Confirm this statement that there is a close relationship between geographical conditions and people's life.​

Answers

Answer 1

Answer:

Explanation:Human geography considers how people are affected by, or affect the environment around them. It might be to do with, for example, migration, immigration, the integration of the social and natural worlds, the internet, but at some level it is connected with how we as people are shaped, and equally shape, how and where we live.

Physical geography is more concerned with topography and how the land is in terms of mountains, seas, rivers, valleys, height and depth, and so forth. It is less concerned with the human impact on it and more to do with the ‘stage’ of land if you were to consider the world as a stage in a theatre.

Despite that the topography in physical geography is still moulded by the people that live on it. Humans, may be constricted or not, by the physical environment in which they live and this in some way, determines how they live their lives.


Related Questions

What are the negative impacts of westernization in India?

Answers

The negative impacts of westernization in India:

1. Loss of Cultural and Traditional Values: One of the biggest negative impacts of westernization in India is the loss of cultural and traditional values. Traditional Indian values and customs have been replaced by western beliefs, which have caused a complete transformation of Indian culture.2. Increase in Immoral Activities: The introduction of western culture in India has brought about a rise in immoral activities such as premarital sex, drug use, alcoholism and other social evils.3. Rise in Gender Inequality: Westernization has led to a rise in gender inequality in India, where women are now expected to behave and dress in a certain way, while men are expected to take on more traditional roles.4. Increase in Health Problems: The adoption of western cultures, such as fast food, has caused an increase in health problems in India, including obesity, diabetes, and heart disease.5. Environmental Damage: The influx of western products and technology has led to an increase in pollution, deforestation, and other environmental damages in India.

The Dark Side of Westernization in India: How It Has Led to a Loss of Cultural and Traditional Values, Increase in Immoral Activities, and More

The introduction of western culture in India has had far-reaching consequences. As westernization has grown, traditional values and customs have been replaced with foreign beliefs, leading to a complete transformation of Indian culture. This has not only caused a loss of cultural and traditional values, but has also led to an increase in immoral activities, gender inequality, health problems, and environmental damage.

First, the influx of western values has caused a significant loss of traditional Indian values and customs. Indian culture is now being replaced with western beliefs and practices, which have caused a drastic change in Indian society. This includes things like food, clothing, music and language, which have all changed to reflect western ideas. As a result, many traditional values, such as respect for elders and the importance of family, are being lost.

Learn more about westernization :

https://brainly.com/question/12214212

#SPJ4

Compare the lives of Jeffrey Dahmer and Alice Walker.
Compare the lives of Jeffrey Dahmer and Alice Walker.

Answers

The life of Jeffrey Dahmer and Alice Walker has minimal similarities such as the nationality of both characters or their popularity (which has different reasons).

How do you compare the lives of two characters?

To compare the lives of two characters we have multiple options. For example, we can look at their most outstanding events, their place and date of birth, their impact on society, among others

In the case of these two characters, it can be inferred that both had an impact on society. However, Jeffrey had a negative impact, while Alice has had a positive impact.

In the case of Jeffrey, he became popular (famous) for the criminal acts committed against 17 people, which led him to be sentenced to jail. On the other hand, Alice has been distinguished for her leadership in different causes such as civil rights, women's rights, among others.

The only aspect that these two characters would have in common is that they were both born in the United States, that is, their nationality is the same.

Learn more aobut comparisons in: https://brainly.com/question/14047951

#SPJ1

Large amounts of data stored in electronic form are ________ than the same data in manual form.
A) less vulnerable to damage
B) more secure
C) vulnerable to many more kinds of threats
D) more critical to most businesses
E) prone to more errors

Answers

Answer:

c) vulnerable to many more kinds of threats

Explanation:

hope this helps. pls mark BRAINLIEST

Which country is famous for potato production?

Answers

Presently, China is the world's largest producer of potatoes, followed by India, Russia, and Ukraine. The world's fifth-largest producer of potatoes is the United States (NPC).

What is production?

Production is the process of mixing multiple inputs, both immaterial (such as plans or information) and material (such as metal, wood, glass, or polymers). In a perfect world, this output would be a product or service that is useful to people and has value.

The primary goal of BCFB is to introduce agriculture to the county's youngsters. BROWNFOOT — Bingham County is the epicenter of the potato universe because it produces more potatoes than any other county in Idaho and the country combined.

Therefore, China currently produces the most potatoes in the world, followed by India, Russia, and Ukraine.

Learn more about production here:

https://brainly.com/question/14787713

#SPJ4

kierra is a young, single parent who is emotionally distant to her children. when she does interact with them, she often gets frustrated and sends them away from her. what type of attachment are her children likely to form

Answers

In a case whereby kierra is a young, single parent who is emotionally distant to her children. when she does interact with them, she often gets frustrated and sends them away from her the type of attachment that her children likely to form is Avoidant.

What is Avoidant attachment?

Avoidant attachment is an attachment style  that can be attributed to the child  when their parent or main caretaker doesn't show care or responsiveness past providing essentials like food and shelter.

It should be noted that the child do disregards their own struggles as well as needs in order so that they can maintain peace and keep their caregiver close by howevr this style can be seen in the way they keep distance from others as well as push others away when they get close or show a desire for closeness and their lack of emotional closeness in relationships.

Learn more about Avoidance at:

https://brainly.com/question/25771019

#SPJ1

If you were an entrepreneur and want to set up a business, which type of market
would you choose and why? Give your shop a suitable name and also suggest how
you would attract customers.

Answers

Find a concept that you can eventually expand to the national or, even better, the global level.

Define a market.

A market is any place where two or more individuals can gather to perform an economic transaction, even if it doesn't include legal tender. An exchange of goods, services, information, money, or any combination of these to a third party is referred to as a market transaction.

It is not the person running the firm, the marketing, or the staff who determines whether the company succeeds or fails, but the quality and viability of the initial idea that gave rise to it.

Three key factors to remember are:

Make sure people are purchasing the good or service again.Make sure your profit margin is high.A good idea alone won't cut it; you need a strong support staff.

To know more about markets, visit:

https://brainly.com/question/17284274

#SPJ1

What is communism Commonlit answers?

Answers

A socioeconomic system founded on the concepts of common or community ownership of all property and the abolition of social classes is what is meant by communism, a philosophical, social, political, and economic movement.

A political and social theory concerning how a society may be run, communism. It may be described as a concept that imagines a civilization or a collection of individuals. where almost everything is shared equally. Decisions are made for the good of the whole group, not just for certain individuals. A truly communist society has never existed on a large scale, but the idea of communism has been around for over 150 years.

Learn more about the communism:

https://brainly.com/question/27580633

#SPJ4

how does intuition fit into the larger discussion of ocgnition? what does it mean that the intuition is often implicit

Answers

intuition fit into the larger discussion of cognition through Effortless, immediate, automatic feeling or thought.

One of two forms of cognition for decision making, intuitive cognition, involves judgements and conclusions based on unconscious situational pattern identification.

This type of cognition has a high capacity and quick reactions, and it is independent of conscious "executive" control. Intuitive cognition dominates response generation, accounting for the majority of replies on various reasoning and decision-making tasks.

In certain situations, intuitive cognition is counterproductive (tasks requiring logic). In other circumstances, intuitive cognition is really beneficial (tasks benefiting from exploiting environmental cues).

In numerous experiments, intuitive cognition outperformed analytical cognition under situations that should have benefited analytical cognition because analytical cognition was confronted with tasks it couldn't complete, and intuitive cognition was likely the default system.

learn more about cognitive intuition at https://brainly.com/question/7272441

#SPJ4

True or false: idiomatic pronominal verbs will always show gender and number agreement. True false.

Answers

Answer:

true

Explanation:

How do you classify confidential information?

Answers

Secret, Top Secret, and Top Secret of Particular Importance are the three categories under which information is classified.

Data that is confidential: Access to confidential data requires a specific clearance or authorisation. Social Security numbers, cardholder information, M&A agreements, and other examples of confidential data may be used. Ordinarily, laws like HIPAA and the PCI DSS are in place to protect confidential data.

Under Brazilian Information Access Law, documents are classified into three categories:

ultrassecreto (top secret),

secreto (secret),

reservado (restricted).

A government-issued document classified as top secret (ultrassecreto) may be kept secret for a term of 25 years, which may be extended for an additional 25 years. No document is therefore kept secret for longer than 50 years. The 2011 Information Access Law changed the old norm, which allowed papers to have their classification time length renewed indefinitely while essentially hiding state secrets from the public. This new rule is required. Existing documents are covered retrospectively under the 2011 statute.

Learn more about "confidential information " to visit here;

https://brainly.com/question/15869788

#SPJ4

6 Principles of Internal Control activities

Answers

The six Internal principles of control activities are:

Establishment of responsibilitySegregation of dutiesDocumentation proceduresPhysical controlsIndependent internal verificationHuman resource controls

The procedure known as internal control is intended to guarantee accurate financial reporting, successful and efficient operations, and adherence to relevant laws and regulations. Internal control also includes preventing unlawful use, acquisition, disposal, and theft of assets.

The control environment is influenced by upper-level managers' expectations, notably their control policies, and management style. The implementation of set rules and processes is helped by a strong control environment. A defined organizational structure with capable and reliable personnel, the delegation of authority and responsibility, and management's integrity, ethical principles, and values are all parts of the control environment.

The exact rules and practices management employs to accomplish its goals are known as control activities. Segregation of tasks, proper transaction and activity authorisation, and adequate documentation are among the most crucial control activities.

Learn more about Internal Control activites at

https://brainly.com/question/29607680?referrer=searchResults

The independent variable, the one that is intentionally manipulated, is. The dependent variable, the one that you measure the response in, is.

Answers

Answer:

Mass is the independent variable in Part I, speed is the independent variable in Part II and kinetic energy is the dependent variable for both Parts.

Whta is the independient variable?

The independent variable is the variable in an experiment that isn't changed along with the experimental procedure.

Conversely, the dependent variable is the variable we need to measure and it is modified by experimental conditions.

The independent variable can be considered the cause, whereas the dependent variable is the effect.

In conclusion, mass is the independent variable in Part I, speed is the independent variable in Part II and kinetic energy is the dependent variable for both Parts.

Explanation:

Kinetic energy is the dependent variable for both Parts, while mass is the independent variable for Part I and speed is the independent variable for Part II.

The independent variable is what, exactly?

The variable in an experiment that is not altered by the experimental process is known as the independent variable. In contrast, the variable we must measure and which is altered by the experimental circumstances is the dependent variable.

The dependent variable is the result, whereas the independent variable can be thought of as the cause. In summary, the independent variable in Part I is mass, the independent variable in Part II is speed, and the dependent variable in both Parts is kinetic energy.

Learn more about independent variable Visit: brainly.com/question/82796

#SPJ4

How did Jesus free us from sin?

Answers

Mankind's separation from God is brought about by sin, and Jesus served as the bridge by atoning for our transgressions by dying on a cross.

How was Jesus able to free us from sin?

Jesus is the only and final source of our freedom. His sinless life, which God accepted in place of our sin-tainted lives, sets us free from sin.

As we gaze to Jesus and see him make the price for every sin, we are totally released from the guilt and consequences of our misdeeds.

He didn't come to this planet to be a cute baby in a manger and then a famous person around Christmas. He came to atone for our sins in order to save us from it.

We are redeemed from both Original Sin and our own personal sins through Jesus Christ. By being baptized, we are cleansed of Original Sin, fortified against the power of sin and death, and partake in the redeeming act of Jesus' death and Resurrection.

To know more about bible, refer:

https://brainly.com/question/10090025

#SPJ4

The authors of women's ways of knowing added an earlier stage to perry's four stages of cognitive development. this stage is called _______.

Answers

The authors of women's ways of knowing added an earlier stage to perry's four stages of cognitive development. this stage is called silence..

Constructed knowledge is one of the stages of Perry's cognitive development can be a concept that can be understood as the integration of an individual with the body of knowledge that he previously learned from other people due to personal experience.  People with structured knowledge can integrate knowledge and reflect on their learning.

In this particular question, the fact that the women were able to distinguish whether the question presented was true or false is evidence that the women had built up knowledge of  Perry's stages of cognitive development. Acquisition of knowledge is an active process that occurs through individual or social engagement. This means that educators must provide students with opportunities for social and individual engagement using methods related to  meaning making.

Learn about constructed knowledge:

https://brainly.com/question/14815170

#SPJ4

Which of the following provides the best evidence that race is more of a social construct than a biological category?
answer choices

People of varying ancestry may categorize themselves as having the same race.
Scores on tests of mental abilities vary by race.
Behavior traits are associated with race.
Skin cancer rates vary by race.
The incidence of high blood pressure varies by race

Answers

People of varying ancestry may categorize themselves as having the same race provides the best evidence that race is more of a social construct than a biological category.

What is mean by race ?Race is a social construct that refers to a categorization of people based on certain physical characteristics, such as skin color, eye shape, and facial features. These characteristics are used to group people into categories that are often referred to as "races." However, these characteristics are not necessarily related to genetics or biological differences between people.The fact that people of varying ancestry may categorize themselves as having the same race suggests that race is more of a social construct than a biological category. This is because people may identify as being a certain race based on cultural, historical, or social factors, rather than based on their genetics or biology.

To learn more about race refer :

https://brainly.com/question/28038672

#SPJ4

What technique was used to make traditional pueblo pottery, such as this jar by maría montoya martínez and julian martinez?

Answers

Coiling technique was used to make traditional pueblo pottery, such as this jar by maría montoya martínez and julian martinez.

Coiling is a primary forming technique, which means it is used to create the overall shape of a vessel before other techniques refine it. Coiling is the process of rolling clay into a long, thin sausage-like shape that is wound around like a spring.The Coiling Technique (also known as colombino or lucignolo in Italy) is one of the oldest ways to make objects out of clay. The clay is worked in the form of ropes (called colombini) that are rolled over one another to form the object.

To know more about Coiling here

https://brainly.com/question/13577587

#SPJ4

Mendelssohn helped bring to life a long-forgotten work by __________.

Answers

Mendelssohn contributed to the revival of a long-forgotten composition by J.S. Bach.

It is difficult to imagine that just a little over a century and a half ago, Johann Sebastian Bach's music and reputation languished in obscurity, virtually unknown to everyone but a few specialists. His stature as a composer of such extraordinary genius and wide-ranging influence is so firmly established in Western culture. Mendelssohn's appreciation of Bach's brilliance and his efforts to make his works available to a larger audience led to the works' current status as the pinnacles of musical expression.

Felix Mendelssohn "saving" Bach's music from near oblivion was perhaps inevitable in hindsight given the odd number of coincidences involving the paths that both the Bach and Mendelssohn families' members crossed.

Learn more about " Mendelssohn  " to visit here;

https://brainly.com/question/12965876

#SPJ4

What was yellow journalism known for?

Answers

The term "yellow journalism" typically refers to sensationalistic or biased articles that media promote as the impartial reality.

What is meant by yellow journalism?The term "yellow journalism" refers to news reports that are more concerned with attracting readers' attention than with reporting accurate news.It is undoubtedly yellow journalism when a newspaper headline reads, "ALIENS STEAL NEIGHBORHOOD PUPPIES."The term "yellow journalism" was first used in the famed New York World comic "Hogan's Alley," which featured a character known as "the yellow kid" who wore a yellow outfit. William Randolph Hearst, the proprietor of the rival New York Journal, was determined to compete with Pulitzer's World in every way, so he even adopted his sensationalistic writing style.The story about the U.S.S. Maine being sunk in Havana Harbor was undoubtedly the most important and influential piece of Yellow Journalism.The term that has been highlighted is not at all what is meant by "sinful reporting." The difference between the two is that the former relates to conveying news or information in an authentic, truthful manner, while the latter refers to presenting little to no well-researched reporting. D is the best choice as a result.

To learn more about yellow journalism refer to:

https://brainly.com/question/861070

#SPJ4

ethics is concerned with what we should or should not do, and law is concerned with which of thefollowing?a. what is the greater goodb. what we must or must not doc. how justice is or is not distributedd. when we must or must not be fair

Answers

Ethics is concerned with what we should or should not do, and law is concerned with what we must or must not do.

Two institutions that regulate human behavior are ethics and the law. While ethics are largely unwritten and are left up to the individual doing the deed, the law is defined as written laws and regulations. While ethics is concerned with what we should do and what we shouldn't do, law talks about what we must do and what we must not do.

As an example of law , we shouldn't drive after drinking. We shouldn't lie, as a rule of ethics. Consequently, the appropriate choice is (b).

To learn more about ethics refer here

https://brainly.com/question/13402919#

#SPJ4

To modify your own behavior using operant conditioning principles, you should?

Answers

Rewards and punishments must be used to change one's behavior using the principle of operant conditioning

The basic concept behind operant conditioning is that stimuli (antecedents) lead to actions, which in turn lead to outcomes. This form of conditioning includes both positive and negative reinforcers, as well as primary, secondary, and generalized reinforcers. The main reinforcement elements are food, shelter, water, etc. Skinner is based on the idea that learning is a function that changes apparent behavior. Behavioral changes are the result of an individual's response to events (stimuli) occurring in the environment. The response produces results similar to the following: B. Define a word, hit a ball, or solve a math problem. The main difference between classical and operant conditioning is that classical conditioning associates involuntary actions with stimuli whereas operant conditioning associates voluntary actions with outcomes. Classical and operant conditioning are two central concepts in behavioral psychology.

To know more about operant conditioning visit:

https://brainly.com/question/13044823?referrer=searchResults

#SPJ4

Why did God give us with freedom?

Answers

Answer:

because he loved us enough to put himself on the cross and die for our sins and so we could have freedom and forgiveness because when he came to earth and got older he knew he was here to save us all

Explanation:

Item A
Right Realist theories have had a significant influence on government policy, especially
because they appear to offer practical answers to the problem of crime. Like many
in later life. they focus on the idea that some people are naturally more aggressive or
sociologists, they see childhood experiences as very important in determining behaviour
less intelligent than others, and they stress the need to ensure the crime does not go
unpunished.
1. Applying material from item A, analyse two explanations for the causes of crime put
forward by the right realists. [10]

Answers

From a consequentialist ethical point of view and based on the autonomy of politics, realism tries to explain how the satisfaction of predetermined national interests in an anarchic world is achieved.

What is the primary focus of the right realist perspective on how to combat criminal activity?

Right realists agree with functionalists like Travis Hirschi that close-knit communities and strong social bonds help prevent crime. They argue that in order to maintain social order and community cohesion, even minor crimes must be dealt with severely through policies like zero tolerance.

According to right realism, what causes crime?

Right realists hold that there are six factors that contribute to crime: the deterioration of society's moral fabric; a growing British underclass; a deterioration of social order; a chance for crime, as well as the fact that some people choose to commit crime with good reason.

To learn more about Right realists here

https://brainly.com/question/14435633

#SPJ1

At the time it was painted, rachel ruysch’s fruit and insects would have been displayed in a:_________

Answers

Fruit and Insects by Rachel Ruysch would have been on view in a monastery's dining hall.

Since 1753, Still-life with Fruit, Flowers, and Insects (1711) has been on view in Florence's Uffizi Gallery.

In pictures, horizontal lines frequently evoke a sense of serenity. Vertical lines frequently convey a sense of steadiness. In general, diagonal lines give the impression of dynamic movement. The exact tools an artist uses, such as oil and a brush, as well as the final product, such as a sculpture, painting, or photograph, are referred to as the medium.

A wingless, silverfish-like organism that existed around 385 million years ago is represented by the oldest insect fossil that has been verified. Insect fossils are not common until roughly 60 million years later, during the Pennsylvanian period of Earth's history.

Learn more about " Fruit and Insects " to visit here;

https://brainly.com/question/20612808

#SPJ4

Which of the following statements accurately describes the natural history of a disease?

A. Predicting whether an individual will recover from a given disease.
B. All of the answers given are correct
C. Describing the amount of a disease occurring in a population by the population s characteristics (age, geographic location, time)
D. A description of the progression of a disease from the first symptom to recovery or death.

Answers

Correct option D - A description of a disease's course from the appearance of its first symptom until it is either fully treated or leaves the body on its own.

The term "natural history of disease" describes how a disease develops in a person over time in the absence of treatment. As an illustration, untreated HIV infection results in a range of clinical issues starting at the time of seroconversion (primary HIV) and ending with AIDS and typically death.

It is now understood that AIDS might take up to 10 years to manifest following seroconversion. (43) Even while the duration and precise disease manifestations might vary from person to person and are impacted by preventive and therapeutic interventions, many, if not most, diseases have a recognizable natural history.

Learn  more about "natural history of disease" to visit here;

https://brainly.com/question/14568610

#SPJ4

What is the gender gap?

Answers

Answer: The answer is A

Explanation:

What is the measurement of each angle and their intercepted arcs?

Answers

The intercepted arc's measure and the center angle are same. The intercepted arc is the same angle as the central angle, which is 30 degrees in this case.

Which intercepted arcs are congruent?

Chord Arcs Theorem, Congruent intercepted arcs are those between two chords in a circle that are identical. Directly opposite a Chord Theorem The chord's bisector is defined as the line perpendicular to a circle's center.

Does the intercepted arc equal the inscribed angle by two?

The central angle that intercepts it, which is how we define the arc angle, is a measure. A conjecture involving inscribed angles The relation between an inscribed angle's measurements and the intercepted arc angle is provided in this paragraph. The intercepted arc's size is stated to be as follows.

To learn more about Chord Theorem here:

https://brainly.com/question/23732231

#SPJ4

The map shows the location of Texas in relation to the surrounding geography.

A map of the bottom half portion of the United States.

Which statements about the relative location of Texas are accurate? Check all that apply.

Texas is south of Oklahoma.
Texas is west of New Mexico.
Texas is bordered by Mexico to the south.
Texas is on the Pacific coast.
Texas is along the Gulf of Mexico.
Texas is west of Louisiana.
Texas is north of Arkansas.

Answers

Texas  is to the East of New Mexico and South West of Arkansas. Therefore the correct response to the question is options (1),(3),(4),((5),(6)

Where is Texas located?

The state of Texas is located in the South Central part of the country. In 1845, it was admitted as the Union's 28th state. Texas, popularly known as the "Lone Star State," is well-known for its barbecue, live music, and scorching weather. Texas is one of the states in the US with the quickest growth. Texas is bordered to the east by Louisiana, to the northeast by Arkansas, to the north by Oklahoma, to the northwest by New Mexico, to the south by Mexico, and to the southeast by the Gulf of Mexico.

The following are factual statements about Texas's relative position.

South of Oklahoma is Texas.Mexico borders Texas on its southern side.On the Pacific Coast is Texas.Along the Gulf of Mexico is Texas.West of Louisiana is Texas.

To know more about Texas, visit:

https://brainly.com/question/14968290

#SPJ1

Answer:

a,c,d,e,f

Explanation:

What was one of the results of the Schenck decision?

Answers

United States, 249 U.S. 47 (1919) The speaker is not protected by the First Amendment from government action if speech is intended to result in a crime and there is a clear and present danger that it will.

What were the consequences of the Schenck decision's removal of protections?

In Schenck v. United States (1919), the Supreme Court decided that the First Amendment does not protect speech that poses a "clear and present danger." This decision exemplifies the ways in which the Supreme Court's interpretation of the First Amendment sometimes necessitates sacrificing individual liberties to maintain social order.

What was the outcome of the Schenck v. United States 1919 case?

Holmes came to the conclusion that the First Amendment does not protect speech that approaches creating a clear and present danger of a significant evil that Congress has the power to prevent by articulating for the first time the "clear and present danger test."

To learn more about First Amendment here:

https://brainly.com/question/1078243

#SPJ4

Based on research, if a child is rarely touched and held during the first few months and years of life, his or her behavior as an adult is MOST LIKELY affected in what way?
a. The person would be less likely to engage in violent behavior as an adult.
b. The person would be more likely to be intellectually focused as an adult.
c. The person would be more likely to want to touch and be touched than the average person.
d. The person would be more likely to have difficulty establishing intimate relationships.

Answers

According to study, a child's conduct in forming intimate relationships as an adult is most likely impacted if they are not frequently held and touched during their first few months and years of life. The right answer is d.

The ability to form emotional attachments later in life depends on how strong these relationships are now. Where do infants come from is a common question among 4 to 5 year olds. They are able to comprehend that a baby develops in the uterus and that an ovum and sperm (which resemble small seeds) are required to create a child (like a tiny egg). Even in newborns, the sense of smell is so well developed that some babies as early as 12 to 18 days old can recognize their mothers just by smell. When we ask kids questions, especially big, open-ended ones, we encourage both their language and critical thinking growth. They can be encouraged to introduce themselves, discuss the tools they are using, their thoughts, and their reflections.

To learn more on relationships, visit:

https://brainly.com/question/10260665

#SPJ4

a widely accepted scientific idea usually is based on: group of answer choices results of one experiment or observation that refuted old ideas and supported the correctness of the new idea. received wisdom from sacred books. an interlocking web of important experimental results or observations that support the correctness of the idea. socially conditioned ideas of scientists without reference to observatio

Answers

A widely accepted scientific idea usually is based on: An interlocking web of important experimental results or observations that support the correctness of the idea.

What current aspects of the scientific theory of evolution are true?

It is successfully used in the real world in a variety of contexts, such as in the battle against emerging pathogens and even in the way computer scientists think.

They are more usually found for those broad categories of living things (such shelled shallow-water organisms) that frequently create fossils than for other general types of living things.

The synthetic theory of evolution, commonly known as Neo-Darwinism or the modern notion, is the evolution theory that is most widely accepted. This hypothesis postulates that genetic variety and natural selection interact to cause the emergence of new species.

To know more about scientific theory of evolution, refer:

https://brainly.com/question/14835829

#SPJ4

Other Questions
Samantha and Luis are attempting to dentermine the average number of library books that seventh-grade students check out at one time. Samantha surveys every other seventh grade students GIVING BRAINLIEST PLEASE HELP!!-if you answer correctly ill give you brainliest which will give you 23pts- what is parallel to y=5x + 3 virtual libraries present new paradigm for learning in school library change that sentence to present continuous tense How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT help please !! i need help The area of a rectangle is 46 square inches. If the length is 4 times the width, thon findthe dimensions of the rectangle. Round off your answers to the nearest hundredth Nicole had 8 correct answers on her math test. There were 20 total questions. Enter the percent of the correct answers Nicole had. What is the slope of the line below?The image is a graph of an x-axis and a y-axis. A line is drawn which passes through the points (2,3) and (-2,-7). A. 5 B. 0.2 or 15 C. 2.5 or 52 D. 0.4 or 25 which inequality is true? lol please do it correctly, brainliest if right please dont post links no bots A city has a population of 340, 000 people. Suppose that each year the population grows by 3.75%. What will the population be after 10 years ? Use the calculator provided and round your answer to the nearest whole number. Complete the proof.Given: ABBP=CBBMProve: CBA~PBM Below shows a process that occurs in cells. The type of building blocks represented by the letters A, B, and C in this process are:A: NucleotidesB: CodonsC: Amino AcidsD: Nitrogen bases Why do you think superstitions and conspiracies are so powerful? Explain. A kicked soccer balleventually comesto rest. Whatforce causesthis?ce find the square rootV 196 please help me with this question Refer to You Should Meet Katherine Johnson for a complete version of this text.What is the overall structure of You Should Meet Katherine Johnson?Comparison, because Katherines accomplishments are compared with other figures in space history.Problem and solution, because Katherines ability to answer questions using math are described.Chronological, because the important events of Katherines life are presented in order.Cause and effect, because the effects of Katherines life decisions are examined in detail. The measure of ABD is (0.18x+56) and the measure of CBD is (0.07x+46). Find the value of x.