Characteristics such as a widow’s peak or attached earlobes are determined by the genetic code. Which components of DNA are referred to as the genetic code?


A. Phosphate groups
B. Nitrogenous bases
C. Deoxyribose sugars
D. Hydrogen bonds



PLEASE HELP!!!

Answers

Answer 1
the answer is a or b i’m not sure

Related Questions

it takes 25 min to cook 10 egg how long does it take to cook 20​

Answers

Answer:

it takes 50 min

Explanation:

20 is twice of ten so if it take 25 min to cook ten then it is 50 min to cook 20.

Work for it:

10 x 2 = 20

10 eggs=10 min

25x2=50

Answer:

it takes 50 minutes to cook 20 eggs

Explanation:

ok first you have to see how long it takes 1 egg to cook so 25/10=2.5minute an egg then u multiply 2.5 x 20=50

hope this helps

Bacteria reproduce in a process called binary fission which of the following is true about binary fission?

Answers

The answer is D :) the offspring will have identical DNA from their parents

how do you think the idea of sustainability influences the work of foresters?



help me

Answers

It’s funny because the concept of sustainability is thought to come from field of forestry. Around the year 1700, Carl von Carlowitz described the concept of sustainable forestry.

What size molecules can pass through a cell membrane by a process called passive transport?​

Answers

Answer:

diffusion and osmosis

Explanation:

lipid_ soluble substance

through lipid baleyer

through protein channel

Transported proteins carry small substances like water, amino acids, and charged ions. One to fifteen angstroms is the range in molecule size that can pass through the membrane. The easier it is for a molecule to move across the cell membrane, the smaller it is.

What is cell membrane ?

All cells have a cell membrane, also known as a plasma membrane, which separates the interior of the cell from the external environment. A semipermeable lipid bilayer makes up the cell membrane. The movement of materials into and out of the cell is controlled by the cell membrane.

Small molecules or ions can traverse the cell membrane passively without the cell providing any energy. The three basic types of passive transport are osmosis, assisted diffusion, and diffusion.

Gases like oxygen and carbon dioxide, as well as small hydrophobic compounds, quickly traverse membranes. Water and ethanol are examples of small polar molecules that can move across membranes, though more slowly.

Thus, The easier it is for a molecule to move across the cell membrane, the smaller it is.

To learn more about cell membrane, follow the link;

https://brainly.com/question/13524386

#SPJ2

Someone help me match the last two to their definition
Hypotonic and Isotonic

Answers

isotonic is equal on both sides, and hypotonic is higher inside the cell

Do humans and plants get their nutrients the same way?

Answers

Answer:

As humans require a lot of nutritious food for the growth, same way plants also require nutrients in order to grow. Plants which are grown in the soil gets all the required nutrients from the fertilizers and from the land where natural nutrients are stored.

plants use photosynthesis

In the seventeenth century, Francesco Redi performed experiments using raw meat placed in jars.
• Half of the jars were covered, and half were left open,
• Redi noticed that the meat in the sealed jars did not have maggots, but the meat in the open jars did have maggots.
Redi concluded that only flies could make more flies,
.
Which part of the cell theory corresponds to Redi's findings?

Answers

Answer: B

Explanation:

''New cells come from the existing cells'' is a part of the cell theory which corresponds to Redi's findings.

Experiment performed by Francesco Redi

Francesco Redi conducted an experiment in which he showed that living organisms come from other living organisms. This worked combine with the work of other later scientists, helped to develop the third part of the cell theory which is cells come from other living cells.

Learn more about cell theory here: https://brainly.com/question/3966602

Which macromolecule plays a central role as an energy source?

Answers

Answer:

Carbohydrates

Explanation:

Ex: Glucose (monosaccharide)

the receptionist said to the manager,'I have booked your flight tickects for Monday'. change into imdirect speech​

Answers

Answer:

The correct answer is-  The receptionist told the manager that he had booked his flight tickets for Monday

Explanation:

Indirect speech is the expression any statement of a consverstaion that occured in past without quoting explicitly. Indirect speech is the stating any quoted statement in simple statement. In this type of speech some grammer and certain noun and pronoun change accordingly.

So the correct indirect speech of the receptionist said to the manager,'I have booked your flight tickects for Monday'. would be The receptionist told the manager that he had booked his flight tickets for Monday

What controls the cell cycle at key checkpoints?
a Regulatory proteins
b Regulatory lipids
C Regulatory carbohydrates

Answers

Answer:

a regulatory proteins

Explanation:

njnjnj

When you step
on a scale, what is being
measured?

Answers

Answer:

Although scales measure force, they give you measurements of mass in kilograms, grams, pounds, or whatever.

Explanation:

What the person above me said is correct


Explanation it’s correct I’m positive

Which best describes the relationship between DNA, genes, and chromosomes?
DNA are segments of genes that form tight coils called chromosomes.
Genes are segments of DNA that form tight coils called chromosomes.
Chromosomes are segments of DNA that form tight coils called genes.
Genes are segments of chromosomes that form tight coils called DNA.

Answers

Answer:

genes are segments of chromosomes that form tight coils called dna

The statement that best describes the relationship between DNA, genes, and chromosomes is as follows:

Genes are segments of chromosomes that form tight coils called DNA.

Thus, the correct option is D.

What is Chromosome?

A Chromosome may be defined as a thin thread-like structure that appears during the process of cell division. Such types of thread-like structures are significantly present in the nucleus of the cell.

Chromosomes are made up of DNA, RNA, histones, and some non-histone proteins. Chromosomes were first discovered by E. Strausburger in 1875.

Genes are small stretches that significantly considered the segments of chromosomes. Together they form a tightly coiled structure remarkably known as DNA. Genes carry nucleotide sequences that can produce functional enzymes or proteins.

All such parts carry genetic information with respect to the existence of organisms on the basis of morphology and function.

Therefore, the correct option for this question is D.

To learn more about Chromosomes, refer to the link:

https://brainly.com/question/11912112

#SPJ6

Which term describes a pure substance that is made up of only one type of atom?
O matter
Orock
O compound
o element

Answers

element. an element is when a substance only contains one type of atom. compound is made of 2 or more

MULTIPLE CHOICE QUESTION
Are a majority of the problems associated with down syndrome a result
of an over or under expression of chromosome 21?
under
over

Answers

It would be over because a baby without a birth defect has 46 chromosomes but with a Down syndrome baby they have an extra copy of chromosome which is chromosome 21

Hope this helps

Have a great day/night

Certain gene mutations can cause genetic disorders. However the same gene can also have a positive effect. The genetic mutation that led to sickle cell anemia can also give its carriers protection from which of the following diseases?
A.
strep throat
B.
Type I diabetes
C.
malaria
D.
hemophilia

Answers

B is the correct answer

Answer:

its malaria

Explanation:

I got it wrong and it showed me that it was malaria

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

The division of the cytoplasm, which follows Mitosis, is called...

Answers

Answer:

Cytokinesis,

Explanation:

Cytokinesis, the division of the cytoplasm to form two new cells, overlaps with the final stages of mitosis. It may start in either anaphase or telophase, depending on the cell, and finishes shortly after telophase.

The division of the cytoplasm, which follows Mitosis, is called Cytokinesis. This is further explained below.

What is Mitosis?

Generally, Mitosis is simply defined as a kind of cell division that produces two daughter cells with the same number and type of chromosomes as the parent nucleus, as seen in normal tissue growth.

In conclusion, Cytokinesis is simply defined as the division of the cytoplasm that occurs after mitosis to produce two daughter cells.

Read more about Cell

https://brainly.com/question/2622341

#SPJ2

ANY ALT PEOPLE HERE

Answers

Answer:

LOL THIS IS NOT THE PLACE FOR THIS XDDDDDD

Explanation:

Answer:

thanks for the points

Explanation:

what is the function of mitrochondria

Answers

Answer: Mitochondria are membrane-bound cell organelles (mitochondrion, singular) that generate most of the chemical energy needed to power the cell's biochemical reactions. Chemical energy produced by the mitochondria is stored in a small molecule called adenosine triphosphate (ATP).

Explanation:

Answer: The mitochondrionis a double membrane-bound organelle found in most eukaryotic organisms. Some cells in some multicellular organisms lack mitochondria (for example, mature mammalian red blood cells). A number of unicellular organisms, such as microsporidia, parabasalids, and diplomonads, have reduced or transformed their mitochondria into other structures.

Explanation:

(Many points) PLS HELP QUICK dont guess answer pls ad dont say random answers for points pls

Cheng made a chart to list the functions of certain fish structures.

(The image below)

Which headings correctly complete the chart?

X: Fin
Y: Swim bladder
Z: Lateral line
X: Fin
Y: Lateral line
Z: Swim bladder
X: Lateral line
Y: Swim bladder
Z: Fin
X: Lateral Line
Y: Fin
Z: Swim bladder

Answers

Answer:

x:fin

y:lateral line

z:swim bladder

Answer: The answer for this question is Fin for x  Lateral line for y and

swim bladder for z

Explanation:

I took the test

Why does DNA need to make a transcript of itself and what is this transcript called?

Answers

Answer:

DNA needs to be transcribed itself as a mechanism for the multiplication of its molecules, and this transcription process is called DNA replication.

Explanation:

DNA replication is a mechanism that allows it, from one molecule, to obtain two molecules identical to the original. In other words, it transcribes the information from one of its strands to a new strand.

The process of DNA replication is semi-conservative, because each new molecule is formed by an original strand and a new strand, which contributes to maintaining the integrity of the genetic information.

As a requirement of the cell division process, as mitosis,  DNA must replicate so that each daughter cell has the same genetic information as the original cell. This is why replication of this nucleic acid occurs.

In pea plants, the allele that produces purple flowers (P) is dominant to the allele that produces white flowers (p), and the allele that produces tall plants (T) is dominant to the allele that produces short plants (t). Two pea plants are crossed and produce 521 offspring, and the results of this cross are shown below:


Phenotype Number of offspring
Tall with purple flowers 291
Short with purple flowers 97
Tall with white flowers 101
Short with white flowers 32


Which cross would MOST LIKELY lead to this outcome?
Pptt × ppTt
pptt × PPTT
PpTt × PpTt
ppTT × PpTt

Answers

Answer: PpTt x PpTt

Explanation:

The cross PpTt × PpTt leads to the phenotype Number of offspring Tall with purple flowers 291 Short with purple flowers 97 Tall with white flowers 101 Short with white flowers 32, hence option C is correct.

What is a dihybrid cross?

Two creatures that are identically hybrid for two characteristics are said to have mated to create a dihybrid cross. When an organism is heterozygous, it signifies that there are two distinct alleles present at a certain genetic location.

An attempt in producing two creatures that are identical hybrids for two qualities is a dihybrid cross.

The people with this sort of character are homozygous for that particular trait.

Therefore, to put it another way, a dihybrid cross is a union of two organisms that are heterozygous for two separate features, hence option C is correct.

Learn more about dihybrid, here:

https://brainly.com/question/12540319

#SPJ2

Interphase
21. Before Meiosis, comes
cell activities, like making
During interphase, the ce
for example.
22. Uncoiled stringy DNA is called​

Answers

uncoiled stringy dna is called chromatin


7. What is a layout of chromosomes in humans in order from largest to smallest with the
sex chromoosomes at the end called?

Answers

Answer:

Look down!!! ;)

Explanation:

In a human karyotype, autosomes or “body chromosomes” (all of the non–sex chromosomes) are generally organized in approximate order of size from largest (chromosome 1) to smallest (chromosome 22). However, chromosome 21 is actually shorter than chromosome 22.

Hope this helps!! ;)


Why must an mRNA copy be made for Protein Synthesis?
A. Ribosomes cannot read DNA, only RNA.
B. DNA must stay inside the nucleus.
C. Ribosomes are too big to enter the nucleus.
D. DNA is too degenerate to use without mRNA.

Answers

Answer:

A

Explanation:

its not D or C and B might be true but its A okay

Why must an mRNA copy be made for Protein Synthesis because C. Ribosomes are too big to enter the nucleus

Why is mRNA important for protein synthesis?

mRNA is the molecule that includes the message contained within DNA to the ribosome. Ribosomes are where proteins are produced. mRNA is vital because ribosomes cannot attain the DNA inside our cell nucleus, which is the region within the mobile wherein DNA is housed.

Why is it important to make an mRNA reproduction of a DNA gene earlier than protein synthesis?

So as for cellular to fabricate these proteins, particular genes inside its DNA should first be transcribed into molecules of mRNA; then, these transcripts must be translated into chains of amino acids, which later fold into completely useful proteins.

Learn more about Ribosomes at https://brainly.com/question/8773679

#SPJ2

Why are the rocks on the bottom folded but the top ones are not? What could’ve caused this?

Answers

Answer: The basic answer could be because of the tectonics plates.

Explanation: Because when two forces act towards each other from opposite sides, rock layers are bent into folds.

Typically, sedimentary rocks are arranged in layers, one on top of the other, the oldest items are listed last, followed by the youngest, this is the concept of "superposition.

Why are rocks folded?

Erosion has removed the top layers of the rocks, resulting in the formation of valleys and hills, the top layer might be penetrated with sufficient power. The plates might shift due to erosion, and plate movement.

Many of the stratified rocks, however, are no longer horizontal, we know that sedimentary rocks that are not horizontal either were created in unique ways.

Therefore, more frequently, were shifted from their horizontal position by subsequent processes, such as tilting during episodes of mountain construction, thanks to the Law of Original Horizontality.

Learn more about rocks, here:

https://brainly.com/question/29561452

#SPJ2

20 points and will mark brainliest!! Explain how you got it!

Answers

Answer:

OF COUSE IT C

Explanation:

Answer:

C

Explanation:

I think the answer is C.

The different kinds of water effects the water and the sunlight. This helps show how much water and sunlight each plant gets and it will bring results.

I hope this helps you! Have a great day!

When the northern hemisphere points toward the sun, the southern hemisphere faces away from the sun. In this instance, it is:

A.
summer in North America, and winter in Australia.
B.
summer in North America and Australia.
C.
winter in North America, and summer in Australia.

Answers

Answer:

A

Explanation:

the northern hemisphere is the opposite from the southern hemisphere

Since northern and southern hemisphere are in opposite directions therefore, option (A) is correct.

Why are the seasons reversed in each hemisphere?

The axis of rotation of the Earth is inclined with regard to the plane in which it orbits the sun. This is the root reason of the changing of the seasons. When the axis of the earth is aligned with the sun, summer arrives in that hemisphere of the planet. Expect winter to arrive when the axis of the earth is tilted away from the sun.

Different places of Earth receive the Sun's most direct rays throughout the year. When the North Pole tilts toward the Sun, it's summer in the Northern Hemisphere. When the South Pole tilts toward the Sun, the Northern Hemisphere experiences winter.

Learn more about seasons, here:

https://brainly.com/question/12028829

#SPJ2

1. Energy transfer is inefficient between trophic levels because

A. Molecules are fully digested from each trophic level.

B. Dead organisms and waste are recycled throughout the trophic levels.

C. Organisms within a trophic level are fully consumed.

D. All organisms within a trophic level die.

2. Primary productivity is defined as

A. The rate that plants and other photosynthesis organisms produce organic compounds.

B. The process where green plants and some other organisms convert light energy into chemical energy using carbon dioxide and water.

C. The overall amount of energy captured by plants and other photosynthetic organisms by the chloroplast.

D. The adjusted amount of energy in an ecosystem due to energy use by organisms for respiration.

Thanks if you help, It's highly appreciated. :-)​

Answers

Answer: b dead organisms And waste are recycled throughout the tropic levels.

Explanation:

Answer:

part 2

the rate that plants and other photosynthetic organisms produce organic compounds.

Explanation:

:)

Pls help me
10 points

If a defendant appeals the verdict from a state court of last resort, which
court would most likely hear the appeal next?
A. An intermediate appellate court
B. The U.S. Supreme Court
C. A federal district court
D. A municipal court
SUBMIT

Answers

Answer:

b

Explanation: peeps in washington are going crazy.

Other Questions
ONE HUNDRED POINTSParaphrase stanza three from "The Man with the Garden Tool" in the form of a summary question.Stanza:What gulfs between him and the seraphim!Slave of the wheel of labor, what to himAre Plato and the swing of Pleiades?What the long reaches of the peaks of song,The rift of dawn, the reddening of the rose?Through this dread shape the suffering ages look;Time's tragedy is in that aching stoop;Through this dread shape humanity betrayed,Plundered, profaned, and disinherited,Cries protest to the Powers that made the world,A protest that is also prophecy. Marcus can drive his boat 36 miles down the river in 3 hours but takes 4 hours to return upstream. Find the rate of the boatin still water and the rate of the current. A 25 foot ladder leans against a house. How faris the foot of the ladder from base of the buildingif the top of the ladder is 20 feet from the ground?A. 20 ftB. 15 ftC. 18 ftD. 10 ft how many atoms are in 1.50 moles of He? Read the selection and the question, and then choose the option that best answersthe question.Si tiene usted fiebre, puede escuchar las recomendaciones del doctor:. Descanse en la casa. Tome la medicina que le receta el doctor. Toque la frente cada dos horas. No beba agua fra.According to the text, what object might be useful?A thermometerA castCrutchesGauze A triangle with vertices D, E, and F are plotted on the coordinate plane at (0, 5). (2, 0), and (-4, 2), respectively. When constructed,medians DG and EH intersect at the point with which coordinates? Round each coordinate to the nearest tenth if necessary. A. (-0.7, 2.5)B. (-1, 1)C. (-0.7, 2.3)D. (-2, 3.5) Your bill at pizza hut is $30. You leave 20% tip. Whats is the amount of tip? I need help please What % of offspring will be green? The equation for line g can be written as y = x + 5. Parallel to line g is line h, which passes through the point (-6, -4). What is the equation of line h? SHOW WORK PLEASE Find the value of x. Why was imperialism mainly a cause of World War I Can anyone help with this please? Need help with this please.... and show work!!! The table below shows the level of carbon dioxide in the atmosphere for a period of 50 years.What conclusion can you make about how the carbon dioxide level has changed over time?The level has not changed.The level of CO2 has declined.The level of CO2 has risen.The table below shows the level of carbon dioxide in the atmosphere for a period of 50 years. What is the value of K?k=8mokNMwhat is the answer to this ? :) Please help me answer this !!! please HELP ME ASP PLEASEEEEEEEEE HELP ILL GIVE BRAINLIEST An angle measures 158 more than the measure of its supplementary angle. What is the measure of each angle? _ and _ Which of the following is NOT a heterogenous mixture:SaladBeef StewCereal in milkVinegar Which definition BEST fits the example shown in the picture?A)An energy source using solar power.B)An energy source using fossil fuels.C)An energy source using nuclear power.D)A resource existing in an unlimited amount; it whmot run out.