate condition is typically found in the tropics due to the interaction of the atmosphere and hydrosphere?
A.Dry with low humidity
B.Dry with high humidity
C.Wet with high humidity
D.Stormy with low humidity

Answers

Answer:

A- Dry with low humidity

Explanation:

The hydrosphere includes the water which is on the surface of the earth, below the ground and in the air.  

On analyzing the climatic conditions in the tropics due to the interaction of the atmosphere and hydrosphere, the presence of water droplets in tropics is less resulting in less humidity and, thus the climatic condition is dry.

Therefore the climatic condition that is typically found in tropics due to interaction of the atmosphere and hydrosphere is dry with low humidity.

Hope this helps!

PLEASE HELP GIVING brainless

Answers

Answer:

An unbalanced force causes the object to change position.

Explanation:

An unbalanced force causes the object on which it is acting to accelerate, changing its position, speed, or direction due to equal forces on opposite sides.

Heart, 5 stars, and Brainiest to first right answer!

Nicole pushes her bike up a hill. Overhead, the sun exerts a gravitational force on Earth. Which statement is true about the bike and Earth?
A. They both experience contact forces.
B. They both experience non-contact forces.
C. The bike experiences a non-contact force and Earth experiences a contact force.
D. The bike experiences a contact force and Earth experiences a non-contact force.

Answers

Answer:

D. The bike experiences a contact force and Earth experiences a non-contact force.

Answer:D. The bike experiences a contact force and Earth experiences a non-contact force.

Explanation:

why is because tthe force wil make the bikw wobbly and boom no contact force

Y’all what’s this I don’t feel like doing it and I’ll give brainlist too

Answers

Closed system is when no atoms or particles go in or out
And open is when there is an exchange of materials outside and inside

how much sucrose can dissolve in 200g of water at 70 °C?​

Answers

Answer: The solubility of sucrose in water at 70o C is 320 g per 100 g of water.

The maximum amount of a substance that can be dissolved in a solvent at a given temperature is referred to as its solubility.

Sucrose has a solubility of 320 g/100 g H2O at 70°C.

How is solubility usually measured?The equilibration of a suspension followed by an assessment of the solution composition, from which the solution concentration can be determined, is a widely accepted and accurate method for measuring solubility.The maximum amount of a substance that can be dissolved in a solvent at a given temperature is referred to as its solubility. This type of solution is known as saturated. To calculate the solubility in g/100g, divide the mass of the compound by the mass of the solvent and multiply by 100 g.The ability of a compound to dissolve in a liquid that functions as a solvent aids in the determination of the solubility test. The tests are critical because they determine the polarity of unknown compounds.

Sucrose has a solubility of 320 g/100 g H2O at 70°C.

To learn more about :  solubility.

Ref : https://brainly.com/question/23946616

#SPJ2

For a reversible reaction, what would a large equilibrium constant indicate? Question 9 options: A) At equilibrium, the concentration of the reactants will be much higher than the concentration of the products. B) At equilibrium, the concentration of the products will be about the same as the concentration of the reactants. C) At equilibrium, the concentration of the products will be much higher than the concentration of the reactants. D) At equilibrium, there will be no reactants left because they will all have been turned into products.

Answers

Hey what do you want me to pick out today or tomorrow if not I’ll just get my car I need you a

Pls answer this question

Answers

Answer:

A carbon dioxide and oxygen

Consider the chemical formula for calcium chlorate: Ca(ClO3)2

How many of each of these atoms is in a molecule of calcium chlorate?

Answers

I hope it help u =)

Brainliest answer pls

The temperature went from 25 to 90 degrees Celsius. What is the CHANGE in temperature?

Answers

Answer:

+65 degress ?

Explanation:

I feel like there is more to this question

Pls help plz answer this question

Answers

Answer:

A) Carbon dioxide and Oxygen

Explanation:

Percentage of gases in the Planet's atmosphere:

Carbon dioxide = 4 % Nitrogen = 72 % Oxygen = 24 %

Percentage of gases in the Earth's atmosphere:

Carbon dioxide = 0.036 % (traces)Nitrogen = 78 % Oxygen = 21 %

___________________

On observing the percentage composition of the atmospheres of the two Planets, we get:

The newly discovered planet has more percentage of Oxygen than The Earth. Percentage of Carbon dioxide is more in the planet than in the EarthNitrogen is less in the planet than in the Earth.

___________________

Answer:

What's asked is the name of the gases that are in higher amounts in the atmosphere of the newly discover planet

Therefore,

A) Carbon dioxide and Oxygen

If there is direct variation and y=75 when x=25, find x when y=48.


A. x=16

B. x=10

C. x=12

D. x=14

Answers

x = ky where k is a constant

first u find k so :
25 = k * 75
25/75 = k
k = 1/3

now when y = 48 just substitute the values
x = ky
x = 1/3 * 48
x = 16

the answer is A) x=16

If there is direct variation and y=75 when x=25,when y=48 X = 16. Therefore, option A is correct.

What is direct variation ?

link between two variables that can be described mathematically by an equation where one variable equals a constant multiplied by the other. For instance, the constant of variation is k = = 3 if y varies straight as x and y = 6 when x = 2. Consequently, y = 3x is the equation that describes this direct variation.

When x is not equal to zero, an equation of the form y = kx describes the linear function known as direct variation. When x is not equal to zero and k is a nonzero real number constant, the equation of the form xy = k describes the nonlinear function known as inverse variation.

x = ky

where k is constant

25 = k × 75

25 / 75 = k

k = 1 / 3

now when y = 48 then substitute the values

x = ky

x = 1 ÷ 3 × 48

x = 16

Thus, option A is correct.

To learn more about direct variation, follow the link;

https://brainly.com/question/13977805

#SPJ5

Explain why aluminum does not react with potassium nitrate (KNO3) although it reacts with copper nitrate

Answers

Answer:

Potassium is more reactive than aluminium, so no reaction takes place. But aluminium is more reactive than copper, so it replaces the copper in copper nitrate

Explanation:

More reactive metal compound + less reactive metal

-> no reaction

However

Less reactive metal compound + more reactive metal

-> more reactive metal compound + less reactive metal

This is called substitution reaction where the more reactive metal replaces the less reactive metal in the compound.

Will the following replacement reaction occur? MgCl2 + I2 → ?
Yes, it will because chlorine is less reactive than iodine.
No, it will not because iodine is less reactive than chlorine.
No, it will not because iodine and chlorine will not bond.
Yes, it will because the iodine will replace the magnesium.

Answers

The replacement reaction will not occur because iodine is less reactive than chlorine.

REPLACEMENT REACTION:

A replacement reaction is a type of reaction in which one element is replaced by another in a compound.

The principle behind one element replacing the other is based on the reactivity of an element. A more reactive element will displace a less reactive one.

According to this question, the following displacement reaction is given: MgCl2 + I2 → ?

This reaction will not occur because chlorine is more reactive/electronegative than iodine, hence, iodine cannot displace it.

Learn more about replacement reaction: https://brainly.com/question/8625202?referrer=searchResults

Other Questions
PLSSSS HELPPPP ASAPPPP. REWARDING BRAINLIEST. PLS SHOW WORK3. What are the exact measures of the other two sides of the triangle? Use special right triangles ratios and show your work. Which feudal leader was responsible for laying the foundation for the European civilization following the fall of the Roman Empire? A:Charalemange B: Wiliam the conqueror Tropical dried fruit costs $1.50 per pound and regular dried fruit costs $0.90 per pound. You want to create a mixed bag of tropical dried fruit and regular dried fruit that is worth $1.30 per pound. How many pounds of tropical dried fruit do you need if you have already purchased 50 pounds of regular dried fruit? EASY 9TH GRADE MATHWrite an equation in point-slope form that passes through the point (1,-10) andis perpendicular to y = -1/3 x + 5.Do NOT type spaces between numbers and symbols.TilALE11SE What does this chart reveal about education in South Africa? How do you think this will affect the economy? If (6^2]^p = 6^10, what is the value of p? A.) 2 B.) 3C.) 4D.) 5 has anyone done this and if u have please help me !! :(( How many moles does 205 g of helium,He, contain ? which best explains the impact of european colonization on the inca and aztec civilizations? When is it best to solve a system of equations using substitution? As part of the Monroe Doctrine, the United States demanded that Europeanpowers:O A. stop participating in the trading of enslaved people.B. establish democratic forms of government.C. give up all of their Caribbean colonies.O D. stop interfering with affairs in the Americas. A change in momentum is also called:a. Impactb. Imputc. Impulsed. Impole Calculate the energy for vacancy formation in nickel. what are the parts system unit LAST ATTEMPT IM MARKING AS BRAINLIEST!! (Draw a dilation of the figure using the given scale factor ) 2. List the like terms in each of the followingi) 4x2 , -5x , 6 , 7x , -2x2 , -3 how long do we have until climate change is irreversible 3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts): Type of mutation ( 3pts): 4. Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTAATTATTACGTGCTGCTATCGCT 5' Type of mutation ( 3pts) : Amino acid ( 3pts): Type of mutation ( 3pts): you---- write to your mother every week since she missed you too mucha.better b.better had c.should d.ought A tram moved downward 9 meters per second for 54 seconds. What was the total change in the tram's elevation?