Briefly explain how DNA profiling is used to identify individuals.

Answers

Answer 1
A sample of DNA is taken from blood of saliva. PCR makes lots of copies, or amplifies the DNA. We then add restriction enzymes to cut the DNA at palindrome sequences. We then run the DNA through gel Elecrophoresis. Each person has unique short tandem repeats that cause a unique number of cuts by the restriction enzyme. These cuts are separated by size on gel electrophoresis, so no two people have the exact same pattern. We can compare individuals banding patterns to what is found at a crime scene, taken in previous samples, in a baby, and the sample that matches all the banding patterns will be the individual.

Related Questions

Which is a type of mining that is very dangerous but doesn't disrupt much of the surface? A Surface mining B. Strip mining C. Mountaintop removal D. Long wall mining​

Answers

Answer:

Surface mining.

Explanation:

Surface mining can severely erode the soil or reduce its fertility. It can also pollute waters or drain underground water reserves; scar or altar the landscape; damage roads, homes, and other structures; and destroy wildlife.

brainly stop removing my question its weird i just need help

Answers

lol…..that’s only thing I wanted to say. And I wanted the 5 points, don’t get me wrong u need to up the points. ( ignore whatever I said I just needed more words) luv you

muscle cell labelled diagram ​

Answers

Explanation:

Here is a diagram, let me know if this is what you needed.

Is fermentation as efficient as aerobic cellular respiration? Multiple choice question, yes or no?

Answers

Answer:

NO

EXPLANATION :

Aerobic cell respiration is roughly 18 times more efficient than anaerobic cell respiration. Your cells require a lot of energy and are dependent on the high efficiency of aerobic respiration. They quickly die if deprived of oxygen.

Which of the following characteristics are necessary for a fossil to be a good index fossil? (Choose all that apply)
had a broad geographic distribution
easy to identify at the species level
an invertebrate
short-lived

Answers

Answer:

A good index fossil is one with four characteristics: it is distinctive, widespread, abundant, and limited in geologic time. Because most fossil-bearing rocks formed in the ocean, the major index fossils are marine organisms.

Explanation:

Fossil to be a good index fossil are:-

Had a broad geographic distributionEasy to identify at the species levelAn invertebrateShort-lived

What is a fossil?Fossils are the preserved remains, or traces of remains, of ancient organisms. Fossils are not the remains of the organism.They are rocks. A fossil can preserve an entire organism or just part of one. Bones, shells, feathers, and leaves can all become fossils.

Hence, All the given option are correct.

To know more about fossils here

https://brainly.com/question/6867325

#SPJ2

Which is an example of a statement about climate?

OPTIONS

It rained 3 inches last night.



Snow and very low temperatures are predicted for tomorrow.



Florida is known for its sunny skies and warm temperatures.



I plan to go swimming tomorrow.

Answers

Answer: Florida is known for its sunny skies and warm temperatures.

Explanation: Climate refers to long term weather. This statement indicates that Florida has a usual weather. Usual can be otherwise known as long-term.

Why animals reproduce? A. To become many B. To become food C. To enjoy D. To grow​

Answers

Question:

Why animals reproduce?

Answer;

(A) To become many

why?

because if no animals in the world you will not enjoy of your childhood

that is my answer I hope it helps to you

1. Why is cell an open dynamic system?​

Answers

The exchange of matter or substances between the cell and its environment is dynamic as it varies in direction and rate as per the requirements of the cell. Thus,a cell attains a stead -state wherein the internal conditions of the cell remain constant. Hence, cell is considered to be a open dynamic system

The Maine Department of Transportation (DOT) has a fleet of roughly 400 plow trucks that are used to control snow and ice on approximately 8300 lane miles of Maine’s state roads. They usually plan on an average of about 30 treatable events in a winter. This includes the use of rock salt, salt brine and winter sand, a mix of sand and salt. Salt brine is used on roads and bridges prior to a storm to delay ice and snow from sticking to the roadway and is also used in plowing to fight the buildup of ice and snow throughout the storm. Rock salt helps keep roads safe when winter storms hit, reducing winter road accidents, but it can also have negative effects on plant life and aquatic ecosystems. What are the environmental effects of salting that must be mitigated? Select ALL that apply.A) Salt kills roadside plants. B) Salt builds up in roadside soil , changing its pH, preventing the growth of plants. C) Salt corrodes metals like automobile brake linings, frames, and bumpers, and can cause cosmetic corrosion. D) Elk, moose and sheep eat road salt causing "salt toxicosis" where they lose their fear of vehicles and humans, causing many fatal encounters. E) Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground

Answers

Answer:

it is 736

Explanation:

me big brain

Salt builds up in roadside soil , changing its pH, preventing the growth of plant and Salt doesn't evaporate, or otherwise get removed once applied, so it remains a persistent risk to aquatic ecosystems due to runoff or ground are the environmental effects of salting that must be mitigated. That is option B and E.

The effects of road salting on the environment

Road salting is a technique that is used to melt snow and ice during winter season. This keeps the streets and side sidewalks clear and prevents slick driving conditions.

The types of salt used for road salting include:

rock salt,

salt brine,

winter sand,

a mix of sand and salt.

The impact of road salting on the environment include the following:

Decrease in reproduction and growth of plants: This is because increase salinity are toxic to plants and as the concentration of these ions increases, the plant is poisoned and dies.

Negative effect on aquatic ecosystems: This affects mostly the freshwater ecosystems as high levels of salt are very toxic to the aquatic organisms.

Learn more about aquatic ecosystems here:

https://brainly.com/question/1023703

Which describes a dominant allele?

A. It can be masked by the presence of a recessive allele
B. Its trait will always show up if it is present
C. It is the type of allele that makes a hybrid
D. It is the form of the gene that comes from the mother​

Answers

Answer:

B.

Explanation:

A dominant allele is an allele whose trait will always show up in an organism when the allele is present

Examine the food web below. Suppose the local government sprayed a pesticide to kill mosquitoes. The sparrows ate the poisoned mosquitoes and died as well. What would most likely happen to the organisms in this food chain after the sparrows began to disappear?
A.
There would be an overpopulation of caterpillars, which would threaten the oak trees.
B.
The sparrows’ disappearance would not affect the other organisms in the ecosystem.
C.
Most of the organisms in the ecosystem would starve and die.
D.
The eagle would loose its primary food source and be forced to start feeding on mountain lions.

Answers

Answer:

A. There would be an overpopulation of caterpillars, which would threaten the oak trees

Explanation:

Because sparrows eat caterpillars as a primary food source, when the population of sparrows decrease, the population of caterpillars will increase. Because of this, more caterpillars will be feeding off of the oak trees, therefore threatening the oak trees. I hope this helps!

Pls help me with this question!! The question is asked on this image!!

Answers

Answer:

With oxygen.

Explanation:

Have a great day!

which is not a topic of biology?
a. the distribution of sand on an ocean floor
b. the chemicals at work in the stomach
c. the speed at which a hummingbird flies

Answers

a. the distribution of sand on an ocean floor
C. The speed at which a hummingbird flies

Giving Away 50 points + brainy to first



Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a/an ____

Answers

Ava has been reading about the interactions among the components of the Earth. This group of components work together to make a system.

The group of components of the Earth work together to make an environment we live in.

What are the different components of the Earth?

The interactions between Earth's five systems—the geosphere, biosphere, cryosphere, hydrosphere, and atmosphere—create the environment we are accustomed to.

The Earth's interior and surface, which are both formed of rocks, make up the first system, the geosphere. The second system is made up of the little area of the planet that may sustain life; this area is known as the biosphere. The third system contains the hydrosphere, or regions of Earth that are completely covered with water. The fourth system is the atmosphere, a gaseous envelope that maintains the planet's temperature while also supplying carbon dioxide for photosynthesis and oxygen for breathing. The cryosphere, which is composed of enormous amounts of ice in the poles and elsewhere, is the fifth system. The maintenance of the Earth as we know it depends on the interaction of all five of these vast and intricate systems.

Learn more about Earth's component, here:

https://brainly.com/question/11250595

#SPJ5

is there vaccine for cancer​

Answers

Answer:

yes

there is vaccines for cancer

Explanation:

plz mark me as brilliant please please please

Labor unions arose in the nineteenth century as increasing numbers of Americans took jobs in factories, mines, and mills in the growing industrial economy.

The Knights of Labor, founded in 1869, was the first major labor organization in the United States. The Knights organized unskilled and skilled workers, campaigned for an eight hour workday, and aspired to form a cooperative society in which laborers owned the industries in which they worked.

The Knights’ membership collapsed following the 1886 Haymarket Square riot in Chicago. By 1886 the American Federation of Labor (AFL), an alliance of skilled workers’ trade unions, was growing.

What type of mutation changes a single DNA nucleotide base, and causes a change in a specific codon?

Answers

Answer:

A base substitution mutation is the answer.

Explanation:

A base substitution mutation changes only a single nucleotide within a gene sequence, so only one codon is affected.

Question 7(Multiple Choice Worth 2 points) (06.02 MC) Read the two sentences. The boy scored the winning goal is on my team. name is Greg. Select the words that complete the sentences. o . that. His that. Their O who. His who. Their​

Answers

Answer:

The boy that scored the winning goal is on my team. His name is Greg.

Explanation:

PLEASE HELP
How are the waste products of respiration removed?
(SELECT ALL THAT APPLY)

A) Food waste moves from the digestive system to the cardiovascular system.

B) Carbon dioxide is removed by respiratory organs.

C) The cardiovascular system transports waste products from cells to other systems.

D) Oxygen molecules are removed by the cardiovascular system.

Answers

[tex]{{\tt{==========================================}}}[/tex]

Question:

How are the waste products of respiration removed?

[tex]{{\tt{==========================================}}}[/tex]

Choices:

A) Food waste moves from the digestive system to the cardiovascular system.

B) Carbon dioxide is removed by respiratory organs.

C) The cardiovascular system transports waste products from cells to other systems.

D) Oxygen molecules are removed by the cardiovascular system.

[tex]{{\tt{==========================================}}}[/tex]

Answer:B) Carbon dioxide is removed by respiratory organs.

[tex]{{\tt{==========================================}}}[/tex]

Explanation:

The primary function of the respiratory system is to deliver oxygen to the cells of the body's tissues and remove carbon dioxide.

[tex]{{\tt{==========================================}}}[/tex]

[tex]\rm\small{CARRYONLEARNING}[/tex]

Waste products of respiration are removed when carbon dioxide is removed by respiratory organs.

What is respiration?

Respiration refers to the process by which living things undergo gaseous exchange with the environment. Respiration produces some wastes such as;

water vapor and carbon dioxide in animalsOxygen in plants

Hence, waste products of respiration are removed when carbon dioxide is removed by respiratory organs.

Learn more about respiration: https://brainly.com/question/1439976


In order for mutations to be passed to offspring in sexually reproducing organisms, the
mutation(s) must occur in sex cells. Why is this NOT true for bacteria like Staphylococcus?
Choose one or more:

Answers

Answer:

Bacteria can evolve quickly because they reproduce at a fast rate. Mutations in the DNA of bacteria can produce new characteristics and that the bacterium will grow better than its neighbors and can increase in numbers..

Explanation:

N/A

Which forest biome has year-round
precipitation in many forms, is very
diverse with deciduous trees,
flowering trees, and shrubs, and
abundant growth in spring?
A. Temperate forest
B. Coniferous forest
C. Tropical rainforest
D. Tropical dry forest

Answers

Answer:

Due to their global position, temperate forests generally receive about 75-150 cm of precipitation every year.

Explanation:

(That's a lot, second only to the Tropics).

What kind of alleles get over-shadowed or blocked by more dominant alleles?

Answers

Recessive alleles are covered

Answer:

I believe these are called the recessive traits or alleles

Explanation:

Recessive traits (represented in a pinnet square usually by lower case letters like rr, bb, pp, mm, ll and so on and so forth)

These traits can be blocked by the dominant ones ( BB, Bb, PP and so on and so fourth)

look at the punnet square to get a better visual :3

AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA

Answers

Answer:

look at explanation

Explanation:

basically in order to go from mrna to trna just replace

a becomes u

g becomes c

u becomes a

c becomes g

compare a frogs internal organs to a humans internal organs

Answers

Answer:

Answer is below

Explanation:

Frogs and humans share the same basic organs. Both have lungs, kidneys, a stomach, a heart, a brain, a liver, a spleen, a small intestine and a large intestine, a pancreas, a gall bladder, a urinary bladder and a ureter. ... On the whole, their organ structure is similar, but frogs have considerably less complex anatomies

Cows, buffaloes and wildebeest are closely related enough that the same disease can harm all of them true or false

Answers

False
Should be the right answer because we can see mutations in humans can kill some and do nothing to others

In which part of the male reproductive part do pollens found? A. Anther B. Filament C. Stigma D. Style​

Answers

Answer:

Anther

Explanation:

Stamen is a male reproductive part in which anther produce male reproductive cells.

Answer:

The stamen is made up of two parts: the anther and filament. The anther produces pollen (male reproductive cells). The filament holds the anther up. During the process of fertilization, pollen lands on the stigma, a tube grows down the style and enters the ovary.

Explanation:

Which of these is not an effect of antibodies?
A. Activating complement proteins
B. Neutralizing toxins
C. Tagging pathogens for phagocytosis D.Perforating membranes of pathogens​

Answers

Answer:

C

Explanation:

Tagging pathogens for phagocytosis D.Perforating membranes of pathogens

Explain the the verse below in your own words.




Hebrews 11:7

Answers

Answer:

Faith, according to the Bible, is not blind. More than half of the verses in the book of Hebrews are dedicated to explaining reasons and evidence to accept the new covenant in Jesus Christ. Nor is faith gullible, or senseless. Instead, godly faith is exemplified by trust. That trust is based on what we know of God, relying on Him for the things we do not know. In particular, godly faith looks forward, from an eternal perspective, and produces obedience, even in the face of hardship. God takes what we cannot see, or cannot understand, and uses it to make good on His word. Since faith relies on what we've seen of God, and trusts Him for the future, it becomes the "assurance of things hoped for, the conviction of things not seen" (Hebrews 11:1–3).

Explanation:

I LOVE JESUS

CAN I HAVE A BRANLIEST PLZ

Faith, according to the Bible, is not blind. More than half of the verses in the book of Hebrews are dedicated to explaining reasons and evidence to accept the new covenant in Jesus Christ. Nor is faith gullible, or senseless. Instead, godly faith is exemplified by trust. That trust is based on what we know of God, relying on Him for the things we do not know. In particular, godly faith looks forward, from an eternal perspective, and produces obedience, even in the face of hardship. God takes what we cannot see, or cannot understand, and uses it to make good on His word. Since faith relies on what we've seen of God, and trusts Him for the future, it becomes the "assurance of things hoped for, the conviction of things not seen" (Hebrews 11:1–3).

In a chemical reaction, 1,3-bisphosphoglycerate ADP yields 3-phosphoglycerate plus ATP. What is the delta G for this reaction

Answers

Answer:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

Explanation:

The reactants have more free energy than the products. In a chemical reaction, 1,3-bisphosphoglycerate + ADP yields 3-phosphoglycerate plus ATP. ... If the delta G of a reaction was -31.45 kJoules, you would know that: The reaction is spontaneous.

A dowry is:
A.
Money or property given by a man to or for his bride
B.
A gift given by the bride to her mother-in-law
C.
Money or property given by a man to his parents
D.
Money or property given by the bride to her parents

Answers

Answer:

B

Explanation:

As dowry system is the social problem in which the bride/bride's family has to give money or property to the groom's family.

The bride/bride's family has to give money or property to the groom/groom's family on their marriage.

It’s A not B it’s given by the husband to be

An insulator the loss of heat energy.

slows down or speeds up

I WILL MARK YOU BRAINLYSS PLUS 40 POINTSSS

Answers

The heat slows down.

Answer: Slows down

Explanation: Insulation slows does the transfer of heat energy. think of it like this. a puffer jacket (more insulation) keeps you warmer longer than a t-shirt (less insulation).

:)

Other Questions
who discovered atom ? Match the words on the left with their definitions on the right you may use a dictionary. HELP PLEASE!! which of the following is document content that displays at the top of every page? how is one kg mass defined in SI system what color is my shirt?? PLEASE HELP I FORGOT Which rhetorical devices does President Trump use in this excerpt? Select two options. Trump uses tricolon in sentence 1. Trump uses an allusion in sentence 2. Trump uses overstatement in sentence 5. Trump uses tricolon in sentence 7. Trump uses repetition in sentences 6 and 7. Solve the system of equations2x - 9y =14x= -6y + 7 6. A man with a mass of 75 kg standing on a skateboard is holding a medicine ball that hasa mass of 20 kg. If the man throws the ball to the left with a speed of 10 m/s,a) What happens to the man on the skateboard?b) What is the man's speed after throwing the ball? Which of the values shown are potential roots of f(x) = 3x3 "" 13x2 "" 3x 45? Select all that apply. if 3t+p = k then t is equal to what? Mark has taken four tests so far this quarter. His grades were 88%, 95%, 80%, and 92%. What is the mean of his test scores? The lengths of 3-inch nails manufactured on a machine are normally distributed with a mean of 3.0 inches and a standard deviation of .009 inch. The nails that are either shorter than 2.98 inches or longer are than 3.02 inches are unusable. What percentage of all the nails produced by this machine are unusable? Find the area between f(x) = 3x and f(x) = x2 on the interval (0,3] Which of the following are important functions of roots?Roots are where cotyledons emerge.Roots enable plants to spread over land areas.Roots hold the plant in place in the ground.Roots store minerals and carbohydrates for the plant. Fertility is the measure of the ability to become __________. What one word completes the sentence In the two-substance mixtures you have investigated so far, are there any situations where thereis more than one correct answer? Explain. Sara has a cell phone plan that charges $2 per minute for her long distance calls to Italy. She also has a pay a flat fee of $10 each month to have this plan, no matter how many minutes she talks on the phone. If Sara talks for 20 minutes long distance this month, how much money does she have to pay in total? Show work that supports your response. What is an oligarchy? create a electrical mind map on the poem good bones sino ang pilipino dito I brainlies him and I follow in my acc Happycutegirl