DESCRIBE THE TYPE OF SOIL THAT WOULD BE BEST FOR LINING A RESERVOIRS.

Answers

Answer 1

Answer:

ithink its Bentonite clay

Explanation:

Answer 2

Answer:

its clayey soils aka clay

Explanation:

because it's composed a very fine densely-packed particles in a compact well to hold water without losing large amounts to drainage


Related Questions

PLS HELP
How is photosynthesis different than cellular respiration?

A. The process involves oxygen
B. The process involves light
C. The process involves carbon dioxide
D. The process involves water

Answers

Answer:

b

Explanation:

basic bio

Which of the characteristics describe energy-carrier molecules?
can be coupled to energy-requiring reactions within a cell to help drive the reactions forward
accumulate in large quantities within a cell for long-term storage of energy
are quickly broken down once the molecules release their energy
include molecules, such as ATP, that contain high-energy chemical bonds
are generated when macromolecules, such as proteins, are broken down

Answers

Answer:

are quickly broken down once molecules release their energy

Explanation:

The characteristics of energy-carrier molecules are that they are quickly broken down once the molecules release their energy, which isoption. Energy-carrier molecules, like ATP, are quickly broken down into ADP (adenosine diphosphate) and inorganic phosphate (Pi) once they release their energy.

 Energy-carrier molecules, such as ATP, store energy in high-energy chemical bonds. When these bonds are broken, energy is released and can be used for cellular processes.Energy-carrier molecules are not typically generated when macromolecules, such as proteins, are broken down. Energy carriers like ATP are produced through cellular respiration, primarily in processes such as glycolysis, the Krebs cycle, and oxidative phosphorylation.

Learn more about the ATP here.

https://brainly.com/question/836188

#SPJ2

Hormone levels being controlled through body fluids is called
A. hormonal control.
B. neural control.
C. humoral control.
D. thyroid control.

Answers

Answer: C.

Explanation:

Hormone levels being controlled through body fluids is called humoral control

where is glucose stored or found in the leaf?

Answers

Its stored in the chloroplasts

In 3-5 sentences explain, ​​​​​​why when DDT was released for insect control it had to be banned in 1972 and what this phenomenon is an example of.

Answers

DDT was banned after it was released for insect control due to the following reasons:

Threat to human livesThreat to wildlifeHas side health effect

What is DDT?

It is a colourless and odourless chemical substance. It full meaning is Dichlorodiphenyltrichloroethane.

It is an organic compound originally produced as insecticides to control insects

It was later banned in 1972 for use dues to its negative effects in the environment, humans and animals.

Learn more about DDT:

https://brainly.com/question/16616238

Help please
ASAP
Earth and space

Answers

Answer: a, suspension

Explanation:

What’s a common element among personality


A) they’re administered by psychologist


B) they’re self-reporting


C) there all scientific


D) they all use common formula

Answers

Answer:

They all use common formula

A)they’re administered by psychologist

If an mRNA codon reads GAU, its complementary
anticodon on the tRNA will be

A. TUC
B. CUA
C. AUG
D. CAG

Answers

The answer for this question is D

CSI Miami: Using DNA to Solve a Robbery

The year is 2023. You are a detective for the Miami Dade Police Department. You’re on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the man’s blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run.

Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person.

On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.

methionine-leucine-proline = Protein that causes DARK SKIN
methionine-leucine-leucine = Protein that causes LIGHT SKIN

valine-proline-proline-lysine = Protein that causes GREEN EYES
proline-leucine-valine-proline = Protein that causes BLUE EYES
proline-lysine-proline-proline = Protein that causes BROWN EYES

lysine-arginine-threonine-valine-serine-serine = BLOND HAIR
lysine-arginine-threonine-valine-serine-cystine = BLACK HAIR
lysine-arginine-threonine-valine-serine-valine = BROWN HAIR

asparagine-isoleucine-arginine = CURLY HAIR
asparagine-asparagine-isoleucine = STRAIGHT HAIR

leucine-arginine-glutamic acid-arginine = BIG NOSE
leucine-asparagine-arginine-glutamic acid = SMALL NOSE
leucine-asparagine-asparagine-glutamic acid = MEDIUM NOSE

proline-tyrosine-tyrosine-(stop) = SMALL EARS
proline-proline-tyrosine-(stop) = MEDIUM EARS
proline-tyrosine-phenylalanine-(stop) = BIG EARS
Step 1: Decode the DNA into mRNA
Step 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.
Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with.

DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC
| | |
AUG
mRNA:

Protein Sequence:
1. Methionine 2. 3.
4. 5. 6.
7. 8. 9.
10. 11. 12.
13. 14. 15.
16. 17. 18.
19. 20. 21.
22. 23. 24.

Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?


Step 5: Answer the following wrap-up questions:
1) When you performed step 1, what enzyme were you imitating?
2) In step 2, what molecule would have brought the amino acids that the codons asked for?
3) In step 2, what molecule would have helped the amino acids line up and attach to one another?
4) In step 2, what connected the amino acids together?

Answers

AUGCUACUUCCGUUAGUUCCCAAGAGGACAGUUUCAUGUAAUAUCCGUCUGAAUCGCCAACCUUACUUUUAG. that’s the DNA transcribed

How does the sociocultural approach view the importance of ethnicity, gender, culture, and socioeconomic status in the development of personality?

Answers

Answer:

individualism and collectivism. Personalities are not influenced by cultural setting. Culture, gender, and ethnicity contribute to the development of personality according to the sociocultural approach. ... Sociocultural theorists would agree that family and environment are key factors in personality development.

--teya

The nose plays many important roles in the conduction of air into the lungs. Air entering the nose from the body’s exterior is very different from the air within the body and lungs. All BUT ONE describes how incoming air is changed by the structure of the nose and nasal passages.


A) As air passes over the mucous membranes, it is warmed and humidified.

B) The olfactory epithelium contain neurons, which conduct sensory signals to the brain.

C) Hairs and mucus on the interior of the nose also catch any solid debris before it can enter the lungs.

D) The convoluted inner structure of the nose increases the surface area of the respiratory tract and forces air to contact the mucous membranes lining the nasal cavity.

Answers

C) Hairs and mucus on the interior of the nose also catch any solid debris before it can enter the lungs.

Where can tephra be found?

Answers

Answer:In the troposphere

Explanation:

pls mark as brainliest!

How do green plants produce their own food?​

Answers

Answer:

Photosynthesis

Explanation:

The process by which land plants produce their own food using sunlight and carbon dioxide is known as photosynthesis. The leaves of green plants contain chlorophyll, which absorbs sunlight for producing food. This food is then used by the plant itself as well as other animals, including humans.

Which of these are recommended for preventing some std/sti’s

Answers

Answer: condom is a very good way to prevent stis

Explanation:

Most times Condoms are recommended for preventing STD

Evidence for coordinated stasis is found in _____.

Answers

Answer:

Evidence for coordinated stasis is found in the fossil record.

Explanation:

i hope it's help

PLS HELP ASAP!! WILL MARK AS BRAINLIEST!!

1. Types of reproduction in microorganisms and examples
2. Which bacteria could be neutralophile?
3. Which microorganisms in your body may be halophiles?
4. Classification according to how they obtain carbon.

Answers

Answer no. 1:

1) binary fission or splitting into two cells (like bacteria)

2) budding or developing outgrowths (like yeast)

3) reproduction using gametes to recombine DNA (like Plasmodium)

4) mitosis, eukaryotic cell division, similar to binary fission (like the micronucleus of the ciliates)

Answer no. 2:

Sorry, don't have any idea.

Answer no. 3:

Most human intestinal halophilic and halotolerant prokaryotes belong to the Firmicutes, Proteobacteria, and actinobacteria phyla.

Answer no. 4:

Carbon can be classified as primary, secondary, tertiary, or quaternary depending on the number of carbon atoms it is bonded to.

What would happen if someone injected tapwater directly into their blood stream?​

Answers

Answer:

cause your blood cells to become hypotonic possibly leading to death.

Answer:

The plasma will get diluted and it would cause blood cells to become hypotonic which could lead to death. But, the bigger issue is that you're using tap water which is not considered sterile and could lead to infections and other problems

Explanation:

What is heat?
A. Heat is the energy needed to change the temperature of 1 g of a substance by 1°C.
B.Heat is the average kinetic energy of the particles of a substance.
C.Heat is the total energy of a substance due to the movement of its particles.
D.Heat is the energy that flows between two substances of different temperatures.

Answers

Answer:

D

Explanation:

heat is the energy that flows between two substances of different temperatures

Answer:

D

Explanation:

Heat is the energy that flows between two substances of different temperatures.

How many amino acids must be obtained in the diet because they cannot be made by the body? 2 5 10 20How many amino acids must be obtained in the diet because they cannot be made by the body? 2 5 10 20

Answers

Of total 20 amino acids, 9 amino acids cannot be synthesized in our bodies and we need to take them in through our diets. These are called essential or indispensable amino acids. Essential amino acids are: Histidine, Isoleucine, Leucine, Lysine, Methionine, Phenylalanine, Threonine, Tryptophan and Valine.

Answer:

C or 10

Explanation:



Help me please I only have 5 minutes left
Earth and space

Answers

density sorted im guessing ??

Ecosystem function relies on the flow of nutrients from one _________ to another in a cycle. Group of answer choices Country Chemical Reservoir Species Altitude

Answers

Ecosystem function is highly dependent on the flow of nutrients from one species to another in a cycle.

What is an ecosystem?

An ecosystem refers to a biological community that typically consists of both living organisms (biotic factors) and the physical environment (abiotic factors) in which they interact.

What is a species?

A species can be defined as a biological classification of related organisms with similar characteristics that are capable of breeding with one another in a cycle.

Generally, the proper functioning of an ecosystem is highly dependent on the flow of nutrients from one species to another in a cycle and as such determines their ability to survive.

Read more on ecosystem here: brainly.com/question/15971107



1 How long after the formation of Earth did the first life appear?
2 Suggest how we know when the different kinds of organisms first appeared on
Earth.
Fears ago
mple animal-like
red.
3 Up to about 3000 million years ago, there was no oxygen in the Earth's
atmosphere. Today, about one fifth of the atmosphere is oxygen gas.
Use the information on page 6 to suggest what caused this change.

Answers

Answer:

1.After 10 years

2.we have our ancestors who see it

3.the change was caused by the trees and the good nature surrounds our planet

Note that science believe that every living organisms on earth is made by bacteria

In most normal human somatic cells, telomeres shorten with each division.

a. True
b. False

Answers

It should be a. True

What exaclty is a mutation?

Answers

Answer:

A Mutation occurs when a DNA gene is damaged or changed in such a way as to alter the genetic message carried by that gene.

Why do you get a sugar rush immediately after
eating candy?
A. because your LIVER is working to detoxify the candy before it
poisons you
B. because candy is composed primarily of STARCHES which are
quickly broken down by enzymes
C. because your taste buds are reacting to the candy and are
overwhelmed by how good it tastes
D. because candy is composed primarily of SIMPLE SUGARS which
are quickly broken down by enzymes

Answers

Answer: D  because candy is composed primarily of SIMPLE SUGARS which are quickly broken down by enzymes

Explanation: The sugar in it -- called a simple carbohydrate -- is quickly turned into glucose in your bloodstream. Your blood sugar levels spike. Simple carbs are also found in fruits, veggies, and dairy products.

Answer:

Your answer is D.

Explanation:

he discovery of mitochondrial DNA (mtDNA) had no effect on which area of scientific investigation?

Answers

Answer:

A diseased cell is no longer able to produce proteins.

Explanation: The discovery of mitochondrial DNA (mtDNA) had no effect on the study of cork bark.

What are some ways that dioxins affect health? What is AhR and what does it do?

Answers

Answer:

Dioxins are highly toxic and can cause cancer, reproductive and developmental problems, damage to the immune system.

The aryl hydrocarbon receptor is a protein best known for its role in mediating toxicity.

The AhR has roles in regulating immunity, stem cell maintenance, and cellular differentiation.

Explanation:

Alexis has a plant with white spots on it. He thinks it might have a chemical burn. What should he do?

a Add commercial fertilizer with Calcium
B. Add commercial fertilizer with Potassium
C. All of the above
D. Dilute the fertilizer with water

Answers

D. dilute the fertilizer with a base such as water

In the above diagram of a plant cell, what is the function of structure 1?
A.
captures light energy and performs photosynthesis
B.
is the site of protein and lipid synthesis and controls cell transport
C.
contains genetic information and serves as the control center of the cell
D.
serves a variety of secretory, excretory, and storage roles

Answers

Answer:

C.

contains genetic information and serves as the control center of the cell

Explanation:

i hope it's help

Describe three ecological benefits of preserving rainforest ecosystems discussed in the
lesson

Answers

Answer:

Explanation:

Benefits of rainforest ecosystems. 1. Preservation of species. Because they are so biodiverse, healthy rainforest ecosystems are the perfect places to preserve huge numbers of species that would otherwise be endangered.

Rain forest ecosystem have several advantages like preserve species, biodiversity is high etc.

what are the types rainforest ecosystem ?

The major constituents of a rainforest ecosystem are tall evergreen trees, it is formed due to heavy annual rainfall, high temperature, poor quality soil and rich in biodiversity.

There are different types of rain forest such as Tropical rainforests which is present near to the equator, the climate is hot and humid.

Temperate rainforests present in extreme temperate zones, close to coastal areas and the climate is  cooler than tropical rainforests.

Third is  Flooded forest where dry forest can be flooded by heavy rains or due to tidal river surrounding the forest, climate is highly humid.

Lowland rainforests refers to either tropical or temperate present near to valley. Cloud forests or Montane rainforests is located on the top of mountain top, partially in cloud.

Finally, mangrove forests are also  called as mangrove swamps, trees are waterlogged ground.

Learn more about rain forest ecosystem, here:

https://brainly.com/question/20997855

#SPJ2

Other Questions
Translate the sentence into an equation.Six less than the product of 4 and a number equals 2 .Use the variable c for the unknown number. ways in which gender stereotype can be broken Dana hopes to start her own business after graduation this summer. In an effort to learn as much as she can about small business management, she talked to four friends who each offered their advice. Which suggestion is likely to help her the most? At EHS, for every 6 students who like rap music, 14 do not. Whatpercent of the students like rap? Ok, so im thinking of starting a small business should i dobeaded jewelry candle makinglip gloss name each indicated part of the algebraic expression 4x + y/3 - 2.34:-2.2: 1/3:y/3: An airplane flies170 miles in 2 hours42 minutes. What isits average speed inmiles per hour? People tint windows dark to encourage __________.Multiple choice question.A)transmissionB)absorptionC)reflectionD)transfusion What is the distance between (0, 0) and (-7, -3)? Round your answer to the nearest tenth. The graph below shows y as a function of x.What is the relationship between x and $y$ in the graph?A As x increases, y increases.B As x increases, y decreases.C As x increases, y increases, then y decreases, then y increases again.D As x increases, y decreases, then y increases, then y decreases again. A wise mechanical engineering graduate began saving money for early retirement by depositing $1400 per month into a fixed rate account that pays 6% per year compounded semiannually. If she started saving 1 month after she started working, what is the expected value of the account at the end of 30 years Really Easy Points!!!-Define potential PLS HELP I NEED TO TURN THIS IN SOON Identify the standards and practices that traditional journalists believe are important. ~giving brainliest for answering this one question~ I was not in class when we did this and i have no idea what the answer is so if someone could help that would be wonderful Do you agree with Jefferson's interpretation of the First Amendment's meaning? Why or why not? With respect to the lobes of the brain, the frontal lobe is involved in ________ and the occipital lobe is the final destination for ________. The complex external covering composed of two or three layers found on the majority of bacteria is termed the cell Multiple choice question. i need help, im about to have a meltdown