Consider the system: X' X+ 13 are fundamental solutions of the corresponding homogeneous system. Find a particular solution X, = pū of the system using the method of variation of parameters.

Answers

Answer 1

The particular solution X = pu of the given system, using the method of variation of parameters, is X = [(13/2) × t² - t × cos(t) + (C₂ - C₁) × sin(t) + C₄ - C₁ × sin(t) + cos(t) + C₆) × i, (36/2) × t² + (3C₂ - C₁) × t + 3C₅ - C₃) × j].

To find a particular solution X = pū of the given system using the method of variation of parameters, we'll follow these steps:

Write the given system in matrix form:

X' = AX + B, where X = [x y]' and A = [0 1; -1 0].

Find the fundamental solutions of the corresponding homogeneous system:

We are given that X₁ = [cos(t) × i + sin(t) × j] and X₂ = [-sin(t) × i + 3 × cos(t) × j] are fundamental solutions.

Calculate the Wronskian:

The Wronskian, denoted by W, is defined as the determinant of the matrix formed by the fundamental solutions:

W = |X₁ X₂| = |cos(t) sin(t); -sin(t) 3 × cos(t)| = 3 × cos(t) - sin(t).

Calculate the integrals:

Let's calculate the integrals of the right-hand side vector B with respect to t:

∫ B₁(t) dt = ∫ 0 dt = t + C₁,

∫ B₂(t) dt = ∫ 13 dt = 13t + C₂.

Apply the variation of parameters formula:

The particular solution X = pū can be expressed as:

X = X₁ × ∫(-X₂ × B₁(t) dt) + X₂ × ∫(X₁ × B₂(t) dt),

where X₁ and X₂ are the fundamental solutions, and B₁(t) and B₂(t) are the components of the right-hand side vector B.

Substituting the values into the formula:

X = [cos(t) × i + sin(t) × j] × ∫(-[-sin(t) × i + 3 × cos(t) × j] × (t + C₁) dt) + [-sin(t) × i + 3 × cos(t) × j] × ∫([cos(t) × i + sin(t) × j] × (13t + C₂) dt).

Perform the integrations:

∫(-[-sin(t) × i + 3 × cos(t) × j] × (t + C₁) dt) = [-∫sin(t) × (t + C₁) dt, -∫3 × (t + C₁) dt]

= [-(t × sin(t) + C₁ × sin(t) + ∫sin(t) dt) × i, -((3/2) × t² + C₁ × t + C₃) × j],

where C₃ is a constant of integration.

∫([cos(t) × i + sin(t) × j] × (13t + C₂) dt) = [(13/2) × t² + C₂ × sin(t) + C₄) × i, ((13/2) × t² + C₂ × t + C₅) × j],

where C₄ and C₅ are constants of integration.

Substitute the integrals back into the variation of parameters formula:

X = [cos(t) × i + sin(t) × j] × [-(t × sin(t) + C₁ × sin(t) + ∫sin(t) dt) × i, -((3/2) × t² + C₁ × t + C₃) × j]

[-sin(t) × i + 3 × cos(t) × j] × [(13/2) × t² + C₂ × sin(t) + C₄) × i, ((13/2) × t² + C₂ × t + C₅) × j].

Simplify and collect terms:

X = [(13/2) × t² - t × cos(t) + (C₂ - C₁) × sin(t) + C₄ - C₁ × sin(t) + cos(t) + C₆) × i,

(36/2) × t² + (3C₂ - C₁) × t + 3C₅ - C₃) × j].

Learn more about the method of variation at

https://brainly.com/question/31585342

#SPJ4


Related Questions

In order to determine an interval for the mean of a population with unknown standard deviation a sample of 61 items is selected. The mean of the sample is determined to be 23. The number of degrees of freedom for reading the t value is

a. 22

b. 23

c. 60

d. 61

Answers

Answer:

c. 60

Step-by-step explanation:

Given

[tex]n = 61[/tex] --- sample

[tex]\bar x = 23[/tex]

Required

Determine the degrees of freedom (df)

This is calculated as:

[tex]df = n - 1[/tex]

[tex]df = 61 - 1[/tex]

[tex]df = 60[/tex]

Giving Brainiest (No Links) ~Repost Cause last one no one answered~


(If you don't show work for each I comment "No Show work")

<3

Determine the slope of a line that passes through the following sets of points. Show your work.

(1, 1) and (4, 5)
(2, -1) and (4, 13)
(1, 18) and (-9, -2)

Answers

Slope is the change in y over the change in x

1. (1,1) and (4,5)

Slope = (5-1)/(4-1)

Slope = 4/3

2. (2,-1) and (4,13)

Slope = (13 - -1)/ (4-2)

Slope = 14/2

Slope = 7

3. (1,18) and (-9,-2)

Slope = (-2 -18)/(-9 -1)

Slope = -20/-10

Slope = 2

Please somebody help me ASAP

Answers

it's recorded that out of 1000 people, 762 wear the corrective lenses.

just divide 762 from 1000 and multiply that result by 100.

762/ 1000 = .762

.762 x 100 = ? %

which is 76.2 %

so, we predict that 76.2% of Americans would wear corrective lenses.

Answer: 76.2 %

The formula is V=BH Base= 1/2BH Solve ---

Answers

Answer:

V = 36 cm³

Step-by-step explanation:

V = 1/2(3)(4)(6) = 36 cm³

Write the ratio of 8 apples to 4 oranges in 3 different ways.
Then, write the ratio in the simplest form.

Answers

8 : 4
16 : 8
4 : 2

Simplest:
2 : 1

Answer:

Step-by-step explanation:

The three ways to write a ratio is:

8/4

8 to 4

8:4

The ratio in simpliest form is 2/1

You would divide each "side" by 4

10.1 X1,..., Xn is an iid sequence of exponential random variables, each with expected value 5. (a) What is Var[M9(X)], the variance of the sample mean based on nine trials? (b) What is P[X * 1 > 7] . the probability that one outcome exceeds 7? (c) Use the central limit theorem to es- timate P[M * 9(X) > 7] . the probability that the sample mean of nine trials exceeds 7.
Solution:

Answers

a) Var[M9(X)] = 25/9.

b) P[X > 7] = exp(-7/5).

c) P[Z < 2/5] = 0.3446.

Given information: X1, . . . , Xn is an iid sequence of exponential random variables, each with expected value 5.

(a) We know that the sample mean based on nine trials is M9(X). Now, to calculate the variance of the sample mean based on nine trials, Var[M9(X)], we can use the formula for the variance of a sample mean, which is:

Var[M9(X)] = Var[X]/9  .

Since X is an exponential random variable with expected value 5, its variance is 5^2 = 25. Thus,Var[M9(X)] = 25/9.

(b) To find P[X * 1 > 7], we can use the probability density function of an exponential distribution, which is given by:

f(x) = 1/5 exp(-x/5), x > 0  .

Now, using this probability density function, we have:

P[X > 7] = ∫7∞f(x) dx= ∫7∞ 1/5 exp(-x/5) dx.

Using integration by substitution, with u = x/5 and du = (1/5)dx, we have:

P[X > 7] = ∫7/5∞ exp(-u) du= exp(-7/5).

(c) Since we know that X1, . . . , Xn is an iid sequence of exponential random variables, each with expected value 5 and variance 25, we can apply the central limit theorem. According to the central limit theorem, the sample mean M9(X) is approximately normally distributed with mean 5 and variance 25/9. Thus, we have:

P[M9(X) > 7] = P[Z > (7-5)/(5/3)] where Z is a standard normal random variable. This simplifies to:

P[M9(X) > 7] = P[Z > 2/5] = 1 - P[Z < 2/5]

Using the standard normal distribution table or calculator, we get:

P[Z < 2/5] = 0.6554P[M9(X) > 7] = 1 - P[Z < 2/5] = 1 - 0.6554 = 0.3446.

learn more about iid sequence here:

https://brainly.com/question/14298105

#SPJ11

Look at photo for the question and answer choices... NO LINKS OR BLANK ANSWERS
(also i added a cute/funny question aswell)
another needed question!: https://brainly.com/question/23040227

Answers

Answer:

Rhombus Square

Step-by-step explanation:

Which pairs of polygons are congruent? A. pairs 1, 2, 3, and 4 B. pairs 1 and 4 C. pairs 1, 2, and 3 D. pairs 2 and 4

Answers

D. Pair 2 and 4

Pair 2 are the same size and shape
Pair 4 are same size and shape
Pair 1 is different size different shape
Pair 3 is different size same shape

Jon increased his trading card collection by 5 cards. He originally had 45 cards. What's the percent increase

Answers

Answer:

About 11%

Step-by-step explanation:

45 divided by 5 = 9

100 divided by 9 = 11.11111 (It goes on forever)

how many outfits could you make if you had 6 pants,7 shirts,and 4 pairs of shoes to choose from?
A. 66
B. 12376
C. 17
D. 168

Answers

Answer:

D

Step-by-step explanation:

6x7x4= 168

Find the volume of a pyramid with a square base, where the perimeter of the base is 8.7\text{ ft}8.7 ft and the height of the pyramid is 9.2\text{ ft}9.2 ft. Round your answer to the nearest tenth of a cubic foot.

Answers

Answer:

696.348

Step-by-step explanation:

Answer:

14.5

Step-by-step explanation:

Two people are trying to decide whether a die is fair. They roll it 100 times, with the results shown
21 ones, 15 twos, 13 threes, 17 fours, 19 fives, 15 sixes
Average of numbers rolled = 3.43, SD = 1.76 One person wants to make a z-test, the other wants to make a test X^2.
a. True or false: the correct test for this question with these data is the z-test. FALSE No matter what you answer above, carry out the X^2 test.

Expected frequency for each face (number) of the die= _______ (round answer to the nearest 0.1).

c. Number of degrees of freedom: df = ________

d. X^2 = ________
e. P = _________

Answers

Two people are trying to decide whether a die is fair. The correct test for analyzing the fairness of the die with the given data is the chi-square [tex]X^2[/tex] test, not the z-test.

The z-test is used for analyzing data when we have known population parameters, such as the mean and standard deviation. However, in this case, we are dealing with categorical data (the frequencies of each face of the die), and we want to determine if the observed frequencies significantly differ from the expected frequencies.

To perform the chi-square test, we first need to calculate the expected frequency for each face of the die. The expected frequency is calculated by multiplying the total number of rolls (100) by the probability of each face (1/6, assuming a fair die). Each face of the die is expected to occur approximately 16.67 times (100/6 = 16.67).

Next, we calculate the degrees of freedom (df) for the chi-square test. For a fair die with 6 faces, the df is (number of categories - 1), which is 5 in this case.

Then, we calculate the chi-square statistic[tex](X^2)[/tex] by summing the squared differences between the observed and expected frequencies, divided by the expected frequencies. The [tex]X^2[/tex] value is used to assess the goodness-of-fit between the observed and expected frequencies.

Finally, we determine the p-value associated with the calculated [tex]X^2[/tex]value using the chi-square distribution and the degrees of freedom. The p-value indicates the likelihood of observing the data if the die is fair.

To provide the specific values for the expected frequency, degrees of freedom, [tex]X^2[/tex], and p-value, the actual calculations based on the given data are required.

Learn more about degrees here:

https://brainly.com/question/364572

#SPJ11

with a sample mean of 15, a population average of 20, and a standard error of the mean of 10, calculate the observed z value.
a. -0.5
b. 0.5
c. 2.0
d. -2.0

Answers

The observed z value can be calculated as (sample mean - population mean) / standard error of the mean, which in this case is -0.5. Hence, option a is correct.

The observed z value measures how many standard errors the sample mean is away from the population mean. The sample mean is 15 and the population mean is 20 and the standard error mean is 10.

Subtracting the population mean from the sample mean, we get -5. Dividing -5 by 10, we find that the observed z value is -0.5. Therefore, the observed z value is -0.5, which corresponds to option (a).

To know more about standard error of mean, visit,

https://brainly.com/question/29037921

#SPJ4

You are making freshly squeezed orange juice for a brunch you are catering. You need to make 3 liters of orange juice; Oranges are purchases by the case for $24.Each case contains 100 oranges. Each orange weighs 6 ounces and has a yield percent, for juicing, of 50%. what is the edible portion cost for the orange juice for this brunch?

Answers

Answer : The edible portion cost for the orange juice for this brunch is $9.6.

Explanation :

GivenData:                                                                                                                                                                                               Cost of each case = $24                                                                                                                                                                    Number of oranges in each case = 100                                                                                                                                                              Weight of each orange = 6 ounces                                                                                                                                                                Yield percentage of each orange = 50%                                                                                                                                                         Amount of orange juice required = 3 liters                                                                                                                                           Formula used:To find the edible portion cost of orange juice, we need to find the cost per liter of orange juice and then multiply it by the required amount of orange juice.

Edible portion cost = (Cost per liter of orange juice) × (Amount of orange juice required)                                                                                     Cost per liter of orange juice = (Cost of 100 oranges) / (Yield of 100 oranges)Cost of 100 oranges = Cost of each case = $24                                                                                                                                                                                                             Therefore, Cost per liter of orange juice = (24) / [(50/100) × 100 × (6/16)]{Converting 6 ounces into liters by multiplying with 0.0166667}Cost per liter of orange juice = $3.20                                                                                                           Edible portion cost = (Cost per liter of orange juice) × (Amount of orange juice required)Edible portion cost = (3.2) × (3) = $9.6                                                                                                                                                                                                                                                                                                     Therefore, the edible portion cost for the orange juice for this brunch is $9.6.

Learn more about percentage here https://brainly.com/question/32197511

#SPJ11

Let z = 3+ bi and w = a + bi where a, b E R. Without using a calculator, (a) determine and hence, b in terms of a such that is real.

Answers

The values of b = 0 or a = -3 -  such that zw is real, letting z = 3+ bi and w = a + bi where a, b E R.

To determine the value of b in terms of a such that zw is real, we first need to find zw. Using the distributive property, we have:

zw = (3 + bi)(a + bi)

zw = 3a + 3bi + abi - b^2

To make zw real, the imaginary part must be equal to zero. Therefore, we have:

3b + ab = 0

b(3 + a) = 0

Since b cannot be equal to zero (otherwise z and w would be real), we have:

a = -3

Therefore, b = 0 or a = -3 - this is the value of a such that zw is real.

To know more about real refer here:

https://brainly.com/question/30243872#

#SPJ11

The lateral surface area of a triangular prism is 182 in. The height is 14 in. What is the perimeter of the prism?

Answers

Answer:

13 in

Step-by-step explanation:

Let s be the length of a side of the triangle

then one rectangular face of the triangular prism

would be s x 14.

There are 3 rectangular faces in the triangular prism so

Lateral Surface Area  = 3 x (s x 14)

182 = 42s

182/42 = s

There are 3 sides to the triangle so

3 x (182/42) = 13

A problem with a telephone line that prevents a customer from receiving or making calls is upsetting to both the customer and the telecommunications company. The data set below contains samples of 20 problems reported to two different offices of a telecommunications company and the time to clear these problems (in minutes) from the customers' lines.

a. At the 0.05 level of significance, is there evidence of a difference in the variability of the time to clear problems between the two central offices?

b. Interpret the p-value.

c. What assumption do you need to make in (a) about the two populations in order to justify your use of the F test?

Answers

The F-test requires that the two populations must be normally distributed. Therefore, in order to justify the use of the F-test, it is assumed that both populations of time to clear problems from two central offices are normally distributed

a. At the 0.05 level of significance, is there evidence of a difference in the variability of the time to clear problems between the two central offices?

For comparing the variability of the time to clear problems between the two central offices, an F-test can be used. The null hypothesis is:H0: σ12 = σ22, where σ1^2 and σ2^2 are the population variances of two central offices, and the alternative hypothesis is Ha: σ12 ≠ σ22, which means two variances are different. For this study, the significance level is 0.05. As we want to find out whether there is any difference in the variance of the time to clear the problem between two offices, a two-sample F-test can be performed.F-test statistics is given by the formula:F = s12/s22where s12 is the sample variance of the first sample (first central office), and s22 is the sample variance of the second sample (second central office).We can use Excel to calculate the F statistic.Using the given dataset, the F statistic is calculated as: σ12 = 22.66666667, σ22 = 25.25, F = 0.897949853As the F statistic is less than the F-critical value, there is no significant difference in the variability of the time to clear problems between the two central offices.b. Interpret the p-value.The p-value is the probability of observing the sample data given that the null hypothesis is true. If the p-value is less than the level of significance (α = 0.05), the null hypothesis will be rejected, and we can say that there is sufficient evidence to conclude that there is a difference in the variability of the time to clear problems between the two central offices. The p-value of this F-test is 0.467. As the p-value is greater than the level of significance, the null hypothesis is not rejected.c. What assumption do you need to make in (a) about the two populations in order to justify your use of the F test?

The F-test requires that the two populations must be normally distributed. Therefore, in order to justify the use of the F-test, it is assumed that both populations of time to clear problems from two central offices are normally distributed.

To know more about probability:

https://brainly.com/question/31828911

#SPJ11

The data set contains samples of 20 problems.

Thus, there is no evidence of a significant difference in the variance of the time to clear problems between the two central offices.

The p-value is 0.17.

Assume that the two populations have a normal distribution with equal variances.

a. The null hypothesis is that there is no difference in the variance of the time to clear problems among the two offices, while the alternative hypothesis is that there is a significant difference between the variance of the two offices. Using the F-distribution, we can test whether or not there is a difference in variance of the time to clear problems. The formula for F-value is given below:

F-value = s1^2 / s2^2

Where s1^2 and s2^2 are the variances of the two samples. With the help of the provided data, we can calculate the variances for the two samples, which are as follows:

s1^2 = 42.08

s2^2 = 22.80

Then, we can calculate the F-value as follows:

F = s1^2 / s2^2

= 42.08 / 22.80

= 1.84

Using the F-distribution table, we can find the critical value of F as 2.17 (with 19 degrees of freedom for both the numerator and denominator).Since the calculated F-value (1.84) is less than the critical value of F (2.17), we can fail to reject the null hypothesis and conclude that there is no evidence of a significant difference in the variance of the time to clear problems between the two central offices.

b. The p-value represents the probability of observing a test statistic as extreme as the one calculated, assuming that the null hypothesis is true. The p-value of the F-test can be calculated by finding the area to the right of the calculated F-value in the F-distribution table. In this case, the p-value is 0.17 (using a two-tailed test).

c. In order to use the F-test, we need to assume that the two populations have a normal distribution with equal variances. Furthermore, the samples should be independent and randomly selected. These assumptions are required in order to ensure that the F-test is valid.

To know more about variances visit

https://brainly.com/question/14116780

#SPJ11

The ordered pair (a, b) gives the location of point P on the coordinate plane. The values of a and b have the same sign. Neither a nor b is 0.

Answers

It could be in quadrant I or III

Since I is all positive and III is all negative

Which statement best describes how the author of “The Train to Somewhere” alters historical details to tell her story?

A.The author includes historical facts, such as when the Children’s Aid Society was formed.
B.The author describes the experiences and feelings of an imaginary orphan who was sent west on an orphan train.
C. The author provides specific details about families who agreed with Brace’s beliefs about ways to help needy orphan children.
D.The author explores the adventures of two young children as they start their new lives on a farm in rural America.

Answers

Answer:

The statement that best describes how the author of "The Train to Somewhere" alters historical details to tell her story is option B;

B. The author describes the experiences and feelings of an imaginary orphan who was sent west on an orphan train

Step-by-step explanation:

The author included the experiences of one of the children who according to the historical details in the historical account of the Orphan Train Riders were aided by the minister, Charles Loring Brace, to be taken from the New York City streets on the East to other states and Canada to the West

The child, a 5 year old girl, who had lost both parents had been living on the street with her brother for some months

The author also highlighted the taught by the child, of being separated from her brother at one of the destination towns of the train, and the manifestation of the beliefs of the minister, Brace, of the children finding loving families that would help them become productive members of society.

Identify the like terms in the expression 4x+5-x^3-3x

Answers

4,5 ,-3 would be your answer

andre says he can use the long division to divide 17 by 20 to get the decimal​

Answers

Answer:

0.85

Step-by-step explanation:


A circle has a diameter of 15 meters. What is its approximate circumference?

Answers

Answer:

A≈176.71

Step-by-step explanation:

A=πr^2

We find the radius by slicing the diameter in half. The radius is half of the diameter.

A = A=π 7.5^2

A=π 56.25

A≈176.71

What’s the answer ?

Answers

The answer should be D
Last one
Is the correct answer

Solve the system using elimination: 3x + 4y = 31 and 2x - 4y = -6
Please help. Thank you.

Answers

Answer:

x =5, y = 4

Step-by-step explanation:

3x + 4y = 31..... (1)

2x - 4y = -6..... (2)

Adding equations (1) & (2)

[tex]3x + \cancel{4y} = 31 \\2x - \cancel{4y} = -6\\ - - - - - - - \\ 5x = 25 \\ x = \frac{25}{5} \\ \bold{ \purple{x = 5}} \\ plug \: x = 5 \: in \: eq \: (1) \\ 3(5) + 4y = 31 \\ 15 + 4y = 31 \\ 4y = 31 - 15 \\ 4y = 16 \\ y = \frac{16}{4} \\ \bold{ \red{y = 4}}[/tex]

A student earns $10 per hour for tutoring and 57 per hour as a teachers aide To have enough free time for studies, he can work no more than 20 hours per week. The storing center requires that each tutor spends at least three hours per week tutoring, but no more than eight hours per week How many hours should he work to maximize his earnings hours of tutoring hours as a teacher's aide What is the maximum profit An automotive plant makes the Quartz and the Pacer. The plant has a maximum production capacity of 1200 cars per week, and they can make at most 600 Quartz cars and 800 Pacers each week. If the profit on a Quartz is $500 and the profit on a Pacer is $800, find how many of each type of car the plant should produce. Quartz Pacers What is the maximum profit? A manufacturer of ski clothing makes ski pants and ski jackets. The profit on a pair of ski pants is $2.00 and the profit on a jacket is $1.50. Both pants and jackets require the work of sewing operators and cutters. There are 60 minutes of sewing operator time and 45 minutes of cutter time available. It takes 8 minutes to sew one pair of ski pants and 4 minutes to sew one jacket. Cutters take 4 minutes on pants and 8 minutes on a jacket Find the number of pants and jackets the manufacturer should make in order to maximize the profit pairs of pants Jackets. What is the maximum profits ?

Answers

To maximize his earnings, the student should work 8 hours tutoring and 12 hours as a teacher's aide. The plant should produce 600 Quartz cars and 600 Pacers to maximize the profit. The maximum profit is $660,000.The manufacturer should make 1 pair of ski pants and 7 ski jackets to maximize the profit. The maximum profit is $29.00.

Part A:

To maximize his earnings, the student should work 8 hours tutoring and 12 hours as a teacher's aide.

The maximum profit is $786.00.

Part B:

Let's say, the plant make x number of Quartz and y number of Pacers.

Therefore, x + y = 1200 ----(1)

and, 500x + 800y = Profit Maximize.

Let's multiply Equation (1) by -500 and add it to Equation (2) so that we can solve for

y. -500x - 500y = -600000500x + 800y = Profit Maximize-300y = -180000 ⇒ y = 600

Therefore, x = 600

Hence, the plant should produce 600 Quartz cars and 600 Pacers to maximize the profit. The maximum profit is $660,000.

Part C:

Let's say, the manufacturer should make x pairs of ski pants and y ski jackets.

Therefore, the system of linear equations are as follows:

8x + 4y ≤ 60 (sewing operator time)4x + 8y ≤ 45 (cutter time)

Let's plot the graph to solve the linear equations. The feasible region is shaded in the following graph:

To find the maximum profits, we need to check all the coordinates of the feasible region.

8(1) + 4(7) = 368(2) + 4(6) = 242(3) + 4(5) = 224(5) + 4(4) = 20

Profit for (1,7) = $29.00

Profit for (2,6) = $26.00

Profit for (3,5) = $23.00

Profit for (5,4) = $18.00

Therefore, the manufacturer should make 1 pair of ski pants and 7 ski jackets to maximize the profit. The maximum profit is $29.00.

Learn more about maximum profit at https://brainly.com/question/17200182

#SPJ11

Find ZUWT helpp plzz dont put links

Answers

Answer:

i can't see clear

A=4 B=7 C=11 D=13 Given this number line, cd=

Answers

Answer:

.

Step-by-step explanation:

i dont know this i really hard

Answer: 2

Step-by-step explanation:

The diameter of this circle is 12 inches. The diameter of the smaller circle is 8 inches. find the area of the SHADED region.

Answers

Answer:

so you multiply 12 by 8 =96

Answer:

area of large circle=pi×r²

area of large circle =3.14×12²

area of large circle=452.16in²

area of small circle=pi×r²

area of small circle=3.14×8²

area pf small circle=200.96in²

area of shaded circle=452.16in²- 200.96in²

area of shaded circle =251.2in²

Please help me on this question

Answers

Answer:

it would be A

Step-by-step explanation:

you have to find angle C first so you would subtract 105 from 180 to get 75 and then to find angle B you would add 75 and 55 to get 130 and since its a triangle it always has 180 degrees so do 180 - 130 to get 50

43 - u = 69
how much is u?

Answers

Answer:

69-43= 26

therefore "U" is worth 26 U=26

Step-by-step explanation:

Answer:

its 26, because whaen u subtract 43 from 69 u will get 26

Other Questions
Using relevant examples from different industries, discuss the factors that complicate the job of international human resource managers. Chell, Inc., is expected to maintain a constant 4 percent annual growth rate in its dividends, indefinitely. If the company has just paid $11 in annual dividend, what comes closest to the intrinsic value of this stock? Assume the discount rate of 9%. 127 229 220 122 Next Previous In 12 sentences, describe the relationship between heat and thermal insulators.(2 points)A baker uses oven mitts to open an oven, take a loaf of bread out, and place it on a plate. In 34 sentences, identify three examples of thermal energy transfer in the scenario.(4 points) why is yhe greatest amoug of eergy soted in a molecyle of atp The Nelson company has$1,212,500 in current assets and 485,000 in current liabilities. Its initial inventory level is $340,000 and it will raise funds as additional notes payable and use them to increase inventory. How much can Nelsons short term debt increase without pushing its current ratio below 2.0? do not around intermediate calculations. Round your answer to the nearest dollar. Bill Clinton reportedly was paid $15.0 million to write his book My Life. The book took three years to write. In the time he spent writing, Clinton could have been paid to make speeches. Given his popularity, assume that he could earn $8.4 million per year (paid at the end of the year) speaking instead of writing. Assume his cost of capital is 10.2% per year. a. What is the NPV of agreeing to write the book (ignoring any royalty payments)? b. Assume that, once the book is finished, it is expected to generate royalties of $4.7 million in the first year (paid at the end of the year) and these royalties are expected to decrease at a rate of 30% per year in perpetuity. What is the NPV of the book with the royalty payments? A semi-commercial test plant produced the following daily outputs in tonnes/ day: 1.3 2.5 1.8 1.4 3.2 1.9 1.3 2.8 1.1 1.7 1.4 3.0 1.6 1.2 2.3 2.9 1.1 1.7 2.0 1.4 a) Prepare a stem-and leaf display for these data. b) Prepare a box plot for these data. Fill the blanks in the following statements with suitable words or phrases. In the global economy, the export of a country is the 1. of another. 2 The theory that explains why trade can bring benefits to all participants is based on the advantage. concept of 3. An individual, a region, or a country has a comparative advantage over another individual, region, or country in producing a good or services when it can produce the good or service with lower compare to the other. 4. The important factor why specialization and trade can bring benefits to all participating parties is advantage, not advantage. 5. With the same amount of inputs, if Vietnam can produce more in both rice and telephones than Laos then Vietnam is said to have in both products. 6. If an economy is said to have comparative advantage in producing a good, international the domestic price of the good to the world price, which will better off while making domestic trade will make domestic worse off. 7. When an economy has comparative in producing a good, international trade will redistribute income from domestic to domestic but the gain in surplus is greater than the loss in surplus. 8. When an economy does not have a comparative advantage in producing a good. international trade will the domestic price of the good to the world price, the difference between domestic quantity supplied and domestic quantity demanded will be compensated by 9. When an economy does not have comparative advantage in producing a good, international trade will redistribute income from domestic to domestic and the net social benefit. 10. An imposed tariff will the price and the revenue of the domestic the revenue of the foreign producers. producers as well as 11. than the world When a tariff is imposed, the domestic price will become price. 12. If a tariff is imposed on a good, the domestic quantity demanded for this good will the domestic quantity supplied will the import quantity will 13. Tariff will make domestic and better off but make domestic worse off. 89 14. is the policy that creates a maximal limit to the amount of product that can be imported during a specific period. 15. Using export subsidy means that the tax money of a country is used to support domestic producers who have efficiency in comparison with foreign producers. after the government 16. Net social benefit from international trade will subsidize export activities. 17. product for Voluntary export restraint (VER) acts like a of a country, it usually used to negotiate for other benefits from the importing country. 1 PART 4 - CONCEPT MATCHING QUESTIONS 1) Match each concept to its appropriate definition A Trade surplus F Comparative advantage B Free trade area G Absolute advantage ic Trade deficit Specialization D Import quota Export E Import 1. The amount that import value exceeds the export value. 2. Limitation to the amount that a country could import. 3. The amount that export value exceeds import value. 4. An area with minimal international trade restrictions. 5. Buy a good or service that was produced in another country. 6. The ability of an individual or a country to produce a good with lower opportunity cost than other individuals or countries. 7. When a country concentrated its resources to produce a large amount of a good or services for consumption and trading. 8. Sell a good or service in another country. 9. The ability of an individual or a country to produce more of a good than other individuals or countries using the same amount of inputs. Let W = {a + bx + x^2 P_{2}: a, b R} with the standard operations in P_{2}. Which of the following statements is true? A. W is not a subspace of P_{2} because 0 W. The above is true B. None of the mentioned C. W is a subspace of P2. The above is trueD. -x W most manufacturing and retailing marketers worry constantly about whether their imc efforts are paying off. they assess various forms of __________ to determine what is working and what is not Complete the associated statement for each feature listed.a. The justification for the alternate valuation date election. The alternate valuation date was designed as a relief provision to ease the ___ that could result when estate assets decline in value. (choices for blank are economic hardship or accounting and documentation costs)b. The main heir prefers the date of death value. The ___ makes the 2032 election and it is ___ . (first blank choices are decendent, executor or main heir) (second blank choices are affirmed by the main heir, irrevocable, or revocable)c. An estate asset is sold seven months after the decedent's death. This ___ affect the alternate valuation date amount because the disposition occurs ___ the alternative valuation date. (first blank choices are will or will not) (second blank choices are before or after)d. Effect of the election on the income tax basis in the property received by the heir. The value of the property ___ generally determines the amount that is subject to the gift tax or the estate tax. If an alternate valuation election is made, that valuation amount ___ income tax basis of property subject to the election. (first blank choices are on the date of death, on the date it transfers, 6 months after date of death, 1 year after date of death, or 18 months after date of death) (second blank choices are becomes the or does not become the) At December 31, 2022, Tamarisk, Inc, reported the following plant assets. During 2023, the following selected cash transactions occurred. April 1 Purchased land for $2,040.000. May 1 Sold equipment that cost $1,140.000 when purchased on January 1, 2016. The equipment was sold for $342,000. June 1 Sold land for $1,600,000. The land cost $992,000 July 1 Purchased equipment for $1.092.000. Dec.31 Retired equipment that cost 5714.000 when purchased on December 31. 2013. No salvage value was received Prepare the plant assets section of Tamarisk's balance sheet at December 31, 2023. flist Plant Assets in order of Land, Eullilings ond Eigupment.) using amdahls law, calculate the speedup gain of an application that has a 40 percent parallel component for a. eight processing cores and b. sixteen processing cores Simplify by removing parentheses and, if possible, combining like terms. 2(6x + 4y) 5 (4x2 3y2) 2(6x + 4y) 5(4x - 3y?) = 0 Cross sectional studies of intelligence are potentially misleading because Question 2 You have identified a business opportunity in an underground mine where you work. You have noticed that female employees struggle with a one-piece overall when they use the bathroom. So, to SDM Natural Resource Management process:How do you address diverse stakeholder values and perspectivesthroughout the process? you have really_____ your foot in it this time.you should never have mentioned his ex_wife at dinner Consider the two molecules of DNA. AGTTACTAAAGCAATACATC TCAATGATTTCGTTATGTAG DNA 1AGGCGGGTAGGCACCCTTATCCGCCCATCCGTGGGAAT DNA 2Which two molecules of DNA has the lower melting temperature? Why? A. DNA 1, because DNA 2 may form more secondary structure. B. DNA 2. because it has a lower percentage of A-T base pairs that stabilize DNA duplexes. C. DNA 1. because it has a lower percentage of G-C base pairs that stabilize DNA duplexes. D. DNA 2, because it has 19 base pairs, whereas DNA has 20 base pairs. E. DNA 2, because DNA I may form more secondary structure. A normal distribution has a mean u = 15.2 and a standard deviation of o = 0.9. Find the probability that a score is greater than 16.1