define bond polarity and bond energy

Answers

Answer 1

Explanation:

♤ ϦØЛÐ þØŁΛ尺ɪŤϤ

=》Polarity refers to the physical properties of compounds such as boiling point, melting points and their solubilities.

♤ ϦØЛÐ ƐЛƐ尺ƓϤ

=》Bond energy is a measure of the bond strength of a chemical bond, and is the amount of energy needed to break the atoms involved in a molecular bond into free atoms..

i hope it helps uh..!! ♥️

mark me as brainliest ♥️

Related Questions

the vsepr model is used mainly to multiple choice question. a) write resonance structures. b) determine molecular shape. c) measure intermolecular distances. d) determine ionic charge.

Answers

The VSEPR theory predicts the form of the molecule based on the bonding electron pairs and lone electron pairs around the core atom since molecular shape is dependent on the electrons surrounding the central atom.

How does the VSEPR theory describe the structure of molecules?

Valence shell electron pair repulsion is the name given to the underlying concept in molecular structures (VSEPR). In essence, it states that because electron pairs are made up of negatively charged particles, they are attracted to one another and want to keep as far apart as possible.

Based on the number of valence shell electron bond pairs between the atoms in a molecule or ion, the valence shell electron pair repulsion (VSEPR) hypothesis is a model used to predict 3-D molecular shape.

Learn more about VSEPR theory refer

https://brainly.com/question/14225705

#SPJ4

determine the osmotic pressure of a solution that contains 0.026 g of a hydrocarbon solute (molar mass

Answers

The osmotic pressure of a solution that contains 0.026g of a hydrocarbon solute is 4.0 torr.

What is osmotic pressure?

Osmotic pressure is the pressure exerted by a solution due to the concentration of dissolved particles and the presence of a semipermeable membrane, which prevents the passage of some particles. This pressure can be present in both living and non-living systems. In living systems, osmotic pressure is the force that is responsible for the movement of water and other solutes across cell membranes. In non-living systems, osmotic pressure occurs when two solutions of different concentrations are separated by a semipermeable membrane. The higher the concentration of dissolved particles, the greater the osmotic pressure. Osmotic pressure plays an important role in the absorption and movement of water and other substances throughout the body. It is also important in industries such as food processing, pharmaceuticals, and biotechnology.

moles of solute=mass/molar mass =0.026/340g/mol=7.647×10⁻⁵

Molarity=moles/volume in solution

=7.647ₓ10⁻⁵/0.350L=0.000218M

osmotic pressure(Pi)=MRT

Pi=0.000218ₓ0.0821ₓ293

=0.00525atm

now,1 atm= 760 torr

so, 0.00525 atm= (760ₓ0.00525)

=3.99 torr

=4.00 torr

For more information about osmotic pressure please visit:
https://brainly.com/question/25904085
#SPJ4

the energy contained within covalent bonds in molecules is a type of potential energy called energy.

Answers

The energy contained within covalent bonds in molecules is a type of potential energy called chemical energy.

What is a chemical?

A chemical is any substance such as matter. This includes any liquid, stable, or fuel. A chemical is any natural substance (an detail) or any mixture (an answer, compound, or gas). they could both arise clearly or may be created artificially.If whatever manufactured from remember is made up of chemical compounds, which means that best phenomena that are not manufactured from be counted are not chemicals: power is not a chemical. mild, heat, and sound aren't chemicals—nor are thoughts, goals, gravity, or magnetism.obviously-going on chemicals may be solid, liquid, or gas. obviously going on solids, liquids, or gases may be made up of individual factors or may additionally contain many factors inside the form of molecules.

To know more about chemical, click the link given below:

https://brainly.com/question/29240183

#SPJ4

given that the enthalpy of the reaction shown below is -2511.14 kj, how much energy would be produced if 20.5 g of c2h2 is combusted with excess o2?

Answers

Answer:

Hope this helps

Explanation:

hjnm

What’s the between reflective symmetry in mathematics and bilateral symmetry in nature?

Answers

An object has reflection symmetry (line or mirror symmetry) if a line runs through it, dividing it into two mirror images of each other.

What is reflection symmetry ?

Reflection symmetry is a type of symmetry that pertains to reflections. Line symmetry and mirror symmetry are other terms for reflection symmetry. It states that if there is at least one line that divides a figure into two halves, with one half mirroring the other.

A biradial animal has only two planes of symmetry, one passing through the anteroposterior and sagittal axes and the other through the anteroposterior and transverse axes.

Thus, An object has reflection symmetry if a line runs through it, dividing it into two mirror images of each other.

To learn more about reflection symmetry, follow the link;

https://brainly.com/question/1531736

#SPJ1

Why is it that when the potential energy is higher in the products of a reaction than the reactants is it less stable and vice-versa?

Answers

Answer:

Explanation:

It is generally true that when the potential energy of the products of a reaction is higher than the potential energy of the reactants, the reaction is less stable and less likely to occur spontaneously. This is because potential energy is a measure of the stored energy of a system, and when the potential energy of the products is higher than the reactants, it means that more energy is being stored in the products than in the reactants. This excess of energy makes the products less stable and more reactive, as they are seeking to release the excess energy and return to a more stable state.

On the other hand, when the potential energy of the reactants is higher than the potential energy of the products, the reaction is more stable and more likely to occur spontaneously. This is because the reactants have more potential energy, meaning that they are more reactive and seeking to release that energy in order to return to a more stable state. The products, on the other hand, have lower potential energy and are more stable, so the reaction is more likely to occur as the reactants seek to release their excess energy and reach a lower energy state.

Overall, the stability of a reaction depends on the relative potential energies of the reactants and products, with reactions being more stable when the potential energy of the reactants is higher than the potential energy of the products.

Make a claim question about energy and states of matter

Answers

The same amount of matter can represent distinct states of matter by having different amounts of energy. An ice cube comprised of water, for instance, changes into liquid water when you add energy, and when you add even more energy, it turns into steam.

What is energy ?

In order to accomplish work and to produce heat and light, energy must be transferred to a body or to a physical system. Energy is the quantitative attribute that does this. It is a mechanically accepted quantity.

The observable cosmos is made up of matter, which coupled with energy serves as the foundation for all objective occurrences. In physics, energy is the ability to perform work. It could exist in several forms, such as potential, kinetic, thermal, electrical, chemical, radioactive, etc.

Thus, The same amount of matter can represent distinct states of matter by having different amounts of energy.

To learn more about the energy, follow the link;

https://brainly.com/question/1932868

#SPJ1

you predict that you should make 8.41 x 1024 molecules of ammonia in your reaction. how many grams of ammonia will you make if your prediction is correct?

Answers

The ammonia molecules involved in your process. 2.39 g of ammonia will be produced by you.

given that :

No. of ammonia there: 8.41 × 10²⁴

molar mass of ammonia : 17 g /mol

no. of molecules = (mass / molar mass ) × Avogadro's number

8.41 × 10²⁴ = (mass / 17 ) × 6.022 × 10²³

mass = 17 / 7.1

mass = 2.39 g

Consequently, a reaction that will produce ammonia as a byproduct. You project that your process should produce 8.41 × 10²⁴ ammonia molecules. 2.39 grams of ammonia can be produced.

What does the chemical term "molecular" mean?

The most frequent uses of the term "molecular" are in biology and chemistry, and it invariably refers to the tiniest components of living things or substances. The name molecule, which meaning "very minute particle," is derived from the Latin word molecula, which means "small bulk."

To know more about molecules visit:

https://brainly.com/question/1446104

#SPJ4

HELP ASAP PLEASE CHEMISTRY!!!

Answers

Answer:

3MgI2 + Fe2S3 -> 3MgS + 2FeI3

Reaction Type

1.Double Displacement 

2.Oxidation-Reduction

A given sample of n2 gas has a pressure of 0. 30 atm at 30. 0 °c. If the volume is 2. 0 l, how many moles of n2 are present?.

Answers

The number of mols of N2 present 0.3 atm pressure and 30 °C is 0.0781 mol

What are mole?

The term "mole" (also spelled "mole") refers to a standard scientific unit for measuring large quantities of extremely small objects like atoms, molecules, or other specific particles. The mole represents 6.02214076 10^23 units, an astronomically large number.

At STP, which is denoted as 0°C (273.15 K, 32°F), the molar volume of a gas is 22.414 L/mol. By calculating the moles of nitrogen in 1.75 L at STP using dimensional analysis we get

1.75 L N2 divided by 1 mole per 22.414 L equals 0.0781 mol.

Learn more about moles here:

brainly.com/question/26416088

#SPJ4

Write structural formulas for the products of 1,2 and 1,4 addition of hydrogen chloride to 2,4−hexadiene.

Answers

The structural formulas for the products of 1,2 and 1,4 addition of hydrogen chloride to 2,4−hexadiene is verified.

Define structural formula.

Chemical formulas known as structural formulas can provide a more thorough understanding of a substance than molecular formulas.

Explanation:

For the given reaction,

The first double bond receives an addition of H-Cl in the 1,2-addition reaction; the second double bond is not involved in the reaction.

However, in the 1,4-addition reaction, the first step is the same, but the second step is different because the location of the second double bond changes and Cl- is added to the fourth carbon because the second double bond demonstrates the need to stabilize the carbocation.

The reactions are represented in the following image.

To learn more about structural formula from the given link.

https://brainly.com/question/514499

#SPJ4

22. What is the difference between lodine-130 and lodine-131?

Answers

The first radioiodine isotopes to be used to treat thyrotoxicosis were iodine-130 and iodine-131 in 1941, and thyroid cancer was added to their list of uses in 1943.

What is Reactor produced radioiodine?Iodine-131, the most frequently prescribed radioiodine isotope for treating thyroid conditions, is a radioactive created in reactors and is widely available in the market. Uranium-235 isotope fission and the so-called (n, ) reaction are its two primary production processes.Iodine-131 is a radioisotope that is simple to obtain in pure form as its chain yield is quite high and radioiodine isotopes with masses higher than 131 have a short half-life. Contrarily, Technetium-130 undergoes a reaction with (n, ) to produce Technetium-131m and Technetium-131g. Depending on whether a wet chemical separation or a dry distillation process is employed, TeO2 or Te-metal is the target material for irradiation.Iodine-131 has a high radiochemical purity and is marketed as a diluted sodium hydroxide solution. When using iodine-131 to identify organic molecules, it may interfere if a certain reducing agent is used to preserve the isotope in the form of iodide in certain solutions.Another radioisotope created in reactors is iodine-125, which is formed when Xenon-124 undergoes the (n, ) reaction. High chemical and radiochemical purity iodine-125 is marketed as a diluted sodium hydroxide solution. It contains 4 to 11 GBq/ml of radioactive material.

To Learn more About radioiodine refer to:

https://brainly.com/question/20739702

#SPJ1

What is the mass of an object with a density of 2g/mL that displaces 1.5mL of water?
O 0.50
O 1.75
O there is not enough information to tell
O 3

Answers

Answer:

1.75

Explanation:

if you add

at constant temperature, 7.72 l of cl2 at 458 mm hg is compressed to 3.75 l. what is the final pressure of cl2

Answers

At constant temperature, 7.72 L of cl2 at 458 mmHg is compressed to 3.75 L. The final pressure of Cl₂ is 942.86 mmHg.

To calculate the final pressure we can use the boyle's law

Boyle's Law:

According to Boyle's Law, the relationship between a gas's volume and pressure is inverse. In other words, it says that as long as the number of gas moles remains constant, the product of pressure and volume for an ideal gas at constant temperature remains constant. P1V1=P2V2, where P1 is the first pressure, V1 is the first volume, P2 is the second pressure, and V2 is the second volume, is one way to state it.

So, the final pressure of Cl₂ can be calculate as follows:

P1V1=P2V2

458mmHg x 7.72 L = P2 x 3.75 L

P2 = 458mmHg x 7.72

                 3.75 L

P2 = 942.86 mmHg

Therefore, at constant temperature, 7.72 L of cl2 at 458 mmHg is compressed to 3.75 L. The final pressure of Cl₂ is 942.86 mmHg.

Learn more about Boyle's Law at https://brainly.com/question/1437490

#SPJ4

what are examples of types of chemical markers associated with dna that determines when, where and by how much genes are expressed in each cell?

Answers

When, where, and how much genes are expressed in each cell are all regulated by the histone proteins and epigenetic elements.

Histone proteins:

The eukaryotic cells include histone proteins, which serve two purposes. They support preserving DNA in a compact state and control how flexible and tight DNA strands are, which controls how genes are expressed.

Epigenetic factors:

The substances known as epigenetic regulators alter the gene to control how the gene expresses itself. These modifications neither result in mutations nor are they heritable. These are the transient alterations, such as DNA remodeling, methylation, and alkylation.

To learn more about Epigenetic factors click the link

https://brainly.com/question/28544015

#SPJ4

PLEASE HELP!! All my points!!

Create a sale pitch poster about Solar energy with all of the needs in the instructions ( pros and cons list does not matter.

Answers

Answer:

Here is a sample sale pitch poster about solar energy:

"Go Solar with Confidence!

Are you tired of rising energy costs and looking for a more sustainable solution? Solar energy is the answer!

Pros:

Solar energy is a clean and renewable source of electricity. It doesn't produce any harmful greenhouse gases or pollutants, making it a great choice for the environment.

Solar panels are easy to install and maintain, with a lifespan of 25-30 years.

Solar energy can save you money on your energy bills, especially if you live in a sunny location.

Cons:

The initial cost of installing solar panels can be high, although there are various financing options available to help offset this expense.

Solar energy is not always reliable, as it depends on the availability of sunlight. However, advances in solar panel technology have made it possible to generate electricity even on cloudy days.

Why is it great?

Solar energy is a reliable and cost-effective way to generate electricity for your home or business. It can help you reduce your carbon footprint and protect the environment for future generations.

Why is it bad?

The upfront cost of installing solar panels can be a barrier for some people. However, the long-term financial benefits of switching to solar energy can far outweigh this initial investment.

Can you overcome those downfalls?

Yes, by exploring financing options and taking advantage of government incentives and rebates, you can make the switch to solar energy more affordable.

Be to the point:

Solar energy is a clean, renewable, and cost-effective way to generate electricity. It has a long lifespan and can save you money on your energy bills. Don't wait any longer - make the switch to solar today!"

what is the emitted particle called that is responsible for each color observed?

Answers

The emitted particle is called photon which is responsible for the different color emission.

When an electron jumps from the higher energy orbit to a lower energy orbit, it releases energy in the form of photons (according to the particle theory of light), this is called photon emission.

The released photons will have different wavelengths and frequencies due to which photons will have different energies and color.

Like in chemical compounds, Heated compounds have acquired energy in the form of thermal energy. This thermal energy, if it is enough, excites electrons in any major atom in a compound or any singular lone atom so that the compound reaches one of its accessible excited states. This event is called an electronic excitation, and it leaves the compound less stable than in its ground state.

To know more about thermal energy here

https://brainly.com/question/9621699

#SPJ4

The heat of combustion for sugar is 5639 kJ/mole, but that for TNT is 3406 kJ/mole. Why, if the heat of combustion for TNT is smaller than for sugar, is TNT an explosive?

Answers

Heat of combustion used to explain the relative stability of the compounds.

The heat of combustion definition is the variation in energy released in the form of heat through the burning of an amount of any substance, all reactants being in the standard state (temperature of 25 C and pressure of 1 atm).

When the amount is quantified for 1 mole of said substance, one can define this quantity as the molar heat of combustion.

The molar heat of combustion values are defined in kilojoules per mole (KJ/mol). The kilojoule is a unit of energy and corresponds to 1000 or Joules (J). Mole is a unit of measurement used to express the amount of matter.

Now sugar is a non electrolyte so comparatively more stable hence more energy required to decompose the sugar hence its heat of combustion value is -5639kJ/mol high.

Where as TNT used as an explosive so it is susceptible for reaction and combustion, hence low amount of heat of combustionnis required for TNT that is -3406kJ/mol whuch is comparatively lower.

To know more about heat of combustion here

https://brainly.com/question/11103047

#SPJ4

The table shows the first, second, and third ionization energies of four elements of Period 6. One of the elements is a noble gas. Use the information in the table to complete the sentences. An element may be chosen more than once or not at all. Ionization Energy (IE) kJ/mol First IE Second IE Third IE Element 1 812 1862 2634 Element 2 376 2234 3203 Element 3 503 965 3458 Element 4 1037 2064 2837 The noble gas is most likely Element Choose... . Of the four, Element Choose... has the largest atomic radius. The element which would form cations with a 2+ charge is Choose... .

Answers

1) The noble gas is element 4.

2) The element that has the largest atomic radius is element 4.

3) The element that would form a +2 cation is element 3.

What is the ionization energy?

We define the ionization energy as the energy that we need so as to remove an electron from an atom. If the electron that we are referring to here is the first electron that is removed from the atom then we can call it more specificaly the first ionization energy. There are other ionization energies as more electrons are removed from the atom.

I see that it is important to say a couple of things about the noble gases that would help us decide on the answer. We know that the noble gas has to do with an element that is found in the eighteenth group of the periodic table and does has a complete octet.

This stability means that it is quite difficult to remove electrons from this atom hence the atom is quite stable.

Learn more about ionization energy:https://brainly.com/question/28385102

#SPJ1

first, alex dose an exprerimen wich she fills 2 cups with cold liquid at the same tempeture: 1 with the new lid she finds that the liquid in one cup warmed up more than the liquid in the other cup after 10 minuts wich cup do yo think it wermed up more why

Answers

The temperature of liquid in a cup with a lid changes less than in a cup without a lid.

How does a lid affect the temperature of liquid inside the cup?

It is well known that in a closed system, neither heat nor matter will be transferred from the system to the environment. In contrast, in an open system, energy and heat are exchanged from the system to its surroundings and vice versa.

Cup with the lid (cup A) is a closed system in this situation, but Cup without lid (cup B) is an open system. Therefore, there won't be any heat or material transfer from cup A to the system or surroundings. As a result, cup B warm up slowly.

We can conclude that cup with lids are able to keep liquid cool better than the cup without the lids. Therefore, after 10 minutes the liquid in the cup without lid will be more warmed up.

Know more about how lid affects the liquid in a cup at:

https://brainly.com/question/12702491

#SPJ1

Most of the energy released in citric acid cycle reactions is conserved in ________.

Answers

The majority of the energy released in citric acid cycle reactions is conserved in the form of adenosine triphosphate (ATP).

What is citric acid cycle?
The Krebs cycle, also referred to as the TCA cycle or the citric acid cycle (CAC), is a set of chemical reactions that releases stored energy by oxidising acetyl-CoA, which is inferred from carbohydrates, fats, as well as proteins. Organisms a certain respire (as compared to organisms a certain ferment) use the Krebs cycle to produce energy, either through anaerobic or aerobic respiration. The cycle additionally supplies the reducing agent NADH and precursors of a few amino acids that are needed in a variety of other reactions. It may have originated abiogenically and became one of the earliest elements of metabolism given its central role in many biochemical pathways.

To learn more about citric acid cycle
https://brainly.com/question/29708858
#SPJ4

calculate the percentage of phosphorus in calcium hydrogen phosphate

Answers

The percentage of P in Ca(H2PO4)2 is 26.42%.

Relative molecular mass of Ca(H2PO4)2  

=40.07+(1×4)+(30.9×2)+(16×8)

=40.07+4+61.8+128

=233.87

Therefore, 233.87g Ca(H2PO4)2 contains 61.8g P.

So, 100g Ca(H2PO4)2 contains:

= 100×61.8/233.87 ​

=26.42

Therefore, the percentage of P in Ca(H2PO4)2 is 26.42%.

To know more about the Percentage of an element, please refer to the link below:

brainly.com/question/24166955

Yo help a brother out you don’t want me to fail right

Answers

a. The names for the compounds in the task above are given below:

Fe2O3: Ferric oxide NiCl: Nickel chloride Co3P: Cobalt (II) phosphide Co3N2: Cobalt (II) NitrideAg2S: silver silver sulfideFeCl2: Iron(II) chlorideFeCl3: Iron(III) chlorideHNO3: Hydrogen trioxonitrate VH2CO3: Hydrogen trioxocarbonateIV

b. The correct formulas for the compounds in the problem above are:

Copper (II) sulfide: CuSMecury (IV) chloride: HgCl2Iron (I) nitride: Fe2NZinc (II) bromide: ZnBr2Vanadium (V) oxide: V2O5Silver (III) phosphide: Ag3PNickel (II) sulfide: NiSHydrofluoric acid: HF.

What is meant by the formula of a chemical compound?

The formula of a compound is the chemical representation of chemical substance. The symbols of the individual elements which forms the compound is used in analysing the chemical formula of particular compund.

From the task given above, HNO3 is a compound which is formed by hydrogen, nitrogen and oxygen and their symbols are used to form the formula.

In conclusion, it can be deduced from the explanation given above that the formulae of chemical species is used to represent chemical equation.

Read more on formulas:

https://brainly.com/question/1603500

#SPJ1

which of the following can exist as cis-trans isomers? a. cyclohexane b. methylcyclohexane c. 1,1-dimethylcyclohexane d. 1,2-dimethylcyclohexane

Answers

The option d) is correct i.e. 1,2 - dimethyl cyclohexane which can exist as cis-trans isomers.

What are isomers?

Isomers are molecules that have the same chemical formula but different structures. This means that they contain the same number of atoms of each element, but they are arranged differently. Isomers can be divided into two categories: structural isomers, where the atoms are connected in different ways, and stereoisomers, where the atoms are connected the same way but arranged differently in space. An example of structural isomers is the difference between butane and isobutane, which are both made up of 4 carbons and 10 hydrogen atoms, but have different structures. An example of stereoisomers is the difference between D-glucose and L-glucose, which are both C6H12O6, but their atoms are arranged differently in space.

The compounds which same molecular formula and different connections are constitutional isomers.

For more information about isomers please visit:
https://brainly.com/question/14130214
#SPJ4

how many milliliters of a 12 m nitric acid solution are needed for a reaction that requires 4.50 mol of h ?

Answers

215 ml is needed for a reaction that requires 4.50 mol of h

What is molarity?

The method of figuring out how much of a material a certain chemical solution contains is known as molecularity, sometimes known as the molar concentration of a solution. It is measured by taking into account two indications, namely the volume of the solution and the quantity of solute molecules. Essentially, the volume of the solution is determined in liters. The letter "M" stands for molarity.

According to the given information:

Make use of the equation molarity = amount of moles / number of litres.

Rearrange the equations to read: no. of moles = no. of litres x molarity and no. of litres = no. of moles / molarity.

There are (0.215 x 1) = 0.215 moles of HCl in 215 ml of 1 M HCl (aq).

The volume of 12 M HCl (aq) containing 0.215 mol of HCl is equal to (0.215/12) = 0.0179 litre or 17.9 ml.

As a result, you would use 17.9 ml of 12 M HCl, which you would then dilute with water to get a total volume of 215 ml

To know more about molarity:

https://brainly.com/question/8732513

#SPJ4

Biomolecules contain a variety of atoms. Which biomolecule maintains a ratio of 1 carbon atom to 2 hydrogen atoms to 1 oxygen atom?.

Answers

The biomolecule with this ratio is water (H2O).

What is biomolecule?
A loose term for molecules found in organisms and necessary for one or more typical biological processes, including such cell division, morphogenesis, as well as development, is "biomolecule" or "biological molecule." Large macromolecules (as well as polyelectrolytes) like proteins, carbohydrates, lipids, as well as nucleic acids, in addition to small molecules like primary metabolites, secondary metabolites, and natural products, are all examples of what is referred to as a biomolecule. Biological materials is a more inclusive term for this category of materials. Living organisms depend on exogenous biomolecules, such as certain nutrients, to survive even though endogenous biomolecules, which are produced inside the organism, are frequently necessary.

Water is made up of two hydrogen atoms bonded to one oxygen atom. This bond forms a covalent bond, with the oxygen atom sharing its two outer electrons with the two hydrogen atoms. This results in a ratio of 1 carbon atom to 2 hydrogen atoms to 1 oxygen atom.

To learn more about biomolecule
https://brainly.com/question/11456886
#SPJ4

Which of the following mixtures would result in the pK, of the acid being obtained from a direct pH
measurement of the resulting solution?
A. 25 cm³ 0.1 mol dm^-3 HCl and 25 cm^3 0.1 mol dm^-3 NaCl
B. 25 cm³ 0.1 mol dm^-3 NaOH and 25 cm³ 0.1 mol dm^-3 CH3COOH
C. 12.5 cm³ 0.1 mol dm^-3 CH3COOH and 25 cm³ 0.1 mol dm^-3 NaOH
D. 12.5 cm³ 0.1 mol dm^-3 NaOH and 25 cm³ 0.1 mol dm^-3 CH3COOH

Answers

The mixtures would result in the pk, of the acid being obtained from a direct pH measurement of the resulting solution is  25 cm³ 0.1 mol dm⁻³HCl and 25 cm³ 0.1 mol dm⁻³ NaCl. Therefore, option A is correct.

What is pH ?

The pH scale, which previously stood for "potential of hydrogen," is used to describe how acidic or basic an aqueous solution is. The pH values of acidic solutions are lower than those of basic or alkaline solutions.

The pH scale determines how acidic or basic water is. The range is 0 to 14, with 7 representing neutrality. Acidity is indicated by pH values below 7, whereas baseness is shown by pH values above 7. In reality, pH is a measurement of the proportion of free hydrogen and hydroxyl ions in water.

A solution's pH is a significant indicator of its chemical composition. The pH can affect how readily available nutrients are, how biological processes work, how bacteria behave, and how chemicals behave.

Thus, option A is correct.

To learn more about pH, follow the link;

https://brainly.com/question/15289741

#SPJ1

In dogs, there is a hereditary type of deafness caused by a recessive gene. Two dogs who carry the gene for deafness but have normal hearing are going to be mated. What is the genotype of the two parent dogs?

Answers

Since the two dogs are carriers of the gene for deafness, their genotypes would be "Hh", where "H" is the dominant gene for normal hearing and "h" is the recessive gene for deafness. This means that each of the dogs has one copy of the normal hearing gene and one copy of the gene for deafness, but they have normal hearing because the dominant gene is masking the effect of the recessive gene. When these two dogs are mated, they can pass on either the normal hearing gene or the gene for deafness to their offspring. The genotype of the two parent dogs would therefore be "Hh".

according to the uncertainty principle, as you localize a wave in time, you become more uncertain about its:_____.

Answers

Answer:

position

Explanation:

cant know both at the same time




6. Which structure is responsible for the synthesis of ATP?
A) A
B) B
Vac
C) C
D) D

Answers

Mitochondria is   responsible for the synthesis of ATP which is required for photosynthesis.

What is photosynthesis?

It is defined as a process by which plants and other photosynthetic organisms convert the light energy in to chemical energy  through the process of cellular respiration.

Some of the energy which is converted  is stored in molecules of carbohydrates like sugar and starches  which are made up of from carbon dioxide and water . Photosynthetic organisms which can perform photosynthesis  are algae and cyanobacteria. Photosynthesis is largely responsible for producing and maintaining the content of oxygen in earth's atmosphere.

Learn more about photosynthesis,here:

https://brainly.com/question/29776072

#SPJ1

Your question is incomplete, but most probably your full question was:Which structure is responsible for the synthesis of ATP?

A.cell membrane

B.nucleus

C.lysosomes

D.mitochondria

E.vacuole

Other Questions
The Double V Campaign sought to fight for democracy in Europe and toend racism in the United States.O create a new League of Nations.revert back to the policy of neutrality.O promote a communist government. when the nurse interviews a client with internal hemorrhoids, what would the nurse expect the client to report? find the volumes of the solid(s) Describe how high-energy electrons are ultimately responsible for driving the reactions of photosynthesis. Plot the image of point A under a dilation about point P with a scale factor of 3. Below is a list of inventions that came out during the Industrial Revolution, describe the impactof each oneIndoor plumbingToiletsToilet paper Electricity Cars Trains Radio Steam Engine Dynamite Cameras I have a triangle with c as hypotenuse, b as opposite, and nothing for adjacent. Bottom left corner is 62 degrees and the right bottom corner is 90 degrees. Round answer to nearest 16th of an inch SolvingThe product of 5 and the differencebetween a number and 7 is 75. What isthe number? a pregnant woman in the second trimester of pregnancy complains of constipation and describes the home care measures she is taking to relieve the problem. which would the nurse determine is a harmful measure in preventing constipation? Which statement accurately describes how toproperly use a semicolon to join independentclauses? An advantage of the balanced scorecard framework is the ability to automate the flow of information on __________, so that executives are kept fully informed about business performance. original DNA: TACTTTAATCCCAAATTTACT DNA: TACTATAATCCCAAATTTACT mRNA: ? amino acid: ? what type of mutation is this: ? The authors most likely use the examples in lines 1-10 of the passage ("Piaget's...knowledge") to highlight thePiaget's theory of cognitive development is acomprehensive theory about the nature anddevelopment of human intelligence. It was firstdeveloped by the Swiss clinical psychologist JeanPiaget, who lived from 1896 to 1980. It is primarilyknown as a theory of the stages of humandevelopment. Beyond this primary purpose, it alscdeals with the nature of knowledge itself and howhumans come gradually to acquire, construct, and use knowledge. Please help me solve! a dam holds back the water in a lake. if the dam has a small hole 1.4 meters below the surface of the lake, at what speed does water exit the hole? A corporation has the following account balances: Common Stock, $1 par value, $80,000; Paid-in Capital in Excess of Par Value, $2,700,000. Based on this information, the a. legal capital is $2,780,000.b. number of shares issued is 80,000.c. number of shares outstanding is 2,780,000.d. average price per share issued is $3.48. 4. Using the statistics in the following report generated for Community Hospital, calculate (round to two decimal places) the percentage of occupancy for the month of December. Remember to calculate the Total for Patient Care Units (IPSD, Bed Count and Percent of Occupancy). There are some coloured pins in a bag. The pins can be green,yellow, purple, or grey. A pin is going to be taken at random from the bag. The table shows the probabilities of picking a purple or grey pin. The probability of picking a green pin is three times the probability of picking a yellow one. a)Complete the table. There are 14 purple pins in the bag. b)Work out how many green pins are in the bag hormones in the body are not responsible for regulatingA) development B) Growth C) OxygenD) Reproduction Can you see or hear radio waves?A) You can't hear radio waves but you can see them.B) You can see and hear radio waves.C) You can't see radio waves but you can hear them.D) You can neither see nor hear radio waves.D