Depending on the economy, financial institution, and your credit history, interest rates commonly range from

Answers

Answer 1
From what we need a picture for prod
Depending On The Economy, Financial Institution, And Your Credit History, Interest Rates Commonly Range
Answer 2

Answer:

When interest rates increase, it affects the ways that consumers and businesses can.called the Fed—cut the target range for its benchmark interest rate by 0.25%.Why does the Fed cut interest rates when the economy begins to struggle—or raise.The prime rate represents the credit rate that banks extend to their most.

Explanation:


Related Questions

Giving away points hope they help with your questions

Answers

thank youuuuuuu :))))

Please help will mark brainliest

Answers

Answer:

C Audio and Video

Explanation:

you can hear and see in vr

why does high resistance not affect a parallel circuit

Answers

Answer:

Because the equivalent or the total resistance is lower comparatively.

Explanation:

It is because in parallel circuit, the equivalent resistance or the total resistance is lower comparatively and hence more current flow through the circuit.

Basically, the same resistors connected in series have high values as compared to the scenario when these resistors are connected in parallel.

does anyone have the answers to the modern carpentry book review questions for chapter 21,22, and 23​

Answers

You could go on Slader and look for the book, it gives you answer keys

15 POINTS! Help.

What might happen if a systems engineer overlooked a detail that may have been discovered by a manufacturing engineer? Explain using an example.

Answers

Answer: it would  overload

Explanation:

Answer:

It is going to overload

Explanation:

Hope this helps have a great day!

if a rocket has .67 calibers what is it considered as

Answers

Answer:

calibers

Explanation:

Three (3) Types of Section Views used in engineering drawing are

Plan, Front and End

Orthographic, Isometric and Oblique Section

Full, Half and Offset Section

None of the above

Answers

Answer:

none of the above

Explanation:

plen ,side and elevation are the three section views

A heater has a resistance of 15 Ω. It operates on 120 V. What thermal energy is supplied by the heater in 2 minutes?

Answers

Answer:

E = 115.2 kJ

Explanation:

Given that,

Resistance, R = 15 ohms

Voltage, V = 120 V

We need to find the energy supplies by the heater in 2 minutes or 120 s.

The formula for the thermal energy supplies is given by :

[tex]E=I^2Rt[/tex]

We know that, V = IR

So,

[tex]E=\dfrac{V^2t}{R}\\\\E=\dfrac{(120)^2\times 120}{15}\\\\E=115200\ J\\\\E=115.2\ kJ[/tex]

So, 115.2 kJ of energy is supplied.

Please help me
Distinguish between the first two steps of an implementation plan: stating the problem and evaluating the problem.

Answers

Answer:

The first step of the problem solving process is to identify and define the problem. The second step, which is to analyze the problem, involves gathering information, sorting through relevant and irrelevant information, and evaluating the source of the problem by asking the Five W's: who, what, where, when, and why.

FDR is regarded as one of our greatest presidents but he made some real errors, what were they? Why? Is it fair to blame him for these considering the magnitude of what he faced?

Answers

Answer: The Second Bill of Rights was proposed by United States President Franklin D. Roosevelt during his State of the Union Address on Tuesday, January 11, 1944. ... Farmers' rights to a fair income. Freedom from unfair competition and monopolies

Explanation:

I need help with this, question thank you so much

Answers

Answer:

Explanation:

beeeeeeep beeeeeeeeeeeeeeeeeeeep

Answer:

what happened here?

hahaha

will mark brainliest!

what is ethics and why is it so important? How does it affect the manufacturing processes of specific goods

Answers

Ethics in production is a subset of business ethic that is meant to ensure that the production function or activities are not damaging to the consumer or the society. Like other ethics there is a certain code of conduct or standards to be followed, however ensuring that the ethics are complied with is often difficult.

i HOPE IT'S HELP

Answer:

Ethics serve as a guide to moral daily living and helps us judge whether our behavior can be justified. Ethics refers to society's sense of the right way of living our daily lives. It does this by establishing rules, principles, and values on which we can base our conduct.

Explanation:

Business ethics help ensure a good reputation for your company. ... When you have a reputation for consistently being ethical in how you source and build products, and treat employees, customers and the community, more people will want to do business with you. Even social media ethics is important for your reputation.

How do engineers deal with liquefaction when building a very tall building?

Answers

Answer:

Engineers can use a variety of techniques to prevent or mitigate the effects of liquefaction when building a very tall building. Liquefaction is a phenomenon that occurs when soil loses its strength and stiffness due to increased pore water pressure. This can cause the ground to become unstable, potentially leading to significant damage to buildings and other structures. To prevent liquefaction, engineers may use a combination of techniques, including:

Deep foundations: By building the foundations of a building deep into the ground, engineers can reduce the effects of liquefaction by increasing the weight and stiffness of the soil. This can help to keep the building stable even if the ground around it becomes unstable.
Vibration monitoring: Engineers can use sensors and other monitoring equipment to detect and measure vibrations in the ground. This can help them to identify areas where liquefaction is likely to occur, allowing them to take corrective action before it becomes a problem.
Soil improvement: In some cases, engineers may be able to improve the soil by adding chemicals or other materials that increase its strength and stiffness. This can help to prevent liquefaction and make the ground more stable for building.
Flexible design: By designing buildings with a certain amount of flexibility, engineers can reduce the effects of liquefaction on the structure. For example, they may use flexible connections between the foundation and the building itself, or incorporate materials that can withstand movements caused by liquefaction.

What’s the answer please help

Answers

Answer:

It B

Explanation:

How does the strength of the bar magnet effect the induced current?

Answers

Answer:

your answer is c does not effect current

make list of possible projects you would like consider doing in the place you live and could be a simple paint job or a bookcase or piece of furniture

plz help ​

Answers

Answer:

Make a model of an highway to study the physics and how the road and velocity of a car.

PROBLEM IN PICTURE HELP ME DEAR GODDDDDD UGHHH NONONO I HAVE 2 MINUTES TO FINISH THIS ❕❗️❕❗️❗️❕❕❕❕❗️❕❕❗️❕❗️❗️❗️❕‼️‼️‼️‼️❗️‼️❗️

Answers

Thx :) so much :))))))

Answer:

Hey mate.....

Explanation:

THANK YOU SO MUCH!!!!!!!!!!!!!!

FOLLOW ME! ;)

Primary power is the electrical supply from the power company.
False
True

Answers

Primary power is the electrical supply from the power company. The given statement is True.

How do main and secondary powers differ?

Primary distribution lines, often known as primaries, are those located on the high voltage side of the distribution transformer. Secondary distribution lines, or secondaries, are those found on the low-voltage side of the distribution transformer. Primary energy (PE) is a type of energy that can be found in nature that hasn't undergone any artificially designed conversion procedures. It is the energy that is present in unprocessed fuels and other energy sources, such as trash, that are introduced into a system.

Renewable or nonrenewable sources can be used for primary energy. Primary energy sources come in a variety of shapes and sizes, and they can be either nuclear, fossil (such as coal, oil, and natural gas), or renewable (such as wind, solar, geothermal, and hydropower).

Learn more about Power here: https://brainly.com/question/25543272

#SPJ1

When starting a featheredge, sandpaper grit is increased in steps of up to
A) 200
B) 150
C) 100
D) 50
grit at a time.

Answers

Answer: C: 100

Explanation: When starting a featheredge, sandpaper grit is increased in steps of up to 100 grits at a time.

Please help i am give brainliest i really need help guys no links please ???
can someone create a 2-minute presentation about wind

also i am giving 40 points

no dam links

if you put links i will hack your brainiy account

Answers

Explanation:

The wind is an actual form of solar energy. winds are caused by the heating of the atmosphere by the sun, the rotation of the earth, and the earth's surface irregularities. The wind is capture in a wind turbine which provides a renewable energy source, the wind makes the rotor spin, as the rotor spins the movement of the blades drives a generator that creates energy, also known as wind power. The average wind efficiency of turbines is between 35-45%.

Advantages of wind power

- Wind power is cost-effective

- wind creates jobs

- wind enables US industry growth and US competitiveness

-it's a clean fuel source

   

Please answer this asap​

Answers

option 2 bud  becasue of how its angles

Answer:

option 2 :

F.V and S.V

Explanation:

that's the correct answer

Which of the following distinguishes why “biosolid” is another name for fertilizers made from sewage sludge?

Answers

Answer:

Because human waste is biodegradable

Explanation:

Since sewage sludge or human waste is an environmentally friendly and biodegradable, so means of processing human waste, it is called "biosolid" when used as fertilizer. Sewage is a semi-solid substance formed during the sewage treatment process and during process human waste can be easily biodegrade.

Which of the following tools utilizes a bubble of air floating in liquid?

A. level
B. sliding T bevel
C. tri-square
D. square

Answers

Answer:

Option A

A level tool utilizes a bubble of air floating in liquid

Explanation:

A level tool (spirit level, bubble level) utilizes a bubble of air floating in liquid. This is a mechanism to check whether the surface is horizontal (level) or vertical (plumb). The air bubble must always be at the center with in the two level indication line marks.

Hence, option A is the right answer

please help i am give brainliest i really need help guys no links please ???

can someone create a 2-minute presentation about wind

also i am giving 50 points

no dam links

if you put links i will hack your brainiy account

Answers

Wind is the flow of gases on a large scale. On the surface of the Earth, wind consists of the bulk movement of air. Winds are commonly classified by their spatial scale, their speed, the types of forces that cause them, the regions in which they occur, and their effect. Wind is the flow of gases, here on Earth it refers to the movement of air.

It is caused by differences in air pressure. ...

Short bursts of wind moving at high speeds are known as gusts.

Depending on their strength, winds can be known as a breeze, gale, storm or hurricane.

You are developing a mind map for measuring the viscosity of fluid. At which stage in the process will you specify the equipment needed for the experiment?

Connecting the subtopics fo the central idea

Defining the lower-level subtopics

Creating the image

Defining the subtopics


Answers

Answer:

Defining the subtopics

Answer:

Defining the subtopics

Explanation:

Using complete sentences, explain what ethics is and why ethics in engineering is important. How does it affects the manufacturing processes of a specific good.


will mark brainliest please help.

Answers

According to Oxford dictionary states “the branch of knowledge that deals with moral principles “

And according to blog v-hr.com sums up saying it should be celebrated as something to be proud which brings concerns forward and to see if something is unsafe

Technician A states that a scan tool can read
almost every system on a vehicle and provide
valuable data in identifying problems. Technician
B states that electronic steering system faults set
a diagnostic trouble code that can be retrieved by
a scan tool. Who is correct?
Select one:
A. Technician A
B. Technician B
C. Both A and B
D. Neither A nor B

Answers

Answer:

your answer is C.both A and B

7. Power steering belts should be checked for all of the following EXCEPT:
OA. Alignment
OB. Glazing
OC. Streaking
OD. Cracking

Answers

Answer:

OB

Explanation:

Calculate the amount of current flowing through a 75-watt light bulb that is connected to a 120-volt circuit in your home.

Answers

Answer:

I = 0.625 A

Explanation:

Given that,

Power of the light bulb, P = 75 W

Voltage of the circuit, V = 120 V

We need to find the current flowing through it. We know that, Power is given by :

[tex]P=V\times I[/tex]

I is the electric current

[tex]I=\dfrac{P}{V}\\\\I=\dfrac{75\ W}{120\ V}\\\\I=0.625\ A[/tex]

So, the current is 0.625 A.

At the operations level of industrial internet what is not critical

Answers

At the industrial internet's operational level, Time is not crucial.

Explain about the industrial internet?

An interconnected system of sensors, instruments, and other devices is referred to as the "industrial internet of things" and is utilized in industrial computer applications such as production and energy management.

Increased efficiency The main benefit of IIOT is the ability for industries to automate and increase their operational efficiency. Robotics and automated machinery can work more accurately and effectively, improving output and helping businesses streamline their processes.

Due to its emphasis on machine-to-machine (M2M) connectivity, big data, and machine learning, the IIOT enables businesses and industries to function more effectively and dependably.

Examples of IIOT devices in an IIOT network include sensors, computers, and machinery used in manufacturing, agriculture, and mission-critical applications, such as nuclear and energy management systems.

To learn more about industrial internet refer to:

https://brainly.com/question/29691498

#SPJ1

Other Questions
Please select the word from the list that best fits the definitionIllegitimate power that is achieved by force or the threat of force. Describe and correct the error in solving the equation This bar chart shows the numbers of pets owned by peoplequestioned in a survey. Note that the scale on the verticalaxis is missing.The total number of petsowned by the respondentsis 92.How many people ownedexactly 2 pets? Why did many americans lose faith in president ford's leadership during his first months in office? How empathy can be used to build positive relationships? CALLIn this cartoon, how are the eastern and western sections of the United Statesdivided?OA. They are divided between states that allowed women to vote andthose that did not.B. They are divided between states that voted Democratic andRepublican.OC. They are divided between slave and free states.OD. They are divided between states that passed the ThirteenthAmendment and those that rejected it. What is the meaning of vadya? Multiply. State the product in simplest form..p-4p-1218p6p+12 p-9p+18, p - 2,3,6 How many years should I pay for SSS? What were the 3 Populist Party beliefs? The five-factor model of personality:is supported by the results of projective tests.is supported by genetic markers.has proven useful across the life span in many cultures.is not well supported. Using the following chart, which chain of amino acids would be produced by the sequence of this very short, complete mRNA: UAUUAUGCCUGAGUGAAUUGCUA? 0.000 $20.000 530 000 S40 Task Instructions x Honolulu Denver Add the alternative text Cost forecast for three years and four cities to the chart. 1:35 AM 4 4U 325/2020 100% ^ (1) ENG 1:35 AM 11/30/2020 AUSWADUI LUULEL Attempts Remaining 7 Submit PB Forecast Excel Sign in File Home Insert Page Layout Formulas Data Review View Tell me what you want to do Askar Com General 28 O IU Insert Delete Format 14 29 Wrap Test B.O.A. s E Merge Center Alge > Cost Forecasts by City - Kitchens $ . % 4 Conditional Formatas Call Formatting Tata Styles Norber - Autocom - COR Sortid Clear Filter Set Editing board Font H M O Precision Building Cost Forecast by City Cost Forecasts by City - Kitchens City Year 2020 Year 2021 Year 2022 $43.000 $44000 $45,000 550.000 $65.000 $67.000 $38.000 $40 000 $43.000 $5.500 $55.000$$7.500 Atlanta, GA Boston, MA Denver CO Fionolulu, HI 2011 Based on 150 sq. ft. Kitchen S. . 50 Honolulu Denver Task Instructions Forecasts Add the alternative text Cost forecast for three yem and four cities to the chant. Type here to search i 1252 O DI How can I get my SSS verification slip online? What were the goals of the US in Afghanistan? What are 3 interesting facts about the Taj Mahal? identify the conclusions that can be drawn from the given premises using existential generalization. (check all that apply.)Check All That Apply a. There exists a non-six-legged creature that eats a six-legged creature. b. There does not exist a non-six-legged creature that eats a six-legged creature. c. There exists a noninsect that eats an insect d. There does not exist a noninsect that eats an insect. if you are in a low-speed collision, when your vehicle is repaired, be sure to have your replaced. Who described the flow of blood through the heart? [tex](5-\sqrt{5}) and (\sqrt{5} -5)[/tex]Are two roots of a fourth degree polynomial with integer coefficients, what are the other roots?