The table shows the total number of posts made by the average registered user of a new social media app in the first week
after purchasing the app.
find the linear equation that models the data in this table.

Linear equations are used to represent relations that have constant rates

The linear regression equation that models the data in this table is [tex]\^y = 2.40476x + 0.33333[/tex]

To calculate the regression equation, we make use of a graphing calculator.

Using the graphing calculator, we have the following data:

The regression equation is represented as:

[tex]\^y = b\^x + a[/tex]

Where:

[tex]b = \frac{SP}{SSX}[/tex] and [tex]a = MY - bMX[/tex]

So, we have:

[tex]b = \frac{101}{42}[/tex]

[tex]b = 2.40476[/tex]

Also, we have:

[tex]a = MY - bMX[/tex]

[tex]a= 8.75 - 2.4\times 3.5[/tex]

[tex]a= 0.33333[/tex]

Hence, the linear regression equation is:

[tex]\^y = 2.40476x + 0.33333[/tex]

Read more about regression equations at:

https://brainly.com/question/25987747

1. Why is cell an open dynamic system?​

Examine the food web below. Suppose the local government sprayed a pesticide to kill mosquitoes. The sparrows ate the poisoned mosquitoes and died as well. What would most likely happen to the organisms in this food chain after the sparrows began to disappear?
A.
There would be an overpopulation of caterpillars, which would threaten the oak trees.
B.
The sparrows’ disappearance would not affect the other organisms in the ecosystem.
C.
Most of the organisms in the ecosystem would starve and die.
D.
The eagle would loose its primary food source and be forced to start feeding on mountain lions.

An insulator the loss of heat energy.

slows down or speeds up

I WILL MARK YOU BRAINLYSS PLUS 40 POINTSSS

Why animals reproduce? A. To become many B. To become food C. To enjoy D. To grow​

1. Which of the following characteristics is possessed by invertebrates?
a) exoskeleton
b) endoskeleton
c) joint appendages
d) cephalization

A scientist recently discovered a pond organism that is unicellular, contain
other membrane-bound organelles, and possesses a flagellum. In which ki
organism classified?
Fung
Monera
Plant
Protista

The gene for fur color in mice has two alleles, the allele for gray fur
(G) is dominant to the allele for black fur (g). What would be the
phenotype of a mouse with genotype gg?

What kind of alleles get over-shadowed or blocked by more dominant alleles?

Question 7(Multiple Choice Worth 2 points) (06.02 MC) Read the two sentences. The boy scored the winning goal is on my team. name is Greg. Select the words that complete the sentences. o . that. His that. Their O who. His who. Their​

The Maine Department of Transportation (DOT) has a fleet of roughly 400 plow trucks that are used to control snow and ice on approximately 8300 lane miles of Maine’s state roads. They usually plan on an average of about 30 treatable events in a winter. This includes the use of rock salt, salt brine and winter sand, a mix of sand and salt. Salt brine is used on roads and bridges prior to a storm to delay ice and snow from sticking to the roadway and is also used in plowing to fight the buildup of ice and snow throughout the storm. Rock salt helps keep roads safe when winter storms hit, reducing winter road accidents, but it can also have negative effects on plant life and aquatic ecosystems. What are the environmental effects of salting that must be mitigated? Select ALL that apply.A) Salt kills roadside plants. B) Salt builds up in roadside soil , changing its pH, preventing the growth of plants. C) Salt corrodes metals like automobile brake linings, frames, and bumpers, and can cause cosmetic corrosion. D) Elk, moose and sheep eat road salt causing "salt toxicosis" where they lose their fear of vehicles and humans, causing many fatal encounters. E) Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground

in this investigation the independent (or tested) variable is a. the speed of the rat b. letting the rat 10 times c. adding the rat's favorite treat at the end d. using the same maze

8. If brown (B) noses are completely dominant to blue (b) noses, write
genotypes combinations and phenotypes you could have in any given individual.

In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction

Show you work here using the data table 1 to calculate the energy consumed by this female sea otter.

which is not a topic of biology?
a. the distribution of sand on an ocean floor
b. the chemicals at work in the stomach
c. the speed at which a hummingbird flies

more complex
mito-
Chondria
___
Contains
DNA
mitochondria
produce
ATP
Which is used by
___ To make___
Which pass the to interior of the
golgi
Then are modified by the
golgi
Then are distributed to
Parts of the cell

Describe the structure and function of areolar connective tissue.

Which of the following are unique to animals? Flagellated gametes, nervous system signal conduction in muscular movement, heterotrophic, the structural carbohydrate chitin

Which indicates a heterozygous genotype for smooth pods?

A. ss
B. SS
C. Ss​

Where does carbon dioxide come from during photosynthesis?

Which sentence correctly uses commas to separate phrases? The cooking class will teach us how to, grill fish, bake a pie, and make ice cream the mouth test will include the one word problem, one pair one graph and 10 questions. I spend my free time reading books, watching tv, and playing video games. Staying for involves eating healthy foods, staying active and, sleeping well

Question 15 of 20
What is true about ice and liquid water?
O A. Ice has a lower density than liquid water because it has more
space between molecules.
O B. Ice has a higher density than liquid water because it has more
space between molecules.
O C. Ice has a higher density than liquid water because it has less
space between molecules.
O D. Ice has a lower density than liquid water because it has less sace
between molecules.

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style​

Remove the roller bearing fastened to the shaft:
A. Dumplings in bearings.
B. Close the ring in the bearing or the ring in the bearing.
C. Close the ring in the bearing.
D. Roll out the outer ring of the bearing.

Cows, buffaloes and wildebeest are closely related enough that the same disease can harm all of them true or false

muscle cell labelled diagram ​

Is fermentation as efficient as aerobic cellular respiration? Multiple choice question, yes or no?

Which of the following characteristics are necessary for a fossil to be a good index fossil? (Choose all that apply)
had a broad geographic distribution
easy to identify at the species level
an invertebrate
short-lived

Which forest biome has year-round
precipitation in many forms, is very
diverse with deciduous trees,
flowering trees, and shrubs, and
abundant growth in spring?
A. Temperate forest
B. Coniferous forest
C. Tropical rainforest
D. Tropical dry forest