Compare the roles of women in classical era Greece and Persia and discuss some of their rights and activities.

Answers

Answer 1
yes it’s tht one.....

Related Questions

important notes about vimy ridge?

Answers

Answer:

vimy Ridge was a particularly important tactical feature. ... Its capture by the Canadians was essential to the advances by the British Third Army to the south and of exceptional importance to checking the German attacks in the area in 1918.

Explanation:

hope this helped,brainliest?

How did the Supreme Court define the powers and role of the federal government?

Answers

Answer:

Ask google and she’ll tell you lol and ur teacher won’t ever know :)

Explanation:

Based on this evidence, what might you infer about the importance of Armistice Day to
Americans?
A. Armistice Day became increasingly important to Americans after 1919.
B. Armistice Day became less and less important to Americans after 1919.
C. Armistice Day was never very important to Americans.
D. Armistice Day was important to just a few Americans.

Answers

Answer: A. Armistice Day became increasingly important to Americans after 1919.

what was the battle of bighorn's effect on westward expansion?

Answers

Answer:

General Custard died, and so did all his men. Americans we’re angry and upset with the Indians, and so Indians were forced to move places with a smaller reservation.

The Proclamation of 1763 stated that colonists were no longer allowed to settle east
of the Appalachians Mountains.
True
False

Answers

Answer:

That is true

Hope this helps!

Answer:

False

Explanation:

The answer is the second option or "false." Although The Proclamation of 1763 prohibited colonists from settling, it did not affect the east side but the west side of the Appalachia. The Proclamation of 1763 angered many of the colonist because they felt that the Proclamation was the governments way of keeping them under England's control.

Hope this helps.

Which ancient empire left the greatest legacy? Why?

Answers

Answer:

The Ancient greek empire left the greatest legacy because it lasted over 2000 years and still affects the greek culture now.

Explanation:

Canada is divided into political areas called...

A)states and territories
B)regions and states
C)provinces and states
D)territories and provinces

Answers

Answer:

D

Explanation:

Answer:

D

Explanation: Got it right hope this helps

How did Georgia officials use the land gained after the Revolutionary War? Check all that apply.
✓ They distributed plots of land to white adult men.

✓ They encouraged settlers to expand into the West.

* They gave territory to loyalists who served in militias.

✓ They gave territory to war veterans who were patriots.

* They set aside land for settlers to build towns along the coast.

Answers

Answer:

A, B, and D

Explanation:

Answer:

abd

Explanation:

Now create a short outline of your paragraph to structure the flow of information in your editorial.

Answers

Answer:

planned for a full paragraph

stated and defended an opinion about Lodge’s and Wilson’s positions

defined the issues surrounding the controversy

concluded a course of action that the United States should take

Explanation:

Answer:

before the editorial with the check boxes they are all correct

Explanation:

planned for a full paragraph

stated and defended an opinion about Lodge’s and Wilson’s positions

defined the issues surrounding the controversy

concluded a course of action that the United States should take

Plz answer 4 points. I need 20 characters lol

Answers

wait its farmers sorry but they were all so great at artwork and they like to build but I'm pretty sure they're of answers farming

Why is community service important in a democracy?
A It helps businesses train new employees
B It shows that you care about the public welfare C It lowers unemployment
D It removes the national government's responsibility to improve society
PLEASE ANYONE I BEG YOU PMEASR OMG PLEASE AMYONE

Answers

Answer:

They support disadvantaged children, help homeless people, care for the elderly. They do all this on a voluntary, pro bono basis and without making a big fuss about it. This way, they not only create added value for other people; they are also the heartbeat of democracy.

Explanation:

Hopefully this helps

Answer:

B.

Explanation:

HELPPPPPPPPPPPP!!!!!!!!!!!!!!!!!! PLEASE!!!!!!!!!!!!!!!

Which statement accurately describes an important contribution of the
Spanish monarchs King Ferdinand and Queen Isabella?
A. Their decision to approve Christoper Columbus's voyage let to Catholicism becoming the dominant religion in the Americas.
B. Their decision to provide Christoper Columbus with a strong army allowed Spain to completely control sea routes from Europe to the Americas.
C. Their decision to support Christoper Columbus's expedition demonstrated that the Earth was smaller than previously thought.
D. Their decision to finance Christoper Columbus's voyage led directly to the beginning of European exploration of the Americas.

2

Answers

Answer:

Correct answer is D. Their decision to finance Christopher Columbus's voyage led directly to the beginning of European exploration of the Americas.

Explanation:

D is the correct answer because after Columbus journey many other explorers, including Cabral, Cabot, Vespucci and other followed and Europeans even started settling in Americas.

A is not correct because with British explorers many Protestants also came to the new world.

B is bot correct is also correct, because Britain, France and other countries also had strong influence.

C is not correct as it actually showed that the Earth is bigger than previously believed.

Which of these is not a way the nile river in egypt influenced everyday life a: Lots of gold was mined from river banks b It served as a highway for travel up and down the valley c: It provided mud to make bricks for homes d: farming was affected by and benefited from annual flooding.

Answers

The correct answer is D) farming was affected by and benefited from annual flooding.

The statement that is not a way the Nile river in Egypt influenced everyday life is " farming was affected by and benefited from annual flooding."

The flooding of the Nile was extremely important for Egyptian agriculture, but as the question says, it was by season, not a daily life activity. Egyptians learned the exact days of the Nile flooding and then they prepared themselves to grow crops in the fertile soil left by the flooding. But as I said, it was a seasonal activity, not a daily life activity.

Daily life activities included mining of gold from river banks, the Nile was the highway for travel up and down the valley and transport all kinds of goods, and the river provided mud to make bricks for homes.

Which strategy did companies use to stop strikes from growing?
a) hired workers to cross the picket line if a group of workers went on strike.
b) offered workers a sum of money to stop striking.
c) asked supervisors to do the work of the people on strike.
d) forced workers to sign contracts promising they would not strike.

Answers

It d hope it help you

Which of the following definitions best describes a Democracy?
Rule of One
Rule of Few
Rule of All
Rule of Religious Leaders

Answers

Tule of all. C. C c c c. C c. C c c c

Why was it decided to lower the voting age to 18 from 21? Not enough people were showing up to vote in elections. College students began to protest a lack of rights. It was unusual that 18-year-olds could be drafted but could not vote. Young people were the only group to not receive increased rights.

Answers

Answer:

THE ANSWER IS C ) IT WAS UNUSUAL THAT 18- YEAR OLDS COULD BE DRAFTED BUT COULD NOT VOTE

Explanation:This is the answer because they found it unfair that people at the age of 18 could go out to war and fight for the a country that doesn't even let them vote, this was change for the 18 year olds since it was found unconstitutional that they could fight but not vote so they were like let them fight and have the right to vote

Answer:

C in edge

Explanation:

What is the APR (interest rate) on this card for Purchases made during the first six months that a cardholder has this card? * 0% 15.24% 23.24% 25.24%

Answers

Answer:

I'm pretty sure it's 0%

Explanation:

The apr usually is 0% for the first 6 months

Answer:

The answer to this question is 0%.

Explanation:

How did the American Revolution contribute to the French Revolution?


The Treaty of Paris that ended the American Revolution made France unstable and led to revolution.The Treaty of Paris that ended the American Revolution made France unstable and led to revolution. , ,

French soldiers from the American Revolution returned home and began a rebellion to overthrow the government.French soldiers from the American Revolution returned home and began a rebellion to overthrow the government. , ,

The debt that France gained during the American Revolution brought on an economic crisis that caused a revolution.The debt that France gained during the American Revolution brought on an economic crisis that caused a revolution. , ,

Britain began a revolution in France because it was upset over France’s support for the American Revolution.

Answers

Answer:

c.The debt that France gained during the American Revolution brought on an economic crisis that caused a revolution.The debt that France gained during the American Revolution brought on an economic crisis that caused a revolution.

details from “to a person sitting in the dark “

Answers

Answer:

dark sitting

Explanation:

Answer:

Your alone

Sad

Scared

Hurry up and get out of the room!!!

Explanation:

Which of the following was a direct result of the Columbian Exchange? A. Native Americans suffered from diseases brought to the New World by Europeans. B. Ideas, technology, plants, and animals were shared between the cultures of North and South America for the first time. C. Europeans benefited from the advanced weapon technology of the Native Americans. D. Explorers were required to give all gold, money, or treasure they found to the king or queen who had financed their voyage.

Answers

Answer:

D

Explanation: Natives were killed if they did not bring enough gold to them

Answer:

D. Explorers were required to give all gold, money, or treasure they found to the king or queen who had financed their voyage.

How did the Voting Rights Act of 1965 stop discrimination in areas where voter eligibility tests were previously used? It required federal supervision. It instituted new poll taxes. It sponsored voter registration drives. It required all citizens to vote.

Answers

Answer: It required federal supervision.

Explanation:

Answer:

A: It required federal supervision.

Explanation:

100% on edg

who killed the district judge during the revolutionary movement
answer in one sentence​

Answers

Answer: Santi Ghose (also known as Santi Ghosh, 22 November 1916 – 1989) was an Indian nationalist who, along with Suniti Choudhury, assassinated a British district magistrate when she was 15 years old and is known for her participation in an armed revolutionary struggle.

Explanation:


Which if the following groups of Americans were negatively impacted by Manifest Destiny?

A.White settlers

B.Native Americans

C. US presidents

Answers

the US presidents have

Answer:

B: Native Americans

Explanation:

The negative effect that this had on Native Americans were lasting effects. Manifest Destiny also caused war and tension with Mexico for the same reasons. Manifest Destiny caused americans to feel entitled, greedy, power hungry, they wanted to be the best.

The integration of West African states into wider regional and transregional economic networks in the period circa 1200–1450 was carried out mostly via the

Answers

Answer:

Trans Saharan Trade Routes

Explanation:

From 1200 to 1450, The integration of West African states into wider regional and transregional economic networks in the period was carried out mostly via Trans Saharan Trade Routes.

This was made possible by the availability of camels and caravans that serves as a means of transportation for both humans and goods between West Africa and North Africa or the Middle East.

The major goods of exchange at the time were Gold in West Africa in exchange for Salt from the Mediterranean region.

The legend of the Trans Saharan Trade Routes was made popular during the time of Mansa Musa, the Malian Empire King. It cut across major cities in West Africa

Which of the following statements best explains the reason that the British government passed the Proclamation of 1763?
Choose 1 answer:
(Choice A)
A
to reduce conflicts between the American colonists and indigenous people after Bacon’s Rebellion

(Choice B)
B
to discourage interracial relationships between indigenous people and British colonists

(Choice C)
C
to limit costly conflicts over access to land between American colonists and indigenous communities

(Choice D)
D
to punish the American colonists for their lack of involvement in the Seven Years’ War

Answers

Answer:

it was issued to appease native americans by checking the encroachment of european settlers on their land

Explanation:

this doesnt exactly answer the question but i hope it helps anyway

Answer:

c:to limit costly conflicts between the American colonists and indigenous people after bacon's rebellion

Explanation:

En la historia del origen del dinero es necesario mencionar la historia de la banca, ya que fueron los primeros en custodiar las monedas de las personas fueron los:

Answers

La respuesta correcta a esta pregunta abierta es la siguiente.

Los primeros en custodiar las monedas de las personas fueron los: Orfebres.

Lo que sucedió es que las personas temían ser robadas. Si ellas dejaban sus monedas o lingotes de oro en casa, corrían el riesgo de ser víctimas de los asaltantes. Por esa razón, los orfebres idearon una forma de hacer más dinero, custodiando las pertenencias de otras personas para resguardarlas. Al hacerlos, los orfebres les cobraban una cantidad por sus servicios.

Esto representó un gran negocio, y es el origen de los bancos. Cuando las personas llevaban sus pertenencias para ser resguardadas, los orfebres tan solo les daban un papel como comprobante del resguardo.

describe 3 examples of how the Magna Carta and bill of rights are similar to one another

Answers

Answer:

The major similarity between the two documents is that both of them are limits on the power of the government. A secondary similarity is that they are both written contracts of sorts that spell out what governments can and cannot do. The idea that a government can be limited was a novel one in the 1200s.

Explanation:

the top answer is correct , i answered after so you can mark them brainliest they deserve it !

A significant accomplishment of the Second Continental Congress
in 1778 was?

Answers

Declaring independence
The Second Continental Congress took on a government's usual duties, nominating ambassadors, issuing paper money, raising the Continental Army by conscription, and appointing army leadership generals.

Answer:

During this period, its achievements included: Successfully managing the war effort; drafting the Articles of Confederation, the first U.S. Constitution; securing diplomatic recognition and support from foreign nations; and resolving state land claims west of the Appalachian Mountains.

Explanation:

The Roman Catholic religion was the unifying institution in both the Spanish and Portuguese colonies
O True
O False

Answers

Answer:

True, they were both catholic and still are!

Explanation:

marking brainliest !!

Answers

Answer:

Your answer is C

Explanation:

Other Questions
why did washington did not want political parties??why did jefferson did want political parties?? Which ion has smaller size and why?Mg++ or Na+. Which statement about Monsoons in South Asia is true?Question 1 options:They are seasonal winds that bring rain. They occur all year. Another term for them in Hurricane. They only occur in India Explain why the slope of the line drawn in part C must be negative. what is the value of the product 2/3 * 9/5 Several important physical needs that organisms receive from the environment are:water, minerals, carbon dioxide, and oxygenthe balance of nature, minerals, carbon dioxide, and oxygenwind, minerals, carbon dioxide, and oxygen anyone good with english i need help What is the value of x? 1. 1422. 713. 1524. 76 what is the equation of aline that passes through the point (4,-8) and has a slope of -1/2? 7x+5y=40 2x+4y=-4Solve the system of equations What is the value of X in this DiagramI will give a brainlist for the correct answer what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K? What mathematical advancement is credited to the Gupta Empire?the development of algebrathe discovery of the circumferencethe development of a decimal systemthe understanding of the diameter which statement would most likely be made by a supporter of the wars in iraq and Afghanistan Which of the following equations represent linear functions?y=x23x4x+y=5y=|2x+1|y=5 Read the excerpt from The Strange Case of Dr. Jekyll and Mr. Hyde. Round the corner from the by-street, there was a square of ancient, handsome houses, now for the most part decayed from their high estate and let in flats and chambers to all sorts and conditions of men; map-engravers, architects, shady lawyers and the agents of obscure enterprises. One house, however, second from the corner, was still occupied entire . . . In what way is this setting characteristic of gothic fiction? The homes have deteriorated from their original grandness. The street is busy with the activity of local traders. The homes have been transformed into places of business. The street is renowned for its wealthy occupants. ____ helps us understand when an action occurred.NounsVerb tenseVerb agreementPronouns