Do American citizens in the territories get to vote for President?


No


Yes

Answers

Answer 1

Answer:

no

Explanation:

Answer 2
Uh I think it’s a no

Related Questions

Opponents of the National Popular Vote proposal argue whose interests would not be represented anymore? CHECK ALL THAT APPLY


Criminals


Under age voters


Registered voters


Legal immigrants

Answers

1 and 2

Explanation:

Opponents of the National Popular Vote proposal argue registered voters interests would not be represented anymore. The correct option is C.

What is National Popular Vote proposal?

The National Popular Vote proposal ensures that the president receives the most votes from all citizens of the United States. States pledge their electoral votes to the person who receives the most popular votes.

The only group that opponents could argue would not have their interests represented among the options listed is registered voters, because they are the only ones who can vote.

Underage voters are barred from voting, as are immigrants regardless of legal status because they are not American citizens, and criminals are barred from voting because their voting rights have been suspended.

Thus, the correct option is C.

For more details regarding National Popular Vote proposal, visit:

https://brainly.com/question/7048155

#SPJ2

To what extent is it necessary for people to engage in conflict to protect authority, security, or freedom?

Answers

When it violates either you or someone else's rights.

Which was a disagreement about government representation in the antebellum era?

Creoles wanted more power than English-speaking citizens.
Democrats wanted only white males with land to be represented.
Farmers wanted equal representation to more populated cities.
Whigs wanted equal voting rights for women and free people of color.

Answers

Answer:

B) the democrat one

Explanation:

Answer:

Democrats wanted only white males

Explanation:

I need a republican. Plz give me a reason on why your on your side

Answers

1. The direct intentional killing of a defenseless innocent child in the womb is an abomination. Sixty million-plus since 1973. Democrats voted to deny care for children in botched abortions. Trump is the most pro-life president ever who believes that life is precious and begins at the moment of conception. He is decreasing the number of abortions by withholding funds for abortions in America. Biden will increase the number of abortions by doing away with the Hyde Amendment and using taxpayer dollars to pay for them. He will also codify Roe v. Wade into federal law. Let’s not forget, to kill is against God’s Fifth Commandment. And for us Catholics, the United States Bishops Conference says, “The threat of abortion remains our preeminent priority because it directly attacks life itself.”

2. During President Trump’s first year in office he signed an executive order upholding religious liberty and the right to engage in religious speech. On May 29, 2019, House Democrats put through a bill that limited religious freedom. Religious organizations would be forced to violate their beliefs or shut down on the basis of discrimination.

3. In May 2019 the Trump administration finalized a rule to protect individuals and health care institutions from discrimination on the basis of their exercise of conscience in Health and Human Services federal programs. Obama and Biden felt no obligation to respect peoples’ consciences. They defunded a program at Catholic charities in Philadelphia to aid women in trafficking because they would not refer these women for abortions. Don’t forget Hobby Lobby and the Little Sisters of the Poor having to go to the Supreme Court to defend their conscience. There are many more examples.

4. Democrats are for socialism. Socialism is evil and can lead to communism. The latest country to try it was Venezuela; the people there are starving. Bernie Sanders is a socialist; Biden owes him.

5. Trump supports school choice to help poor children to get ahead. Democrats? No, they need the teachers’ union’s contributions for their campaign coffers.

6. Trump is for law and order. All cities that are on fire and being looted are run by Democrats. Many Democrats support defunding the police in New York and Chicago, and poor Black children and adults are dying. Murder rates are way up without police.

7. President Trump appointed 200 federal judges who will interpret the Constitution as written. Democrats will approve judges who are activists and will further the Democratic agenda. This is the only way Democrats can advance their agenda because people won’t vote for it.
Work is a valued thing, we shouldn’t just be giving out money to anyone because they just sit around. People in America work so hard for there money to get taxed and given to people on the left.

is an agricultural system which a renter farms land owned by someone else. Commercial farming The plantation Sharecropping Tenant farming​

Answers

Answer:

Tenant farming

Explanation:

The definition of it is this: A system in which a person lives on and farms land owned by someone else. In the South, tenants were different from sharecroppers. Tenants often brought their own tools and animals and paid the landowner a fixed sum of cash.

Tenant farming​ is an agricultural system in which a renter farms land owned by someone else.  Thus the correct option is D.

What is Tenant farming​?

In a system known as tenant farming, farmers cultivate crops or rear livestock on a rented property, agreeing to pay a set amount before knowing how much money they would make.

In England and Wales, renting is very common. In one type of arrangement called sharecropping, the landowner provides the tenant with all of their capital and may also oversee the job.

In a tenant farming system, landowners provide their property along with labor from tenant farmers. Landowners also frequently provide some operating money and administration which helps them in better crop production.

Therefore, option D is appropriate.

Learn more about Tenant farming​, here:

https://brainly.com/question/30838490

#SPJ2

I need HELP!!! I will comment the link to the google doc. It is due tomorrow

Answers

Answer: Ok, I can help ✨

h t t p s : / / d o c s . g o o g l e . c o m / d o c u m e n t / d / 1 n K _ P s L- 6 k Y 3 N 7 t I 7 5 G F 3 I 5 8 J 4 5 n i Q Z S x _ F 1 a w r T u C b s /e d i t ? u s p = s h a r i n g

What I’m confused what is it

what was the worst part of the fugitive slave law?
1. free black men in the north could be taken back to the south as a slave
2. slave owners could travel north and reclaim their slaves
3. northerners refused to help return run away slaves
4. northerners were forced to help with slavery
I need help again!​

Answers

Answer:

the answer is one

Explanation:

because this is one the worst cases  the  free black man  just travel for a long time and they can just become salves again

one is the answer i’m sure if it

Which of the following amendments address crime and punishment in the United States? i. 5th Amendment ii. 6th Amendment iii. 7th Amendment iv. 8th Amendment v. 9th Amendment A. i only B. ii and iv only C. i, ii, iii, and iv only D. ii, iii, iv, and v only

Answers

Answer:

C. i, ii, iii, and iv only

Answer:

Its C

Explanation:

Read the excerpt from "Woman's Rights to the Suffrage." It was we, the people; not we, the white male citizens; nor yet we, the male citizens; but we, the whole people, who formed the Union. And we formed it, not to give the blessings of liberty, but to secure them; not to the half of ourselves and the half of our [descendants], but to the whole people – women as well as men. And it is a downright mockery to talk to women of their enjoyment of the blessings of liberty while they are denied the use of the only means of securing them provided by this democratic-republican government – the ballot. Which fact supports Anthony's opinion that all adults should have the right to vote we, the whole people, who formed the Union. they are denied the use of the only means of securing them . . . And it is a downright mockery to talk to women . . . not to give the blessings of liberty . . .

Answers

Answer:

The answer to this is A.

Explanation:

Answer:

The Answer is A.

Explanation:

This is the only answer that makes any sense. I looked at the question and instantly knew, A!

Hope this helps you!!

50 POINTS Or take the stance of someone opposing women's suffrage. Why would you think that women should not be allowed to vote? What would you have done to try and keep the status quo where women did not cast ballots.

Answers

Answer:

i think women should vote

but if you need an answer maybe do that women would not understand whats going on bc they just stayed home and cooked

Explanation:

Harriet Bishop was the first public-school teacher in Minnesota.

True
False


Hans Mattson was the first governor of the Minnesota Territory.

True
False



Transportation to Minnesota Territory included cars, steamboats, and canoes.

True
False


Before statehood, Minnesota did not control its own finances.

True
False


The three branches of government are legislative, executive, and judicial.

True
False

Answers

Answer:

Pls Mark me

Explanation:

1. True

2. False

3. False

4.  True

5. True

Answer:

Here is another answer

Explanation:

What would happen to a civilization if it ran out of resources?

Answers

If a civilization ran out of resources, it would slowly but surely die.

Answer:

Okay so it would definitely die.

Explanation:

Okay so when a civilization runs out of resources, it becomes a competition of survival (hence "Survival of the Fittest") Take us humans. If we ran out of vital resources, we would turn against each other to survive. It might sound like some would survive, however we would all just turn against each other until we destroy ourselves.

Which policy was supported by the federalist but not the democratic republicans?

Answers

Answer:

a

Explanation:

i did i t

Answer: Building a larger U.S. military

Explanation: I took the quiz :)

Where were most telegraph lines built during the antebellum era?

along waterways
along rail lines
along subway lines
along roadways

Answers

Along water ways. Sorry if I’m wrong
Most telegraphs during the antebellum era/ 18th century were built along railroad lines.

which phrase best completes the diagram
Please help, I already got one question wrong, so I would like to get this question correct. thanks.

Answers

Answer: A or D

Explanation:

i did this question i forgot if it was A or D tho sorry

according to the declaration of independence what have the colonists been asking the king to do

Answers

Answer:he colonists believed that King George III and the Parliament limited the colonists' individual rights by the acts that they passed. The colonists believed that their rights were limited by being taxed on various goods and services while at the same time, the money from these taxes did not benefit the colonies.

Explanation:

Answer:

he colonists believed that King George III and the Parliament limited the colonists' individual rights by the acts that they passed. The colonists believed that their rights were limited by being taxed on various goods and services while at the same time, the money from these taxes did not benefit the colonies.

Help me pls
Use your ideas and knowledge to list and answer questions about civic duties and responsibilities.

Answer each of the following questions with at least two complete sentences:
4. What does it mean to be a good citizen?


5. What is the difference between a civic duty and a civic responsibility? Be sure to give an example for each to help explain.


6. When have you experienced a civic duty or responsibility? You may describe the example you wrote in your CAP file.


7. Why is it important to a community for people to have good citizenship?


8. What could happen if people do not fulfill a civic duty or responsibility? Give a specific example.

Answers

The first one: Being a good citizen means helping your community. It also means following rules and being thoughtful.

Reconstruction ended with the O withdrawal of the military. O Republican takeover of Congress. O Democratic takeover of Congress. O Compromise of 1887.​

Answers

Answer:

Compromise of 1877

Explanation:

The Compromise of 1876 effectively ended the Reconstruction era. Southern Democrats' promises to protect civil and political rights of blacks were not kept, and the end of federal interference in southern affairs led to widespread disenfranchisement of blacks voters.

It is Compromise of 1887

A citizen’s strong loyalty to his city-state enabled Greeks to unify. true or false

Answers

Answer:

Mountains and seas brought the Greek city-states together. Citizens of city-states put the needs of the city-states above their own. A citizen's strong loyalty to his city-state enabled Greek to unify. The lack of unity among Greek city-states made Greece easier to conquer.

False because it’s false

wait... who is Catherine Medici??? in ur own words plz

Answers

She was an italian noble woman and also she was the queen of France from 1547-1559

Answer:

Italian-born French queen, regent and mother of three kings of France. She was a powerful influence in 16th century France, particularly during the Wars of Religion.

Caterina Maria Romola di Lorenzo de Medici was born in Florence on 13 April 1519. Her father was Lorenzo de Medici, Duke of Urbino and ruler of Florence and her mother was Madeleine de la Tour d'Auvergne, cousin of Francis I, King of France.

Catherine's mother died when she was two-weeks-old and her father soon afterwards. In 1533, at the age of 14, Catherine's uncle Pope Clement VII arranged her marriage to the duke of Orléans, second son of the king of France.

A year after their marriage, the duke began a long affair with Diane de Poitiers. Diane remained a dominant force in his life for the next 25 years, leaving Catherine sidelined. It was not until ten years after their marriage that Catherine gave birth to their first child. This greatly improved the queen’s position and the couple eventually had seven surviving children.

In 1536, the duke of Orléans became heir to the throne. Eleven years later he was crowned Henry II of France. Unfortunately it was to be a short reign as Henry died in a jousting accident in 1559, thrusting Catherine onto the political stage. Their eldest son Francis was proclaimed king, but died after less than a year. Then in 1560, their second son Charles was crowned, aged just ten years old. Catherine acted as regent for the young king and as a result dominated Charles throughout his reign.

She at first adopted a conciliatory policy towards the Huguenots (French Protestants), but in 1562 civil war broke out in France, marking the beginning of the series of conflicts which became known as the French Wars of Religion.

In 1572, in an effort to bring reconciliation, Catherine arranged the marriage of her daughter Marguerite to the Protestant Henry, King of Navarre. During the wedding celebrations in Paris, the Huguenot leader, Coligny, was murdered, as were hundreds of other Protestants who had gathered for the wedding. This became known as the St Bartholomew’s Day Massacre, in which Catherine was probably involved.

Charles IX died in 1574 and Catherine's favourite son Henry succeeded as Henry III of France. She continued to play a central role in government and made further fruitless attempts to reconcile the opposing sides in the ongoing civil war.

Catherine died on 5 January 1589 and was buried next to her husband in the church of St Denis in Paris.

Explanation:

did report made 96.9 plz mark brainlist

WILL GIVE BRAINLIEST!!!!

What purposes did the Code Noir serve? Check all that apply.

It established laws for slaveholders to follow.
It set out to control the behavior of enslaved workers.
It outlined punishments for enslaved workers who broke rules.
It established laws for free people of color to follow in society.
It outlined laws for the interaction of whites and free people of color.

Answers

Answer:

It established laws for slaveholders to follow.

Explanation:

hope i could help :)

Answer:

It established laws for slaveholders to follow.

Explanation:

Hope this helps

Select all that apply.

In what ways were monasteries very helpful during the medieval times?

They provided military support to nobles.
They preserved ancient manuscripts.
They cared for people.
They made sure everyone supported the local kings.
They offered safe haven to anyone.

Answers

They provided military support to nobels

They made sure everyone supported the local kings

Answer.) 1 and 4 I think lemme know if I got it right!

Help please history Knights During Feudal Times

Answers

The answe is within the brain.

Halppppppp

I need to interview ten people. You just have to rank six leadership qualities from 1 (most important) to 6 (least important). Please help lol

Answers

Answer:

okkk

Explanation:

Honesty- 6

fair judgment-3

hard working-5

the ability to make tough decisions-1

being humble-4

loyalty and sacrifice-2

This was actually hard for me to pick, they are all important qualities every leader should have.

Have a wonderful day!!!

You can put my name as Aerin.

Honesty - 5

Fair Judgement - 4

Hard Working - 6

The ability to make tough decisions - 4

Being Humble - 5

Loyalty and sacrifice - 6

(Sorry if all of them were pretty high I just think they are all kind of important)

What Type of boeing 747 operates Air force one

747-100
747-200
747-300
747-400
747-8i

Answers

Answer:

The 2nd one, your welcome

Answer:

747-200

Explanation:

This is the newest type of boeing that operates at at Air force one.

How was the country changing in the late 1800s? (hint: choose 2)


There was no leisure time


Many people moved to the cities (population explosion!)


New technology was not being developed

Answers

Answer:mew technology was not being developed

Explanation:

The second and third answer

I will give brainliest!!! And 5 stars and everything T-T
Royal governors were ___ by the king of England.

Answers

Answer:

Ruled

Explanation:

Make an inference about why the winter at Valley Forge was so important for Washington and his troops.

Answers

It was so important because that is how they hide from the enemy that’s how they won battle

Answer: The winter at Valley Forge was so important for Washington and his troops because after they survived, their spirits were lifted and they were better trained.

Explanation:

Please help this is urgent!!!

The 15th amendment protects individual rights by:

A. granting citizenship to all people born in the country.

B. making it illegal to hold people in slavery.

C. guaranteeing citizens' right to vote no matter their race.

D. outlawing poll tax requirements to vote.

Answers

Answer:

c

Explanation:

The right of citizens of the United States to vote shall not be denied or abridged by the United States or by any State on account of race, color, or previous condition of servitude.

the answer is c, according to the web and my quiz that i just took

What influence did Julius Ceaser have on the Roman Republic, or on history in general? Describe both negative and positive influences as appropriate.

Answers

Answer:

Julius Caesar was a renowned general, politician and scholar in ancient Rome who conquered the vast region of Gaul and helped initiate the end of the Roman Republic when he became dictator of the Roman Empire.The death of Julius Caesar ultimately had the opposite impact of what his assassins hoped. Much of the Roman public hated the senators for the assassination, and a series of civil wars ensued. In the end, Caesar's grandnephew and adoptive son Octavian emerged as Rome's leader. He renamed himself Augustus Caesar.The Romans created a republic after overthrowing a king. Romans are also responsible for creating a legal code written down which protected the rights of all citizens. This document was influential in the creation of the Bill of Rights in the Constitution.How did Julius Caesar change the world? Julius Caesar was a political and military genius who overthrew Rome's decaying political order and replaced it with a dictatorship. He triumphed in the Roman Civil War but was assassinated by those who believed that he was becoming too powerful.

Explanation:

your welcome

Other Questions
Find the length of side b in the right triangle below. Round to the nearest tenth if necessary A. 8B. 16 C. 32 D. 64 Which thesis is stronger? Explain your answer using complete sentences.A) Globalization has created many new jobs in India. B) Globalization has had a positive effect on India because it offers new solutions to poverty. What is your best memory? In the story behind Barz vets with PTSD basin new Warzone with little support how did David Carlson time at war change him A scientist walking through a forest recorded as integers the heights of 5 trees standing in a row. She observed that each tree was either twice as tall or half as tall as the one to its right. Unfortunately some of her data was lost when rain fell on her notebook. Her notes are shown below, with blanks indicating the missing numbers. Based on her observations, the scientist was able to reconstruct the lost data. What was the average height of the trees, in meters? why did washington did not want political parties??why did jefferson did want political parties?? Which ion has smaller size and why?Mg++ or Na+. Which statement about Monsoons in South Asia is true?Question 1 options:They are seasonal winds that bring rain. They occur all year. Another term for them in Hurricane. They only occur in India Explain why the slope of the line drawn in part C must be negative. what is the value of the product 2/3 * 9/5 Several important physical needs that organisms receive from the environment are:water, minerals, carbon dioxide, and oxygenthe balance of nature, minerals, carbon dioxide, and oxygenwind, minerals, carbon dioxide, and oxygen anyone good with english i need help What is the value of x? 1. 1422. 713. 1524. 76 what is the equation of aline that passes through the point (4,-8) and has a slope of -1/2? 7x+5y=40 2x+4y=-4Solve the system of equations What is the value of X in this DiagramI will give a brainlist for the correct answer what happened to elizabeth proctor by the end of the story Function A is represented by the equation y = 4x + 6.Function B is a linear function that goes through the points shown in thetable.x 13 4icy 3 9 12 18Which statement correctly compares the rates of change of the twofunctions?A. The rate of change of function A is 6.The rate of change of function B is 3.B. The rate of change of function A is 4.The rate of change of function B is 6.OC. The rate of change of function A is 6.The rate of change of function B is 6.D. The rate of change of function A is 4.The rate of change of function B is 3 GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were How many grams are in a sample of 0.55 mol of K?