Answer: Asexual
Explanation: Since only one parent is needed, asexual reproduction is more beneficial. It is a "simpler" (in terms of not needing two mates to fornicate) and causes species to reproduce at a faster rate
List some common adaptations in organisms
100 ponits!!!
Mafic rocks are...
a.high in silica content
b.low in Fe & Mg content
c.high in Fe & Mg content
d.low in silica content
Answer:
B
Explanation:
YOOOOOOOOOOOOOOOOOOOOOO
ELETSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS
what is the percentage of thymine in wheat ?
Answer:
27.1% or 27% if rounded
Explanation:
Hope this helps ya!!
A substance only composed of one kind of atom is a(n) *
What two electron carrying particles does the electron transport chain use to get the energy it needs to
make ATP?
GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were
Answer:
u want step by step?
Explanation:
what is empty space that is free of matter
What do you think we would see if we looked at that same portion of the sky with an even more powerful telescope that is in space?
what is homeostasis?
the body's way of coping of outside factors
the body's ability to heat up and cool down
the body's natural way of maintaining equilibrium or balance
the body's standard heart rate
Answer: C or if there is an E for all the above
Explanation: Homeostasis refers to the body’s ability to maintain a stable internal environment (regulating hormones, body temp., water balance, etc.).
question one : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) colliding with each other
question two : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) moving towards, then moving away from each other
question three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?
a) the rocks are youngest the further away you move from the ridge
b) the rocks are oldest the further away you move from the ridge
c) the rocks are the same age no matter how far away from the ridge you move
d) the rocks do not age
Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?
Rust occurs when iron chemically reacts with oxygen. what type of weathering is this an example of?
Answer:
Wedging (for the first one)
Explanation:
Which is the process by which gas exchange between the respiratory system and the blood cells in the cappilaries occurs? transfusion condensation evaporation diffusion
Answer:
Diffusion
Explanation:
Diffusion is the process by which molecules of substances move from regions of higher concentration to regions of lower concentration until equilibrium concentration is attained. This movement of molecules is because a concentration gradient exists between the two regions.
Blood cells in the capillaries is low in oxygen because the cells have used up the oxygen in cellular respiration. However, in the lungs, the oxygen concentration is high due to inspiration of oxygen from the external environment. Therefore, a concentration gradient exists between the lungs and blood cells in the capillaries. Oxygen from the lungs diffuses into the blood cells in the capillaries, and these blood cells are then returned to other parts of the body by the circulatory system. This is a continuous process and is known as gaseous exchange.
Answer:
Diffusion
Explanation:
2. Chemicals that absorb light
are called
Answer:
Chemicals that absorb light are called Pigments. 3. Chlorophyll makes plants look green because it Reflects green light.
Explanation:
Answer:
pigments
Explanation: Chlorophyll makes plants look green because it Reflects green light.
are bones living or non living and why
Answer:
i think they are non living
Explanation:
because they dont have organs or blood or anything
Answer:
Bones are non living
Explanation:
1: Bones don’t movement on their own
2: Bones don’t have cells
3: Bones do bot breathe
4: They do not count on anything to survive
5: They are just something that helps a living organism to move
Help please
I’m begging you, due in an hour
Answer:
1 should be D and 2 should be A
hurry due in five min plz help
Answer:
b
Explanation:
Answer:
d
Explanation:
I hope that helped!
fill in the complementary bases according to the base-pair rule.
a | t | c | c | g | a | t | a | g | c | t | t | a | g
What is H₂O - H₂+ boz
Answer:
-tH2
H20 - H2 + boz
0-H2t
-tH2
What components are needed for
photosynthesis?
Answer:
sunlight, carbon dioxide, and water as substrates
Explanation:
Hope this helps :]
Answer:
Explanation:
chicken leg piece and/Photosynthesis is a multi-step process that requires sunlight, carbon dioxide, and water as substrates. It produces oxygen and glyceraldehyde-3-phosphate (G3P or GA3P), simple carbohydrate molecules that are high in energy and can subsequently be converted into glucose, sucrose, or other sugar molecules.
Give two examples of why water is important to the human body.
Answer: Your body uses water in all its cells, organs, and tissues to help regulate temperature and maintain other bodily functions. Because your body loses water through breathing, sweating, and digestion, it's important to rehydrate by drinking fluids and eating foods that contain water.
Different plant species require different amounts of direct sunlight in order to flower. A student designed an experiment to determine the length of exposure to direct sunlight necessary for a specific plant species to produce flowers. The student collected the data below.
0 hours, 0% with flowers
9 hours, 0% with flowers
1 hour, 0% with flowers
5 hours, 90% with flowers
3 hours, 80% with flowers
7 hours, 10% with flowers
Identify the:
independent variable-
dependent variable-
control group-
experimental group-
constant-
Answer:
Independent variable: LENGTH OF EXPOSURE TO DIRECT SUNLIGHT
Dependent variable: PRODUCTION OF FLOWERS
Control group: THE GROUP OF PLANT THAT WASN'T EXPOSED TO SUNLIGHT i.e. 0 hours
Experimental group: THE GROUP OF PLANTS THAT WERE EXPOSED TO SUNLIGHT
Constant: THE SAME PLANT SPECIES
Explanation:
Independent variable is the variable that the experimenter changes or manipulates in an experiment. In this experiment, the experimenter exposes the specific plant species to sunlight at different length of time, hence, the LENGTH OF EXPOSURE TO DIRECT SUNLIGHT is the independent variable.
Dependent variable is the variable which is measured in an experiment. In this experiment, the measured/dependent variable is the PRODUCTION RATE OF FLOWERS by the plant species.
Control group is the group in an experiment that does not receive the variable being tested. In this experience, the control group is THE GROUP OF PLANT THAT WASN'T EXPOSED TO SUNLIGHT i.e. 0 hours
Experimental group is the group of am experiment that is exposed to the experimental treatment (sunlight). In this case, the experimental group is THE GROUP OF PLANTS THAT WERE EXPOSED TO SUNLIGHT.
Constants are variables of an experiment that must be kept unchanged for all groups throughout the experiment in order not to affect the experiment's outcome. In this experiment, the constant is THE SAME PLANT SPECIES used,
Are Bacteria (essential/non-essential) to sustaining the EcoSphere?
Please Help me as soon as possible.
In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR) is crossed with a camellia plant with white flowers (WW). What are the expected phenotypes of the offspring of this cross?
A.
All will have red flowers.
B.
Half will have red flowers and half will have white flowers.
C.
All will have both red and white flowers.
D.
All will have pink flowers.
Answer:
The answer is; c
It is important to distinguish between codominance and incomplete dominance.
In incomplete dominance, the two alleles blend with each other in phenotype giving offspring with intermediate phenotypes, hence offspring would produce pink flowers, in this case.
In codominance, both alleles are simultaneously expressed in phenotype in the offspring. Therefore flowers, in this case, would exhibit both red and white colors.
Explanation:
Unsaturated fat consists of which of these, Lipid, Carbohydrate, Protein, or Nucleic Acid
Answer:
Lipid is the most likely answer.
Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule? What happens to the other 66%?
Answer:
Why are cells are able to harvest about 34% of the available stored potential energy in a glucose molecule is because of the process of cellular respiration. And what happens to the other 66% is that it's used to make water from hydrogen ions and oxygen that converted to heat and used directly for energy to store as fat
Explanation:
When you exhale, what happens in the lungs?
A. Air moves from high pressure (in the lungs) to low pressure (outside)
B. Space in the lungs increases
C. Lung pressure decreases
D. Air moves from low pressure (in the lungs) to high pressure (outside)
Answer:
Conversely, exhalation moves the diaphragm up into the chest cavity and reduces the space in it. This forces the air, which is dense with carbon dioxide at that point, out of the lungs and windpipe. It then exits the body either through the nose or mouth. Usually, this requires no physical effort from the body.
Explanation:
So its A
What is typical of cell reproduction when cancer cells are reproduced in a petri dish from a tissue culture? Check all that apply.
Answer:
Cells reproduce without limit. Cells reproduce with multiple cells
A water molecule is attracted to another water molecule. This is an example of
Which of the following statements supports the need for a handler to know an animal’s point of balance? A handler must know an animal’s pattern of movement in order to avoid injury. A handler must know where to stand in order to avoid injury. A handler must know proper feeding procedures in order to avoid injury. A handler must not use a loud voice in order to avoid injury.
Answer:
A handler must know an animal’s pattern of movement in order to avoid injury.
Explanation:
Point of balance refers to equalibrium so if you know the animals pattern of movemenrt you are less likely to get injured while moving on or with it.
Answer:
A
Explanation:
i got it wrong and it showed the correct answer
Please hurry
1. Identify one environmental factor that could cause a base sequence in DNA to be changed to a different base sequence.
2. Explain why, in a mammal, a mutation in a gamete may contribute to change in the population of the organism while a mutation a body cell will not.
Answer:
Explanation:
1 Long term exposure to harmful genotoxic chemicals or ionizing radiation can cause changes in the base sequence of DNA.Chemicals might induce DNA mutations, such as polycyclic hydrocarbons (fumes found in oil stations, or smoke from a tobacco cigarette), intercalating agents such as Ethidium Bromide (carcinogen), but also radiations such as UV-radiation (C and T bases are most vulnerable and would bind to identical bases unstead of their
2 Genetic changes that are described as de novo (new) mutations can be either hereditary or somatic. In some cases, the mutation occurs in a person’s egg or sperm cell but is not present in any of the person’s other cells. In other cases, the mutation occurs in the fertilized egg shortly after the egg and sperm cells unite. (It is often impossible to tell exactly when a de novo mutation happened.) As the fertilized egg divides, each resulting cell in the growing embryo will have the mutation. De novo mutations may explain genetic disorders in which an affected child has a mutation in every cell in the body but the parents do not, and there is no family history of the disorder.
Somatic mutations that happen in a single cell early in embryonic development can lead to a situation called mosaicism. These genetic changes are not present in a parent’s egg or sperm cells, or in the fertilized egg, but happen a bit later when the embryo includes several cells. As all the cells divide during growth and development, cells that arise from the cell with the altered gene will have the mutation, while other cells will not. Depending on the mutation and how many cells are affected, mosaicism may or may not cause health problems.