Answer:
Both Mars and Saturn have rings.
10. Modern telescopes make it possible for astronomers to detect planets around distant stars. Why couldn't
astronomers detect these planets before?
A. The planets are much closer than the stars they orbit.
B. The planets are much larger than the stars they orbit.
C. The planets are much farther than the stars they orbit.
D. The planets are much smaller than the stars they orbit.
Answer:
I would Say the answer is D
Explanation:
Answer:
I I think it’s D
Explanation:
D the planets are much smaller than the stars they orbit.
What are some environmental indicators?
Eukaryotic cells can be specialized for specific tasks in multicellular organisms
true
false
The diagram shows the moving molecules in a beaker of liquid. What will happen if the molecules increase their speed?
A.
the liquid will become a solid
B.
the temperature of the liquid will increase
C.
the temperature of the liquid will decrease
D.
the molecules will gain mass
Answer:
I believe the answer to this question is B
Please help I'm behind
Answer:
B : Barometer
Explanation:
A barometer is a scientific instrument used to measure atmospheric pressure, also called barometric pressure. The atmosphere is the layers of air wrapped around the Earth. That air has a weight and presses against everything it touches as gravity pulls it to Earth. Barometers measure this pressure.
5. Why might a cell need to phagocytose?
Answer:
Phagocytosis is a critical part of the immune system. ... By knowing the enemy, the cells of the immune system can specifically target similar particles circulating in the body. Another function of phagocytosis in the immune system is to ingest and destroy pathogens (like viruses and bacteria) and infected cells.
Explanation:
True or false the main source of energy and water cycle is gravity
Answer:
False please mark me brainlest.
Explanation:
how does water pollution harm water ecosystems?
Answer:
the animals die due to the chemicals and stuff in the water
Explanation:
Identify the advantages and disadvantages of internal and external fertilization
What abiotic factors might affect a population of fish? Check ALL that apply.
clear water
light
temperature
food
Answer:
Clear water, light, and tempature.
Explanation:
1. What Does DNA stand for?
Answer:
deoxyribonucleic acid
construct a flowchart (using “->”) (or explain) that depicts all the energy transfers that occur from the sun to the milk of your cereal
Answer:
dragon warrior or whatever it is called I don't maybe I am right
The energy related to the motion of an object is called ___.
Answer:
The answer is kinetic energy
Explanation:
Why do the cells used for reproduction only have half (½) of the DNA that other cells have?
Answer:
Because each chromosome has a pair, these cells are called "diploid" cells. On the other hand, human sperm and egg cells have only 23 chromosomes, or half the chromosomes of a diploid cell.
Explanation:
Match each underlined word to its correct meaning based on the context of the sentence. Tom had long been picking his way cautiously through this treacherous forest; stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering, but what it was she forbore to say. At this propitious time of public distress did Tom Walker set up as a usurer in Boston.
Answer:
A. Tom had long been picking his way cautiously through this treacherous forest; stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs. - 3.dangerous.
B. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors. - 4.bleak.
C. He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering, but what it was she forbore to say. - 2.conciliatory.
D. At this propitious time of public distress did Tom Walker set up as a usurer in Boston. - 1.favorable .
Explanation:
The given underlined words in each sentence are-
1. "Precarious" refers to something unstable, unconfirmed, dangerous, uncertain, unreliable. So, when used in the given sentence, it suggests the dangerousness of the foothold that Tom had to depend on.
2. The word "dreary" is also used for something dull, uninteresting, bleak. It is used to describe the banal, cheerless memento of the fight the Indian warriors had given.
3. "Propitiatory" is another word used to describe something that is like a conciliatory offering, a token of appeasement, or trying to please someone or something. In the given sentence, it is used to describe how she will be offering a conciliatory act to him.
4. The word "propitious" is synonymous with something favorable, advantageous, presenting a promising idea. And in its use, the sentence presents how the public distress is favorable for Tom Walker to set up his office.
Answer:
- 3.dangerous. Tom had long been picking his way cautiously through this treacherous forest; stepping from tuft to tuft of rushes and roots, which afforded precarious footholds among deep sloughs.
- 4.bleak. It was a dreary memento of the fierce struggle that had taken place in this last foothold of the Indian warriors.
- 2.conciliatory.
He was sulky, however, and would not come to terms: she was to go again with a propitiatory offering, but what it was she forbore to say.
- 1.favorable . At this propitious time of public distress did Tom Walker set up as a usurer in Boston.
Explanation:
decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Answer:
GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong
Anaerobes carry on whereas aerobes carry on cellular respiration
Answer:
Anaerobes carry on cellular respiration in the absence of oxygen, whereas aerobes carry on cellular respiration in the presence of oxygen.
Explanation:
Many of the cell processes needed need some energy to occur. Cellular respiration is the process by which cells degrade organic compounds and turn them into energy. Cellular respiration follows two ways, which depend on the presence or absence of oxygen, and both of them begin with the process of glycolysis, which occurs in the cytoplasm and does not need oxygen to occur.
Aerobic Respiration
Occurs in the presence of free oxygen.Series of reactions by which pyruvic acid (product of glycolysis) turns into CO₂ and H₂O, producing many ATP molecules. Respiration occurs in the mitochondria.Takes place in two steps or stages: Krebs cycle and electron transporter chain. Glycolysis and Krebs cycle produce electrons, which then travel along the electron transporter chain while releasing energy, and ATP is produced.Anaerobic Respiration
Occurs in the absence of free oxygenSeries of reactions by which using pyruvate (product of glycolysis) 2 ATP molecules van be produced. There are two ways in which anaerobic respiration can be produced: lactic fermentation and alcoholic fermentation. Lactic fermentation produces lactic acid and 2 ATPAlcoholic fermentation occurs in two steps, and the final products are ethylic alcohol, 2ATP, and 2 CO₂The whole anaerobic process occurs outside the mitochondria.What is the role of enzymes in the DNA replication process?
A. Enzymes read the DNA code and build a new DNA molecule from scratch.
B. Enzymes link together to form a template for a new DNA molecule to be built.
C. Enzymes split the DNA molecule into two rails and then transport corresponding nitrogenous bases to each rail.
D. Enzymes link adjacent nucleosides together, becoming an integral part of the structure of the new strands of DNA.
Answer:
B.
Explanation:
I’m not sure if anyone knows this or not, can someone try and help me with this question!
Answer:
it gives them a mental picture of where they need to plant and pick the cotton
Explanation:
Hope this helps
Every cell contains DNA. The main purpose of DNA is to store the cell’s genetic information. How does DNA control the cell?
A. DNA activates nerve signals in the nervous system
B. DNA speeds up chemical reactions and lowers activation energy
C. DNA protects the cell from invaders.
D. DNA determines what proteins are made.
Answer:
The answer is D: DNA determines what proteins are made.
Explanation:
The nucleotide sequences that make up DNA are a “code” for the cell to make hundreds of different types of proteins; it is these proteins that function to control and regulate cell growth, division, communication with other cells and most other cellular functions.This process is called protein synthesis.All known cellular life and some viruses contain DNA. The main role of DNA in the cell is the long-term storage of information. It is often compared to a blueprint, since it contains the instructions to construct other components of the cell, such as proteins and RNA molecules.
Hope this helps!! ;)
DNA controls the cell by determining what protein are synthesized by the cell. Thus, the correct option is D.
What is Translation?Translation is the process of synthesis of proteins from the mRNA (messenger RNA) of the cell. This process occurs in the ribosome of the cell. In this process, the mRNA produced from the DNA encodes amino acids which join together to form large polypeptide and protein molecules.
mRNA are produced from DNA through the process of transcription. Transcription occurs in the nucleus of the cell. Through this process, DNA produces a sequence of mRNA which is complementary to it. This mRNA determines what proteins will be synthesized by the cell.
Therefore, the correct option is D.
Learn more about DNA here:
https://brainly.com/question/264225
#SPJ6
(GIVING BRAINLIEST!!)
Which common characteristic of planets do Saturn and Earth share?
A) They have rings.
B) They have moons.
C) They are made of rock.
D) They have thick atmospheres.
Answer:
THEY HAVE MOOOONNNNSSSSS
Explanation:
Through scientific research, genetic technologies have advanced the study of gene sequences. Which is a main benefit of gene therapy technology?
a. The ability to cure genetic diseases by replacing defective genes
b. The ability to genetically design organisms that have never existed
c. Understanding how human genes turn on and off to make carbohydrates
d. Making genetically superior plants and animals to benefit the entire world.
Answer:
a. The ability to cure genetic diseases by replacing defective genes
Explanation:
True or False: Epinephrine enters
the cell after it binds to the receptor.
Epinephrine enters the cell after it binds to the receptor. Yes, this statement is true.
What are the functions of epinephrine?
Adrenaline, also known as epinephrine, is a hormone and medication which is involved in regulating visceral functions. It appears as a white microcrystalline granule.
Epinephrine injection is used for emergency treatment of severe allergic reactions (including anaphylaxis) to insect bites or stings, medicines, foods, or other substances.
Through its action on alpha-1 receptors, epinephrine induces increased vascular smooth muscle contraction, pupillary dilator muscle contraction, and intestinal sphincter muscle contraction.
Learn more about epinephrine:
https://brainly.com/question/3882731
#SPJ2
A plant or animal that carries a disease or parasite during part of its life cycle is called a(n):
Answer:
it could probably be host
Answer:
A plant or animal that carries disease or parasite during part of its life cycle is called a host
I HOPE IT HELPS ❤❤In a series of rock layers, where do you find the oldest layers? Explain why?
Your answer
Please helppp meh!!
Answer:bottom
Explanation:
Mitosis is responsible for growth, repair, and maintenance in an organism because
a. it occurs at a faster rate than meiosis.
b. the chromosome number is reduced by half.
c. exact duplicates of each mother cell are produced.
d. it is the only process that involves replication of genetic material.
Answer:
The correct answer is c
Explanation:
USA test prep
You should be on the lookout for tornadoes
during___
because the two often occur
together.
х
thunderstorms
winter storms
blizzards
hurricanes
Which belongs in each place
Answer:
1=e, 2=b, 3=c, 4=d, 5=a
Explanation:
.
If an organism is heterozygous for a particular trait, the organism
A.
has the same allele on both chromosomes in a chromosome pair.
B.
is missing alleles on the chromosomes in a chromosome pair.
C.
has different alleles on the chromosomes in a chromosome pair.
D.
has extra alleles on both chromosomes in a chromosome pair.
Answer: C.
has different alleles on the chromosomes in a chromosome pair
Explanation:
Hetero means different.
A heterozygous condition is one in which the child inherits various eye-color genes from both biological parents. For that particular gene, a heterozygous genotype exists when there are two distinct versions. Thus, option C is correct.
What is the particular trait for heterozygous organism?When two distinct alleles of a gene (one mutant allele and one wild-type allele) are present in a diploid organism's cells, that organism is said to be heterozygous at that particular gene locus.
Heterozygosity describes a particular genotype, since the cell or organism is referred to be a heterozygote just for the particular allele in question.
The heterozygote may, however, occasionally have a phenotype that is somewhere between the phenotypes of both homozygous parents.
Therefore, has different alleles on the chromosomes in a chromosome pair.
Learn more about heterozygous here:
https://brainly.com/question/29327683
#SPJ2
Advantages of using tidal power include O no alr pollution
Otides are predictable
O low environmental Impact
O all of these
Answer:
all of these :)
Explanation:
i think
Answer:
Yes The Correct answer is ( All Of These)
explanation: