The absorption of a photon causes a hydrogen atom
to change from the n = 2 to the n = 3 energy state.
What is the energy of the absorbed photon?
A) 4.9 eV
C) 1.9 eV
B) 3.4 eV
D) 10.2 eV

Answers

Answer 1

4.9 eV is the correct answer

Hope it helps you ^ _ ^


Related Questions

Kiedy błyska blisko slyszymy krótki grzmot, kiedy daleko długi. Dlaczego ?

Answers

Answer:

it is becuase light travel faster then sound thus light come to us first

Explanation:

to dlatego, że światło podróżuje szybciej niż dźwięk, to światło dociera do nas jako pierwsze

The reading on your speedometer is the

A) average velocity
B) none of these is correct
C) speed
D) instantaneous velocity

Answers

The answer is speed!!
If you need why it is speed comment, if helped mark me the brainiest!!
The answer is c) speed

A man who weighs 75kg on the surface of the earth whose mass is 6*10^24kg. If the radius of earth is 6480km ,calculate the force of attraction between them.

Answers

Answer:

but I don't know what the answesorryr

Answer:

the force of attraction between them???

hich of these best describes Earth’s mantle?

Most dense layer, consists of the outer and inner parts
Thinnest under the oceans and thickest under continents
Middle layer, density increases with depth as pressure increas

Answers

Answer:

Middle layer, density increases with depth as pressure increases

Explanation:

The Earth's mantle is the middle layer of the earth. It is the largest layer of the earth consisting of about 83 % of the earth's volume and continues to a depth of 2900 km. Also, the mantle is hot and made of solid rock. It is hot since it is close to the core and its pressure and density increases with depth causing it to be more solid.

So, the Earth's mantle is the middle layer, density increases with depth as pressure increases.

a ball of mass 0.2 kg is dropped from a height of 20m on impact to the ground it loses in 30 joule of energy calculate the height it reaches on rebound​

Answers

Answer:

new PE at top=original PE - energy lost

mgh=.2(9.8)20-30

Explanation:

mgh=.2(9.8)20-30 = 9.2

What would be the weight (in Newtons) of a person with a mass of 80 kg on Earth, where the acceleration due to gravity is approximately 9.8 m/s/s? *
please help asap

Answers

Answer:

ml tayo 1v1 durugin kita

Explanation:

ano takot ml 1v1

A piece of iron has a mass of 30 g and its volume is 6.2 cm3. What is its density?

Answers

Answer:

Density = 4.84 g/cm³

Explanation:

Given the following data;

Mass = 30 g

Volume = 6.2 cm³

To find the density of the piece of iron;

Density can be defined as mass all over the volume of an object.

Simply stated, density is mass per unit volume of an object.

Mathematically, density is given by the equation;

[tex]Density = \frac{mass}{volume}[/tex]

Substituting into the equation, we have;

[tex]Density = \frac{30}{6.2}[/tex]

Density = 4.84 g/cm³

what the balance electrons for calcium​

Answers

Answer:

its two valence electrons

Explanation:

Calcium is a group 2 element with two valence electrons. Therefore, it is very reactive and gives up electrons in chemical reactions.

UR WELCOME!! :)

Explain why magnetic damping might not be effective on an object made of several thin conducting layers separated by insulation.

Answers

Answer:

The eddy currents will be very small.

Explanation:

An object made of several thin conducting layers separated by insulation may not be affected by magnetic damping because the eddy current produced in each layer due to induction will be very small and the opposing magnetic flux produced by the eddy currents will be very small.

HELP PLEASE ?? can u answer this multiple choice for me please?

Answers

Answer:

.04 kg m/s

Explanation:

Momentum is simply mass multiplied by velocity given by p = mv. You can consider momentum as mass in motion.

Before the collision, the data given for the toy train:

v = 0.5m/s

m = 75g

We need to convert grams into the SI unit of mass, kg.

75g / 1000g * 1kg = 0.075kg

Using p = mv, we can determine:

p = 0.075kg * 0.5m/s = 0.0375 kg m/s

Rounding to the value of 1 sig-fig, it comes out to be 0.04 kg m/s.

2. Two charges at fixed locations produce an electric field as shown
below. If point charge. Y. is negative, which direction will it travel?

Answers

Answer:

sum of the two forces as both point to the right is a force that points to the right,

Explanation:

The force on the cast load at point Y is given by

        F = q_y  E

force is a vector magnitude so its result is

        ∑ F = Fₐ + F_b

indicate that the charge at y is negative, we analyze the direction of the force created by each charge

Charge A

as the electric field is incoming the charge is negative and as the test charge is negative both repel each other, consequently the force points to the right

Charge B

in this case the electric field lines are salient, therefore the charge is positive, consequently the force on the charge at y is attractive and points to the right

the sum of the two forces as both point to the right is a force that points to the right, that is, in the direction of the charge located at B

A 15.0 kilogram cart initially traveling at 2.0 meters per second east accelerates uniformly at 0.75 meter per second squared east for 6.0
seconds. What is the speed of the cart at the end of this 6,0 second interval? Please include all work - including givens, formula, substitution,
and units for full credit. (2)

Answers

Answer:

Explanation:

Since this is not parabolic motion, it is one-dimensional motion. Very simple. What we are given is

mass: 15.0 kg

initial velocity: 2.0 m/s

acceleration: .75 m/s/s

time: 6.0 seconds

Since we are looking for final velocity, the equation we need for this is

v = v0 + at that says final velocity is equal to the initial velocity plus the acceleration of the object times how long it travels. We don't have a need for the mass here at all.

[tex]v=2.0\frac{m}{s}+.75\frac{m}{s^2}(6.0s)[/tex]

Notice that one of the seconds labels to the right of the plus sign cancel out, leaving us with like units...which we HAVE to have if we want to add.

Simplifying a bit gives us

v = 2.0 m/s + 4.5 m/s so

v = 6.5 m/s

Water is being heated on the stove at 90 ⁰C. What is this temperature on the Fahrenheit degrees?

Answers

Answer:

194 degrees farenheit! hot

Explanation:

(90°C × 9/5) + 32 = 194°F

Answer:

194

Explanation:

to get from celcius to Fahrenheit

multiply temperature by 2 and add 30

50N force accelerated a body at a rateof 8 metres per second square. Calculate the mass of the body​

Answers

Answer:

m=6.25kg

Explanation:

Force= mass × acceleration

50=m×8

make m subject of the formula...

m=50/8

m=6.25kg

Answer:

[tex]\boxed {\boxed {\sf 6.25 \ kilograms}}[/tex]

Explanation:

According to Newton's Second Law of Motion, force is the product of mass and acceleration.

[tex]F= m \times a[/tex]

We know the force is 50 Newtons and the acceleration is 8 meters per second squared. Let's convert the units to make the problem and unit cancellation easier.

1 Newton is equal to 1 kilogram meter per square second (1 kg*m/s²), so the force of 50 N is equal to 50 kg*m/s².

Now we know 2 values:

F= 50 kg*m/s²a= 8 m/s²

Substitute the values into the formula.

[tex]50 \ kg *m/s^2= m \times 8 \ m/s^2[/tex]

Since we are solving for the mass, we must isolate the variable, m. It is being multiplied by 8 meters per square second and the inverse of multiplication is division. Divide both sides by 8 m/s².

[tex]\frac {50 \ kg *m/s^2}{8 \ m/s^2}= \frac{m \times 8 \ m/s^2}{8 \ m/s^2}[/tex]

[tex]\frac {50 \ kg *m/s^2}{8 \ m/s^2}= m[/tex]

The units of meters per square second (m/s²) cancel.

[tex]\frac {50 \ kg }{8 }=m[/tex]

[tex]6.25 \ kg =m[/tex]

The mass is 6.25 kilograms.

As an IT technician for your company, you have been notified that the Windows domain does not seem to be functioning properly. Being familiar with domains, you are fairly confident you know what the issue is. But just to be safe, you take the applicable time to gather additional information and to identify what, if anything, has changed.

Which of the following is the BEST next step?

A. Determine the appropriate fix.
B. Create a hypothesis.
C. Implement the fix.
D. Identify what has changed.
E. Gather information.

Answers

Answer: Create a hypothesis

Explanation:

From the information given, information has been gathered and the identification to ascertain if there's a change. Then, an hypothesis has to be created in order to know what the problem is.

One has to carry out some research in order to know what went wrong and should also validate the hypothesis by consulting with ones peers. By doing this, the most likely causes of the issues will be gotten.

In a wire, when elongation is 4 cm energy stored is E. if it is stretched by 4 cm, then what amount of elastic potential energy will be stored in it?

Answers

Answer:

4E

Explanation:

The elastic potential energy of an elastic material (e.g a spring, a wire), is the energy stored when the material is stretched or compressed. It is given by

U = [tex]\frac{1}{2}kx^2[/tex]               --------------------(i)

Where;

U = potential energy stored

k = spring constant of the material

x = elongation (extension or compression of the material).

From the first statement;

when elongation (x) is 4cm, energy stored (U) is E

Substitute these values into equation (i) as follows;

E = [tex]\frac{1}{2}k(4)^2[/tex]

E = 8k

Make k subject of the formula    

k = [tex]\frac{E}{8}[/tex]   [measured in J/cm]

From the second statement;

It is stretched by 4cm.

This means that total elongation will be 4cm + 4cm = 8cm.

The potential energy stored will be found by substituting the value of x = 8cm and k = [tex]\frac{E}{8}[/tex] into equation (i) as follows;

U = [tex]\frac{1}{2}\frac{E}{8} (8)^2[/tex]  

U = [tex]\frac{1}{2}{8E}[/tex]

U = [tex]{4E}[/tex]

Therefore, the potential energy stored will now be 4 times the original one.

What are the wavelengths of x-rays and gamma rays?
a.
x-rays - 3 pm to 20 nm
gamma rays- less than 3 pm
c.
x-rays - 3 mm
gamma rays- 20 to 50nm
b.
x-rays - 400nm
gamma rays- 700nm
d.
None of the above

Answers

Answer:

1. less. 2 greater. 3. the same. 8. An FM radio station broadcasts its signal at a fre​- ... wave 3. | 3x108 = 269.15x107). = 3.20m. 2. An electromagnetic AM-band radio wave could have Base your answers to questions 9 and 10 on the informa- ... X rays. -Microwaves. -Long

What is the three-body problem? Explain at a level so an 8th grader could understand

Answers

Answer:

In physics and classical mechanics, the three-body problem is the problem of taking the initial positions and velocities (or momenta) of three point masses and solving for their subsequent motion according to Newton's laws of motion and Newton's law of universal gravitation.[1] The three-body problem is a special case of the n-body problem. Unlike two-body problems, no general closed-form solution exists,[1] as the resulting dynamical system is chaotic for most initial conditions, and numerical methods are generally required.

Hope this answer is right!

A rocket of mass M when empty carries a mass M of fuel. The rocket and fuel travel at speed v.
The engine of the rocket is fired and all of the fuel is expelled. The speed of the rocket increases
to 2v.

What happens to the kinetic energy of the rocket?
A It doubles.
B It halves.
C It increases by a factor of four.
D It stays the same.

Answers

The kinetic energy of the rocket should be A. it doubles.

What is kinetic energy?

Kinetic energy represents the energy where an object or a particle should be the reason for its motion. It transfers energy than it should be done on an object by applying a net force, so the object speeds up and thereby gains kinetic energy. In the case when the speed increased to 2v so the kinetic energy should also doubles.

Learn more about speed here: https://brainly.com/question/17052831

A fixed mass of gas has a volume of 25 cm³. The pressure of the gas is 100 kPa.
The volume of the gas is slowly decreased by 15 cm³ at constant temperature.
What is the change in pressure of the gas?
A)67 kPa
B)150 kPa
C)170 kPa
D)250 kPa​

Answers

Answer:

67 kPa

Explanation:

Given that,

Initial volume, V₁ = 25 cm³

Initial pressure, P₁ = 100 kPa

Final volume, V₂ = 15 cm³

We need to find the change in pressure of the gas. The relation between the volume and pressure of a gas is given by :

[tex]P\propto \dfrac{1}{V}\\\\\dfrac{P_1}{P_2}=\dfrac{V_2}{V_1}\\\\P_2=\dfrac{P_1V_1}{V_2}\\\\P_2=\dfrac{100\times 25}{15}\\\\=166.66\ kPa[/tex]

or

= 167 kPa

The change in pressure,

= P₂ - P₁

= 167 kPa - 100 kPa

= 67 kPa

Hence, the correct option is (a).

What state of matter did the earth need to be in order for planetary differentiation to occur?
Answer: Gas, liquid, or solid?

Answers

Gas. I know this because first you will need to do the equator so I will say gas

which of the following is incorrect for nuclear forces
a) they are attractive in nature
b) they are short range forces
c) they obey inverse square law
d) they are non conservative in nature

Answers

Answer:

c they obey inverse square law

Answer is C .

The reason is as follows:
Nuclear forces don’t obey inverse square law.

Neither the strong nuclear force nor the weak nuclear force follow the inverse square law.

The weak nuclear force is a Yukawa-type force. Such a force is characterized by a potential in the form ∝−/

e

m
r
/
r
. At short range ( ≪1
m
r

1
) the exponential term is just 1
1
, so the potential becomes an inverse-
r
potential with an inverse square force law associated with it. So at very short (subatomic) ranges, the weak nuclear force is actually very similar to the electromagnetic force. But as soon as >1
m
r
>
1
, the force rapidly vanishes and becomes undetectable.

The strong nuclear force does not decrease with distance. Which means that as you “stretch” the bond between two quarks, for instance, more and more energy needs to be invested; until there is enough energy to create a new quark-antiquark pair, at which point the bond breaks. This limits the range of the strong nuclear force to subatomic scales, too.

Q= Which one of the following statement is incorrect?
A. When a switch is closed in a circuit, no current flows.
B. A switch is a device for turning on and off an electric current.
C. An electric current is a complete loop around which a current can flow.
D. An electric current is a flow of charge

Answers

Answer:

A.

Explanation:

I think it might be the big number A

An athlete running the velocity 3m/s due east is confronted with two trade winds. One wind travelling at 10m/s in a direction north 65degrees east and another wind travelling at 8m/s in a direction south 70degrees east. Find the resultant velocity and direction of the athlete

Answers

Answer:

v = 10.09 m / s,   8.78 North of East

Explanation:

The easiest way to solve this exercise is to decompose the velocities into a coordinate system, where the x-axis coincides with the West-East direction and the y-axis coincides with the South-North direction.

athlete's velocity v₁ₓ = 3 m / s

wind speed 2 v₂ = 10 m / s with direction 65 north of east

          sin 65 = v_{2y} / v₂

          cos 65 = v₂ₓ / v₂

          v_{2y} = v₂ sin 65

          v₂ₓ = v₂ cos 65

          v_{2y} = 10 sin 65 = 9.06 m / s

          v₂ₓ = 10 cos 65 = 4.23 m / s

wind speed 3 v₃ = 8 m / s with direction 70 south of east

This angle measured from the positive side of the x-axis is

          θ = 360 - 70

          θ = 290

          sin 290 = v_{3y} / v₃

          cos 290 = v₃ₓ / v₃

          v_{3y} = v₃ sin 290

          v₃ₓ = v₃ cos 290

           v_{3y} = 8 sin 290 = -7.52 m / s

          v₃ₓ = 8 cos 290 = 2.74 m / s

now we can find each component of the velocity

         

X axis

        vₓ = v₁ + v₂ₓ + v₃ₓ

        vₓ = 3 + 4.23 + 2.74

        vₓ = 9.97 m / s

Y axis  

        v_y = v_{2y} + v_{3y}

        v_y = 9.06 - 7.52

         v_y = 1.54 m / s

to find the modulus let's use the Pythagorean theorem

         v = [tex]\sqrt{v_x^2 + v_y^2 }[/tex]

         v = [tex]\sqrt{9.97^2 + 1.54^2}[/tex]

         v = 10.09 m / s

let's use trigonometry for the direction

         tan θ = v_y / vₓ

        θ = tan⁻¹ v_y / vₓ

        θ = tan-1 1.54 / 9/97

         θ = 8.78

           

the address is 8.78 North of East

NEED ANSWER QUICK, WILL GIVE BRAINLIEST! How many nails do sapiens have?
A. 6
B. 10
C. 3
D. None

Answers

Answer:

nice calculations!

Explanation:

None of the above. Or is it regarding toe alone with finger nails?

2
Select the correct answer.
Which statement is true about acceleration?
OA.
It is the rate of change of speed per unit time.
OB.
It is the rate of change of displacement per unit time.
Ос.
It is the rate of change of velocity per unit time.
OD.
It is the rate of change of position per unit time.
Reset
Next

Answers

Answer:

the answer is C ----- it is the rate of change of velocity per unit time

Explanation:

acceleration

[tex] = \frac{velocity(v)}{time(t)} [/tex]

what happens when a light ray is incident normally to the interface of two media?

Answers

Explanation:

ahhh, maybe you mean , what happens when a light ray hits the interface of two media perpendicular to the normal.

if that is the case then the light ray will not bend but it will travel in the same direction in the second medium as it was travelling in it's first medium

hope this helps bro

The specific heat capacity of sea water is 4100 J/Kg°C and the boiling point of 100.6 °C. (i) Calculate the energy required to raise the temperature of 0.900 kg of this sea water from 10 °C up to its boiling point. Also mention the equation to be used. *

Answers

Answer:

334.314 (kJ)

Explanation:

1) the formula for the required energy is: Q=c*m(Bp-t), where c - 4100 J/kg*C; m - 0.9 kg; Bp - 100.6 C; t - 10 C.

2) according to the formula above:

Q=4100*0.9*(100.6-10)=41*9*906=334314 (J).

A spring with a spring constant of 200 is compressed 0.5 . What is the potential energy stored in the spring

Answers

Answer:

E = 25 J

Explanation:

Given that,

Spring constant, k = 200

Compression, x = 0.5

We need to find the potential energy stored in the spring. The formula for the stored potential energy in the spring is given by :

[tex]E=\dfrac{1}{2}kx^2[/tex]

Put all the values,

[tex]E=\dfrac{1}{2}\times 200\times 0.5^2\\\\E=25\ J[/tex]

So, 25 J of potential enersy is stored in the spring.

Based on the law of conservation of energy, how can we reasonably improve a machine’s ability to do work?

Answers

Answer:

We can reasonably improve a machines ability to do work by reducing the friction between the moving parts of machine.

Explanation:

According to the law of conservation of energy, the energy can neither be created nor destroyed.

Other Questions
Whoever answers these 2 right gets brainliest and 25 points! please help me :(Any Maths Moderator:( please help me; I am in great trouble I need help with another too! :( I will mark brainliest! You will get 30 piontsthe picture is right there too! The question is also in the picture too!I hope you could see it clrealy! Find the value of x. 0.45 written as a common fraction, in its simplest form, is Step by step pls thanks 1. Mention naste to any four importance of animals plants Write 5/14 with denominator 28 Solve for xxx. Enter the solutions from least to greatest. (x + 5)^2 - 64 = 0 Brainliest goes to whoever answers correctly also if you want more points then answer my others Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5. What does this mean anyone? Some guy sent it to me and Im having trouble translating it Give an example of a composite number written as a product of primes.Choose the correct answer below.A. 60 = 2 x 2 x 15 or 60 = 22 x 15B. 41 = 1x41C. 28 = 2x2x7 or 28 = 22x7 compare and contrast the Nationalist Party with the Chinese Communist Party. Can you guys help me find the answer PLZ HELP ASAP!!!!!!!!!!!!!! A store has two different coupons that customers can use. One coupon gives the customer $15 off their purchase, and the other coupon gives the customer 30% off of their purchase. Suppose they let a customer use both coupons and choose which coupon gets applied first. For this context, ignore sales tax.Let f be the function that inputs a cost (in dollars) and outputs the cost after applying the "$15 off" coupon, and let g be the function that inputs a cost (in dollars) and outputs the cost after applying the "35% off" coupon. a. Suppose acustomerwants to purchase asi 40 item and apply the si 5 of coupon first, and then the 35% or coupon How much will the item cost after applying the coupons?b. Suppose a customer wants to purchase a S 140 item and apply the SI 5 off coupon first, and then the 35% or coupon Ure ction notation to represent how much the item will cost (dollars) after applying the coupons. c. Suppose a customer wants to purchase a $140 item and apply the 35% om coupon first and then the sis of coupon How much will the item cost after applying the coupons?d. Suppose a customer wants to purchase a S 140 item and apply the "35% or coupon first and then the "S 15 off coupon. Usefu ction notation to represent how much the item will cost (dollars) after applying the coupons. Population, 1860-1920Year Percent Rural Percent Urban186080.219.8187074.325.7188071.828.2189064.935.1190060.439.6191054.445.6192048.851.2Which of the following statements is TRUE about the information displayed in thetable above?Between 1860 and 1880, rural population increased.Between 1860 and 1920, people began moving to cities.Between 1910 and 1920, rural and urban populations were even.D Between 1860 and 1920, urban and rural populations remained stable. A corporation declares a cash dividend on Friday, December 5th, payable to holders of record on Friday, December 19th. The local newspaper publishes the announcement on Monday, December 8th, while Standard and Poor's reports the dividend on Friday, December 12th. The ex date for regular way trades will be set at: A Friday, December 5th B Wednesday, December 17th C Thursday, December 18th D Friday, December 19th