Can someone help me with this graph please

Can Someone Help Me With This Graph Please

Answers

Answer 1
These are the answers to your questions

a.In short supply
b.5
c.5

Related Questions

Select the correct answer for the blank: if everything else stays the same, the required sample size ____ as the confidence level decreases to reach the same margin of error. answer: question 1 options: increases decreases remains the same

Answers

The complete statement is "if everything else stays the same, the required sample size decreases as the confidence level decreases to reach the same margin of error." This is further explained below.

What is the margin of error?

Generally, the margin of error is simply defined as a measure of how far your findings depart from the population average.

In conclusion, As confidence levels decline, the needed sample size reduces to provide the same margin of error, assuming all other variables remain constant.

Read more about margin of error

https://brainly.com/question/10501147

#SPJ1

From his eye, which stands 1.63 meters above the ground, Isaac measures the angle
of elevation to the top of a prominent skyscraper to be 17°. If he is standing at a
horizontal distance of 294 meters from the base of the skyscraper, what is the height
of the skyscraper? Round your answer to the nearest hundredth of a meter if
necessary.

Answers

The height of the skyscraper if the angle of elevation to the top of a prominent skyscraper to be 17° is 91.51 meter

What is an equation?

An equation is an expression that shows the relationship between two or more numbers and variables.

Let h represent the height of the skyscraper, hence:

tan(17) = h/294

h = 89.88 meter

Total height = 89.88 + 1.63 = 91.51 meter

The height of the skyscraper if the angle of elevation to the top of a prominent skyscraper to be 17° is 91.51 meter

Find out more on equation at: https://brainly.com/question/2972832

#SPJ1

What is a simpler form of the radical expression?

SOMEONE PLEASE HELP!!

Answers

Answer:

Choice B

Step-by-step explanation:

Given radical expression:

[tex] \sqrt[4]{1296 {x}^{16} {y}^{12} } [/tex]

To Find:

The Simpler form of this expression

Soln:

[tex] = \sqrt[4]{1296 {x}^{16} {y}^{12} } [/tex]

We could re-write the given expression, according to the law of exponents:

[tex] = \tt \sqrt[4]{(6x {}^{4}y {}^{3}) {}^{4} } [/tex]

Now we need to bring terms out of the radical as:

[tex] \tt = | 6x { }^{4} y {}^{3} | [/tex]

Bring out 6x^4 from the absolute & put y^3 only in it:

[tex] \tt = 6x {}^{4} |y {}^{3} | [/tex]

Choice B is accurate.

help me pls I need to get my grade up before July 11th so help ASAP​

Answers

Second option:
-7x^2+4x+2

i dont now this question

Answers

Answer:

y = 108

Step-by-step explanation:

2x + 16 = 3x -12 (as you can see the F shape and are on straight lines and AB is parallel to CD) .

Now we solve for x :

Subtract 2x from both sides :

16 = x - 12

Now we add 12 to both sides :

28 = x

Angle 3x-12 and y add up to 180 as they are on a straight line :

3x-12 + y = 180

Substitute x and solve for y :

3(28) - 12 + y = 180

84 - 12 + y = 180

72 + y = 180

y = 108  

Hope this helped and have a good day

order from the least to the greatest 5 -13 _19 -8 _14 -12​

Answers

If you meant - instead of _, the order would be -19, -14, -13, -12, 18, 5

If you mean for the numbers with _ to be positive, the order is -13, -12, -8, 5, 14, 19

Vector bought 15.6 pounds of paintballs. Ali together, the balls cost 35.99. About how much did the paintball cost per pound

Answers

Answer:

about $2.31 per pound

Step-by-step explanation:

35.99/15.6 = 2.30705128205

2.31

Have a good day! :)

pls help me im confused!
angle #1 = x = ?

angle #2 = X + 30 = ?

Answers

When the sum of two angles measures up to 90° then these angles are known as complementary angles of each other. The measure of ∠1 is 30°, while the measure of ∠2 is 60°.

What are Complementary Angles?

When the sum of two angles measures up to 90° then these angles are known as complementary angles of each other.

for example, ∠x + ∠y = 90°, therefore, the ∠x and ∠y are the complementary angles of each other.

Since the two angles together form a 90° angle. The angles are complementary to each other, therefore, we can write,

∠1 + ∠2 = 90°

x + x + 30 = 90°

2x = 60°

x = 30°

Thus, the measure of the angles can be written as,

∠1 = x = 30°

∠2 = x+30° = 60°

Hence, the measure of ∠1 is 30°, while the measure of ∠2 is 60°.

Learn more about Complementary Angles:

https://brainly.com/question/5708372

#SPJ1

What is 12x³ – 9x² − 4x + 3 in factored form?
Pls hurry

Answers

Answer:

[tex]\bold{\green{(4x-3)(3x^{2}-1) }}[/tex]

Step-by-step explanation:

[tex]\sf{12x^{3}-9x^{2}-4x+3 }[/tex]

[tex]\sf{3x^{2}(4x-3)-1(4x-3) }[/tex]

[tex]\sf{(4x-3)(3x^{2}-1) }[/tex]

Answer:

(3x^2 - 1)(4x - 3)

Step-by-step explanation:

We can use grouping to factor this

12x^3 – 9x^2 − 4x + 3

group into: (12x^3 – 9x^2)(− 4x + 3)

Solve one side at a time:

(12x^3 – 9x^2)

3x^2(4x - 3) factor out a 3x^2

(− 4x + 3)

- 1 (4x - 3) factor out a -1

put the two equations togeth

(3x^2 - 1)(4x + 3)

Which number line represents the solution set for the inequality –4(x 3) ≤ –2 – 2x?

Answers

The solution to the inequality expression is x ≥ - 5

Inequality expressions

Inequality are expressions not separated by an equal sign. Given the inequality;

–4(x + 3) ≤ –2 – 2x

Expand

-4x - 12  ≤ -2 - 2x

Collect the like terms

-4x + 2x  ≤ -2 + 12

-2x  ≤  10

Divide both sides by -2

-2x/-2  ≤ 10/-2
x ≥ - 5

Hence the solution to the inequality expression is x ≥ - 5

learn more on inequality here: https://brainly.com/question/24372553

#SPJ1

Answer:

First line

Explanation: Edge2023

the hcf of 12x^2-4xy+15x-5y​

Answers

Answer:

-1

Step-by-step explanation:

We have 2 letters, x and y. what letter is in all of them? none of them. that means the HCF can't contain a letter. let's take away the letters, we have 12, -4, 15, -5. Since -5 is a prime number. the answer is -1

find the circumference of an object. use 3.14 or 22/7 for pi. round to the nearest hundredth if necessary. 9 cm​

Answers

Step-by-step explanation:

to find the circumference of an object take pie and the radius and multiply it by 2

equation: 2 pie r

if r is 9 the answer is 56.55

9x2=18

18xpie=56.55

Mr. Rodrigo pours himself a glass of orange juice every morning. Yesterday he drank 5/6 of his glass. Today he drank 7/12 of his glass. On which day did drink more

Answers

Yesterday.
Exp: if you make the denominators equal, 5/6 becomes 10/12 which is more than 7/12

Payton collected data to show the relationship between the number of hours he practices and the number of errors he makes when playing a new piece of music. The table shows his data.


A 2-row table with 9 columns. The first row is labeled number of hours with entries 1, 2, 3, 4, 5, 6, 7, 8. The second row is labeled number of errors with entries 36, 34, 30, 31, 23, 16, 11, 5.


Which is the approximate slope of the line of best fit for the data?

Answers

Using a calculator, it is found that the approximate slope of the line of best fit for the data is of -4.54762.

How to find the slope of the line of best fit?


The slope is found inserting the points (x,y) in a calculator. In this problem, the points are as follows:

(1, 36), (2,34), (3,30), (4,31), (5,23), (6,16), (7,11), (8,5).

Hence, using the calculator, the slope is of -4.54762.

More can be learned about a line of best fit at https://brainly.com/question/17261411

#SPJ1

Name the types of angles shown.
L
M
Check all that apply.
A. straight angle
B. right angle
c. supplementary angles
D. complementary angles

Answers

Answer:

Ans : A. Straight angle

Step-by-step explanation:

Brainliest me pls

#KEEPSAFE

#STUDYWELL

#G'MORNING

Brain

Question 2
suppose there is a city where the mean cost per
month of a one-bedroom apartment is $1,500, with a
standard deviation of $250.
approximately what percentage of one-bedroom
apartments in the city cost between $750 and
$1,000?

Answers

Using the normal distribution, it is found that 2.15% of bedroom apartments in the city cost between $750 and $1,000.

Normal Probability Distribution

The z-score of a measure X of a normally distributed variable with mean [tex]\mu[/tex] and standard deviation [tex]\sigma[/tex] is given by:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

The z-score measures how many standard deviations the measure is above or below the mean. Looking at the z-score table, the p-value associated with this z-score is found, which is the percentile of X.

The mean and the standard deviation are given, respectively, by:

[tex]\mu = 1500, \sigma = 250[/tex]

The proportion of apartments that cost between $750 and $1,000 is given by the p-value of Z when X = 1000 subtracted by the p-value of Z when X = 750, hence:

X = 1000:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

[tex]Z = \frac{1000 - 1500}{250}[/tex]

Z = -2

Z = -2 has a p-value of 0.0228.

X = 750:

[tex]Z = \frac{X - \mu}{\sigma}[/tex]

[tex]Z = \frac{750 - 1500}{250}[/tex]

Z = -3

Z = -3 has a p-value of 0.0013.

0.0228 - 0.0013 = 0.0215.

0.02215 = 2.15% of bedroom apartments in the city cost between $750 and $1,000.

More can be learned about the normal distribution at https://brainly.com/question/24663213

#SPJ1

Construct three parallel lines. Then construct two arbitrary non parallel transversal of the parallel lines. Make sure that the transversals cut the three parallel lines at distinct points mark the points of intersection where the transversals cut the parallel lines. Take a screenshot of your construction, save it, and insert the image below.

Answers

The image lines constructed are called parallel lines. They are parallel because  they are all equidistant to each other at every point and at no point between any of the lines will there be an intersection of the three lines.

What does it mean for two or more lines to be equidistant from each other?

Equidistance is simply another word for equal in distance. That is, parallel lines maintain equal distance from each other at all points along them.

See the attached construction as well as more insights about parallel lines from the link below.

https://brainly.com/question/24607467'

#SPJ1


Find the indicated measures for each circle 0

Answers

Answer:

there are no indicate measure bro in circle

Step-by-step explanation:

Why was federal ruling system implemented in Nepal?Give any four reasons

How many solutions are there for the system of nonlinear equations represented by this graph?

Answers

The total solution for the system of nonlinear equations represented by this graph is 2 solutions

Graphs and Functions

Quadratic function have a leading degree of 2. The graph of a quadratic function is parabolic in nature.

Since the given graph consists of a parabola, hence the total solution for the system of nonlinear equations represented by this graph is 2 solutions

Learn more on graphs here: https://brainly.com/question/25020119

#SPJ1

Find the slope and y-intercept for the following graph of a linear equation

Answers

Answer:

Slope: [tex]\frac{4}{1}[/tex]

Y - intercept: -1

Step-by-step explanation:

We can see from the graph that the slope is [tex]\frac{4}{1}[/tex].

We can also identify the y - intercept as -1.

Therefore, the linear equation would be y = [tex]\frac{4}{1}[/tex]x -1

Hope this helps:) Goodluck!

-7–2.1n=-3.5n PLEASE ANSWER

Answers

Answer:

n=5

Step-by-step explanation:

-7-2.1n=-3.5n

 +2.1n    +2.1n

-7   =  -1.4n

/-1.4   /-1.4

n=5

Hope this helps!

If not, I am sorry

Answer:

b = - 1.25

Step-by-step explanation:

-7 - 2.1n = 3.5n

-7 = 3.5n + 2.1n

-7 = (3.5+2.1)n

-7 = 5.6n

-7/5.6 = n

n = -1.25

Check:

-7 -(2.1*-1.25) = 3.5*-1.25

-7 + 2.625 = -4.375

Malaki constructed \overline{CG}

CG

start overline, C, G, end overline parallel to \overline{AB}

AB

start overline, A, B, end overline through point CCC.


Which of the following statements best justifies why \overleftrightarrow{CG}

CG

C, G, with, \overleftrightarrow, on top is parallel to \overleftrightarrow{AB}

AB

A, B, with, \overleftrightarrow, on top?

Choose 1 answer:

Choose 1 answer:


(Choice A)

A

Lines perpendicular to the same transversal are parallel.


(Choice B)

B

Lines with supplementary same-side angles are parallel.


(Choice C)

C

Lines with congruent alternate interior angles are parallel.


(Choice D)

D

Lines with congruent corresponding angles are parallel.

Answers

Answer: Lines with congruent corresponding angles are parallel.

CG is parallel to AB because Lines with congruent corresponding angles are parallel.

How to define transverse lines?

From the given image, we see that there is a transverse line cutting across lines AB and CG.

Now, from transverse line theorem we know that If two parallel lines are cut by a transversal, the corresponding angles are congruent. If two lines are cut by a transversal and the corresponding angles are congruent, the lines are parallel.

Thus, we can conclude that CG is parallel to AB because Lines with congruent corresponding angles are parallel.

Read more about Transverse Lines at; https://brainly.com/question/2141319

#SPJ1

If the diameter of a youth baseball is 2. 8 inches and the diameter of an adult softball is 3. 8 inches, what is the approximate difference in their volumes? use 3. 14 for pi. round to the nearest tenth. recall the formula sphere volume = four-thirds pi r cubed. 1. 0 cubic inch 17. 2 cubic inches 40. 2 cubic inches 137. 8 cubic inches.

Answers

The approximate difference in their volumes is 17.2 cubic inches

How to determine the difference in the volume?

The given parameters are:

Diameter, d = 2.8

Diameter, D = 3.8

The radii are the half of the diameter.

So, we have:

r = 1.4

R = 1.9

The volume of the balls is then calculated using:

[tex]V = \frac{4}{3}\pi r^3[/tex]

The difference is then represented as:

[tex]D = \frac{4}{3}\pi (R^3 - r^3)[/tex]

Substitute known values

[tex]D = \frac{4}{3}* 3.14* (1.9^3 - 1.4^3)[/tex]

Evaluate

D = 17.2

Hence, the approximate difference in their volumes is 17.2 cubic inches

Read more about volumes at:

https://brainly.com/question/1972490

#SPJ1


Find the 14 term of the following geometric sequence.
10, 20, 40, 80,

Answers

Answer:

81920

Step-by-step explanation:

Finding the common ratio (r) :

20/102

Finding the 14th term :

a₁₄ = ar¹⁴⁻¹a₁₄ = ar¹³a₁₄ = (10)(2)¹³a₁₄ = (10)(8192)a₁₄ = 81920

Answer:

the 14th term in the sequence would be 81920.

Step-by-step explanation:

because you are multiplying by 2 each time to find the next multiply 80 by 2 giving you 160 again giving you 320 again giving you 640 than 1280 , 2560 ,5120 ,10240 ,20480 ,40960 ,finally the 14th number in the sequence multiplying 40960 by 2 would give you your answer of 81920.


I need help with this

Answers

Answer:

The answer is B

Step-by-step explanation:

f(x) = -3x - 5

g(x) = 4x - 2

= -3x - 5 - (4x - 2)

= -7x - 3

Answer:

B. -7x - 3

Step-by-step explanation:

(f - g)(x) = f(x) - g(x)

f(x): -3x - 5

g(x): 4x - 2

f(x) - g(x) = (-3x - 5) - (4x - 2)

              = -3x - 5 - 4x + 2

              = (-3x - 4x) + (- 5 + 2)

              = (-7x) + (-3)

Use the digits 1-9 without repeating, to create two prisms with the same volume

Answers

Two prisms with the same volume are rectangular prisms of the dimensions  1 by 4 by 9 and 2 by 3 by 6

How to create the prisms?

To do this, we start by determining the type of prism to create.

Assume that we want to create a rectangular prism.

The volume of a rectangular prism is:

Volume = Length * Width * Height

Using the digits 1 - 9, we have:

Prism 1

Length = 1

Width = 4

Height = 9

The volume is

Volume = 1 * 4 * 9 = 36

This means that the second prism must have a volume of 36.

Using the digits 1 - 9, we have:

Prism 2

Length = 2

Width = 3

Height = 6

The volume is

Volume = 2 * 3 * 6 = 36

Notice that the digits are not repeated.

Hence, two prisms with the same volume are rectangular prisms of the dimensions  1 by 4 by 9 and 2 by 3 by 6

Read more about volumes at:

https://brainly.com/question/1972490

#SPJ1

what is the answer to 8^6÷8

Answers

the answer to this equation is 8^5

Answer:

32768

Step-by-step explanation:

8^6 is 262144

then divide 262144 by 8

so 262144 / 8 = 32768

Hope This Helped

[((a ^ 2 - 25b ^ 2) ^ 3 + (25b ^ 2 - 9c ^ 2) ^ 3 + (9c ^ 2 - a ^ 2) ^ 3)/((a - 5b) ^ 3 + (5b - 3c) ^ 3 + (3c - a) ^ 3)]​

Answers

The factorization is  [(a + 5b)/(a - 5b)]³ + [(5b + 3c)(5b - 3c)]³ + [(3c + a)(3c - a)]³

To answer the question, w e need to know what factorization is

What is factorization?

Factorization is the breaking down of a larger expression into smaller expression by grouping it into its factors.

So, [{(a² - 25b²}³ + {25b² - 9c²}³ + {9c² - a²}³)/{(a - 5b)³ + (5b - 3c)³ + (3c - a)³}]​

= [{(a² - (5b)²}³ + {(5b)² - (3c)²}³ + {(3c)² - a²)})/{(a - 5b)³ + (5b - 3c)³ + (3c - a)³}]​

Using the fact that x² - y² = (x + y)(x - y) in the terms in the numerator, we have

[{(a - 5b)(a + 5b)}³ + {(5b - 3c)(5b + 3c)}³ + {(3c - a)(3c + a)}³/{(a - 5b)³ + (5b - 3c)³ + (3c - a)³}]​

Factorizing out the denominator, we have

= [{(a + 5b)/(a - 5b)}³ + {(5b + 3c)/(5b - 3c)}³ + {(3c + a)/(3c - a)}³[(a - 5b)³ + (5b - 3c)³ + (3c - a)³]/{(a - 5b)³ + (5b - 3c)³ + (3c - a)³}]​

Cancelling out the denominator, we have

= [(a + 5b)/(a - 5b)]³ + [(5b + 3c)(5b - 3c)]³ + [(3c + a)(3c - a)]³

So, the factorization is  [(a + 5b)/(a - 5b)]³ + [(5b + 3c)(5b - 3c)]³ + [(3c + a)(3c - a)]³

Learn more about factorization here:

https://brainly.com/question/26257992

#SPJ1

Why won't anyone help me :(​

Answers

The probability will include:

P(A and 1) = 1/24

P(C and 2) = 1/12.

P(B and 3) = 1/12.

P(A and 4) = 1/12

How to calculate the probability?

The probability of P(A and 1) will be:

= 1/4 × 1/6

= 1/24

The probability of P(C and 2) will be:

= 1/4 × 2/6

= 1/12

The probability of P(B and 3) will be:

= 2/4 × 1/6

= 1/12

The probability of P(A and 4) will be:

= 1/4 × 2/6

= 1/12

Learn more about probability on:

brainly.com/question/24756209

#SPJ1

Solve the system of equations.

8x – y = 8
8x2 – y = 8

(0, 8) and (0, –8)
(1, 0) and (0, –8)
(2, 8) and (1, 0)
(3, 16) and (2, 24)

Answers

Answer:

(1, 0 ) and (0, - 8 )

Step-by-step explanation:

8x - y = 8 → (1)

8x² - y = 8 → (2)

since both equations are equal to 8 then equate the left sides

8x² - y = 8x - y ( subtract 8x - y from both sides )

8x² - 8x = 0 ← factor out 8x from each term

8x(x - 1) = 0

equate each factor to zero and solve for x

8x = 0 ⇒ x = 0

x - 1 = 0 ⇒ x = 1

substitute these values into (1) and solve for y

x = 0 : 8(0) - y = 8 ⇒ y = - 8 ⇒  (0, - 8 )

x = 1 : 8(1) - y = 8 ⇒ y = 0 ⇒ (1, 0 )

Other Questions
Imagine that you're reading about the different roles the president of the United States plays, including the commander in chief of the armed forces, chief diplomat (which involves setting foreign policy and dealing with foreign governments), and chief of state (which involves serving as the main representative of the country). What mental image could help you remember these three roles? Select the correct answer from each drop-down menu. which sector dominates developed economies such as the united states? in developed economies such as the united states, the sector dominates the economy. examples include legal firms, , and so on. Simulated Gel Electrophoresis Activity #1 Directions: You have been given segments of DNA from all 4 organisms (below). You are going to add a particular restriction enzyme that cuts a segment of DNA every time it finds the sequence ccgg. Depending on where it cuts we get different sized pieces of DNA that we can separate on the basis of size using gel electrophoresis. There were 3 cuts so 4 pieces of DNA (I did this one for you) Botana curus ATTCCGGATCGATCGCCGGATATACTCCGGTAATATC Species X ATTGTACCGGGATCCGGACGTCGCGACTAATATAGCA Species Y ACCGGTCCGGGATCGCACCCGGTACTCCTGTAATATC Species Z ATTCCGGATCGATCGCCGGATATTCTCCGGTAATATA LLFC95D2x+3EWhat is the value of x and the length of segment DE?1 5992x + 32. 10x+15=9(9)Length of DE=units Read paragraphs 36. Which main techniques does the author use in all three paragraphs to develop the idea that Zitkla- 's mother has negative feelings about the paleface? a rectangle mural measure 234 inches by 245 inches, rihanna created a mural 33 inches longer Lisa is a high school student who went to see her guidance counselor. she was given a questionnaire that contained these questions: what activities do you enjoy the most? the least? which things would your job need to include in order to make you feel satisfied? what things are you especially good at? what values, beliefs, or principles are most important to you? what issues or causes do you care about? which best explains why lisas guidance counselor asked her these questions? so she could see her personal vision and plan achievable goals. so she could set her priorities and adjust her goals. so she could visualize her future and plan achievable goals. so she could identify her milestones and adjust her goals. 1235678910TIME REMAINING48:31Read this introduction paragraph from a sample essay about industrialization.[1] There are many examples of revolutions in human history that have resulted in tremendous change. [2]The transformation of manufacturing during the Industrial Revolution is one such example. [3] Although therevolution began in England, it soon spread to other countries in Europe, and the United States. [4] In each ofthe countries, the industrial revolution resulted in increased urbanization, changes in employment, and newtechnologies that changed the way people worked and lived.Which sentence in the paragraph includes the essay's thesis statement?O sentence 1sentence 2sentence 3O sentence 4 Some companies positively harness the power of rumors to multiple choice instill false confidence in investors. replace formal communications. create buzz about a new product launch. deflect interpersonal conflicts. achieve the boundaryless organization. Solve system of equation using elimination by addition.Will give brainliest!! A country has two political parties, the Reds and the Blues. The 100-member senate has 44 Reds and 56 Blues. How many ways are there to pick a 10 member committee of senators with the same number of Reds as Blues Which of the following best explains the importance of having a standardized taxonomic classification system when determining the relatedness of organisms? Marias suitcase has a mass of 14 kilograms. Her sisters suitcase has a mass of 1,600 grams. Which suitcase has a greater mass? Explain. A chemical reaction can be reversed if?The energy of the reactants exceeds the activation energy threshold.The energy of the products exceeds the activation energy threshold.The energy of the reactants is less than the activation energy threshold.The energy of the products is less than the activation energy threshold. Miguel Rodriguez borrowed $300 from his brother Julio to pay for books and tuition. He agreed to pay Julio in 6 months with simple annual interest at 6.9% Someone please help fast!Simplify: in the picture Choose the correct verb in subjunctive and complete the following sentences.Espero que sean/conozcan las pirmides de Egipto What is f(x) + f(x) + f(x)? 3f(x)3f(x) = 3xEvaluate 3f(2) = . Which topic below would be a good one for a demonstration?steps for safety during an earthquakewhy frogs sing after it rainswhat to look for in a petwhere Canada is on a map (3x-2)(3x-2)(3x-2)(2x+1)