Answer:
The second growth phase
Explanation:
i did the quiz
Explain how a moderate
increase in (1) light and (2) carbon dioxide could
affect photosynthesis in a desert plant. Address
both conditions for full credit.
Answer:
1) Moderate increase in light increases the photosynthetic rate
2) Moderate increase in CO2 increases the photosynthetic rate
Explanation:
Photosynthesis is a metabolic process unique to the cells of autotrophic organisms such as green plants. It is the process whereby they synthesize their food in form of sugars (glucose) in the presence of sunlight energy.
The photosynthetic process, although comprises of several reactions and processes, is generally described as the reaction of carbon dioxide, water and light to give glucose and oxygen gas as products. The general equation is as follows:
6CO2 + 6H2O + light → C6H12O6 + 6O2
Since both light (needed to supply energy) and CO2 (carbon source) are reactants of the photosynthetic process, a MODERATE INCREASE in them will INCREASE THE RATE AT WHICH PHOTOSYNTHESIS OCCURS.
Is it normal for a period to not come on for 1 month im worrying
Answer: It depends. Your period might sometimes come some days later or earlier because of stress or another thing. It should be fine if it comes one or two days after the date it is supposed to come, if not, well, you might be pregnant or some health problem that has delayed it.
What's a quote in the poem "two kinds" that encouraging
1. Given the original DNA nucleotide sequence, which of the following is a mutated sequence showing a point mutation?
Original: G C A T T A A C G A C A
a. G C T T A A C G A C A U
b. G C A A T A A C G A C A
c. C G T A A T T G C T G T
d. G C C A T T A A C G A C
Answer:
The correct answer is - b. Original: G C A T T A A C G A C A
Explanation:
Point mutation is the mutation where change takes place in one of the nucleotides or single base by one of three ways that are insertion, deletion, or substitution of the nucleotide. In insertion, one extra single base is added to the original sequence, In the deletion one of the single base pair is deleted from the single sequence, and in substitution one base is switched with the complementary base.
In all the options, there are more than nucleotide is altered except option B where T is altered with A and cause mutation.
Original sequence: G C A T T A A C G A C A
mutated sequence: G C A A T A A C G A C A
Why do scientists organize living things into groups?
Explanation:
Biologists use classification to organize living things into groups so that organisms are easier to study. ... Speicies with similar evolutionary histories are classified more closely together.
Answer:
Biologists use classification to organize living things into groups so that organisms are easier to study. ... Speicies with similar evolutionary histories are classified more closely together.
Explanation:
Interview 10 different people
Ask:
–Which city they live in. Must be different cities.
–If the person recycles
–If they recycle – what? (paper, plastic, metal, etc.)
–How they recycle – home bin, recycling center, etc.
–If NOT – why? What would encourage recycling?
Answer:
ok
Explanation:tahy all were like why
Explain why it is important to be skeptical of statistical results reported in the media.
Answer:
Firstly, many statistics are taken from a small group of people used to represent the general population. Say a news channel reported that 81% of teenagers in America were planning on going to a four-year college. This statistic is most likely taken from a randomly selected group of teenagers, and calculated with a margin of error. Because after all, it's nearly impossible to survey every single teenager in America. This can lead to some statistics that are not really representative of the actual percentage of people. This only gets more likely the larger the general population being "surveyed" is. Another reason is that the media is not always truthful with statistics. Things can be altered and not many people will notice. Hope this helps!
8)
Carbon dioxide is removed from the atmosphere by
A)
the burning of forests
B)
the burning of fossil fuels
C)
respiration
D)
photosynthesis
The gene frequency for a particular trait in a population was determined to be 80% A (dominant allele) and 20% a (recessive allele). Fifty years later, the gene frequency was determined to be 60% A and 40% a. What does this change most likely indicate about the gene pool?
Answer:
Explanation:
Microevolution is a change in the frequency of gene variants, alleles, in a population, typically occurring over a relatively short time period.
Population genetics is the field of biology that studies allele frequencies in populations and how they change over time.
Allele frequency refers to how common an allele is in a population. It is determined by counting how many times the allele appears in the population then dividing by the total number of copies of the gene.
\text{Frequency of allele }AFrequency of allele Astart text, F, r, e, q, u, e, n, c, y, space, o, f, space, a, l, l, e, l, e, space, end text, A ==equals \dfrac{{\text{Number of copies of allele }A \:{\text {in population}}}}{\text{Total number of }{\text{copies of gene in population}}}
Total number of copies of gene in population
Number of copies of allele Ain population
start fraction, start text, N, u, m, b, e, r, space, o, f, space, c, o, p, i, e, s, space, o, f, space, a, l, l, e, l, e, space, end text, A, start text, i, n, space, p, o, p, u, l, a, t, i, o, n, end text, divided by, start text, T, o, t, a, l, space, n, u, m, b, e, r, space, o, f, space, end text, start text, c, o, p, i, e, s, space, o, f, space, g, e, n, e, space, i, n, space, p, o, p, u, l, a, t, i, o, n, end text, end fraction
The gene pool of a population consists of all the copies of all the genes in that population.
This change in the gene pool most likely indicates the existence of microevolution. It generally includes the implications of various evolutionary forces like migration, genetic drift, mutation, natural selection, etc.
What is Microevolution?Microevolution may be characterized as a series or sequence of changes that may lead to alterations in the frequency of genes. Due to this, the overall gene pool may get influenced within a particular time.
This methodology and the complete process of alteration in the gene pool with respect to the evolutionary forces are studied under population genetics. It is the field of biology that significantly involves the detailed study of alleles and their frequencies among populations.
According to the context of this question, the gene frequency for a particular trait in a population was determined to be 80% A (dominant allele) and 20% a (recessive allele). Fifty years later, the gene frequency was determined to be 60% A and 40% a. This is due to the microevolution.
To learn more about Microevolution, refer to the link:
https://brainly.com/question/1386312
#SPJ3
PLEASE HURRY! IM BEING TIMED!! 5:42!!!
Explain why the biodegradation of plastic might be more hazardous to the environment than the presence of plastic as marine
debris.
Answer:
simplified: the toxic breakdown of plastics have potential to do more damage than marine debris.
Explanation:
while plastic marine debris is hazardous and dangerous to marine organisms, the toxic breakdown products of plastics have the potential to do even more damage.
The biodegradation of plastic might be more hazardous to the environment than the presence of plastic as marine debris, as the plastic in the marine environment causes many harmful effects to the animals, such as when it enters the marine animal's body.
What are the hazards of marine pollution?Because of the world's overpopulation, rapid industrialization pollutes various natural sources such as water bodies and land, but chemicals, plastics, and debris cause more pollution in marine or water bodies that have a variety of negative impacts on marine life and ecosystems. It causes habitat damage, and contamination of seafood has a negative impact on human health as well as economic growth.
Hence, the biodegradation of plastic might be more hazardous to the environment than the presence of plastic as marine debris, as the plastic in the marine environment causes many harmful effects to the animals, such as when it enters the marine animal's body.
Learn more about marine pollution here.
https://brainly.com/question/23722171
#SPJ2
When a chemical reaction does not occur, what happens to the atoms of the two substances?
If a population is steady at its carrying capacity, but then a group of organisms from that species moves in to the same space occupied by the original population, what will happen to the carrying capacity of the combined population?
Answer:
It will remain relatively stable
Explanation:
The carrying capacity (k) of an environment is a factor that represents the maximum number of organisms of a particular species such environment can support based on the resources it has.
Below the carrying capacity, the population of a species still has the potential to increase due to resource availability, and above the carrying capacity, the population has the potential to reduce due to the overstretching of the available resources. Factors that keep the population from expanding significantly beyond the carrying capacity include competition for resources, natural disasters, disease outbreaks, etc.
Hence, if a population is steady at its carrying capacity and a group of organisms from that species moves into the same space occupied by the original population, the carrying capacity will only increase temporarily before factors such as competition and natural disasters operate to bring the carrying capacity to the normal level.
which group contains only molecules that are each assembled from smaller organic compounds
Proteins, DNA, fats, starch
A plant's water supply is now deeper in the ground.
What process allows the roots to grow longer?
A. interphase
B. photosynthesis
C. mitosis
D. meiosis
Why are primary producers also referred to as autotrophs? plzzzz help!!!
a) They are able to change chemical energy into light energy.
b) They are able to transfer energy throughout an ecosystem.
c) They are able to release energy from other organisms in an ecosystem.
d) They are able to transform energy from an unusable form to a usable form.
Answer:An autotroph is an organism that can produce its own food using light, water, carbon dioxide, or other chemicals. Because autotrophs produce their own food, they are sometimes called producers. ... Most autotrophs use a process called photosynthesis to make their food.
Explanation:
Answer:
d) They are able to transform energy from an unusable form to a usable form.
Explanation:
Auto- means "self" and -troph means "feeding," so autotrophs are "self-feeders."
In order to maintain a high level of performance, what types of foods do you think an athlete should eat right before a race? Select one.
Answer:
According to me it's energy bars and fruits, but u can give ur own opinion.
Besides organic pollutants, dead zones are also affected by nitrogen compounds. Denitrifying bacteria in the anoxic dead zones can use nitrates and nitrites as electron acceptors, thereby generating nitrous oxide, a potent greenhouse gas. What is the term used for this process?
a. assimilatory nitrogen reduction
b. dissimilatory nitrogen reduction
c. nitrification
d. nitrogen fixation
Answer: The correct answer to the question bus option B
DISSIMILATORY NITROGEN REDUCTION .
Explanation: When we talk about Dissimilaritory nitrogen reduction we simply mean an alternate form of respiration which occurs in the anoxic grown bacteria example purple photosynthetic bacteria.
Dissimilaritory nitrogen reduction is actually a type of denitrification which entails the denitrifying bacteria using nitrates or nitrites as electron acceptor and then reduce them to nitrogen gas. A series of intermediates are formed in this process of which Nitrous oxide is one of them, Nitrous oxide is a green house gas.
However,the main difference we can see between assimilatory and dissimilatory nitrogen reduction is that in the assimilatory pathway of nitrate reduction, ammonia will be formed which is utilized for the biosynthesis as a source of nitrogen. While in dissimilatory pathway, ammonia formation do not take place.
Photosynthesis results in *
An oxygen-rich atmosphere
Glucose, a food for plants
Glucose, the source of energy for all living things on earth
All of the above
What will happen to the rate of photosynthesis, if the temperature is

Caves being formed by acid rain dissolving underground limestone
Answer:
If this is a yes or no question, I'm gonna say no... Please let me know if I am wrong.
Help I'm confused!
This is the beginning sequence of the first exon in the mRNA sequence:
AUGAAGCUCUUUUGGUUGCUUUUCACCAUU
Give the DNA/genomic sequence it was transcribed from.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Where is the cell body for the preganglionic neuron found?
Some preganglionic neuron synapses with the cell body of the
postganglionic neuron in the
ganglion
These ganglia are linked together to form the
Name some of the tissue/organs are innervated by these neurons:
Other preganglionic neurons pass through the sympathetic trunk and
synapse with the postganglionic neuron anterior to the spinal cord in
ganglia.
The axons of these preganglionic neurons are called
nerves.
Name some of the tissue/organs are innervated by these neurons:
The sympathetic nervous system also send neurons directly from the
spinal cord to synapse onto the
gland.
This would cause the release of
into the
blood.
What would be some effects?
Is the sympathetic preganglionic neuron long or short?
Is the sympathetic postganglionic neuron long or short?
PARASYMPATHETIC NERVOUS SYSTEM
From where in the CNS do sympathetic neurons originate?
What cranial nerves carry parasympathetic impulses?
3
Answer:
Location of the Cell Bodies Also, the cell bodies of the preganglionic neuron are located in the brain or spinal cord while the cell bodies of the postganglionic neuron are located in the ganglion. Axons of Preganglionic and Postganglionic Neurons
WILL MARK BRAINLIEST WORTH 20 POINTS
Which of the following limit cell size? Select all of the answers that apply.
A. ratio of surface area to volume
B. rate of moving materials across the cell's membrane
C. efficiency of using the information in a cell's DNA
D. efficiency of DNA replication and cell division
Answer:
Okrtyuiop[poiuytfdfghjkl;lkjhgfcvbnm,
Explanation:
How are solids, liquids, and gases different?
Answer:
Gases, liquids and solids are all made up of atoms, molecules, and/or ions, but the behaviors of these particles differ in the three phases.
Explanation:
gas are well separated with no regular arrangement. liquid are close together with no regular arrangement. solid are tightly packed, usually in a regular pattern.
High average daily temperature and heavy annual precipitation are found in a?
Answer:
Rainforesr
Explanation:
Which action is the best way to turn an electromagnet off?
Answer: 1) The strength of the electromagnet increases → Place a magnetic core inside the coil of wire
2) The electromagnet turns off → Turn off the battery supply
3) The poles of the electromagnet reverse → Change the direction in which the current flows
Explanation:
when current passes through a coil it behaves a an electromagnet.
Magnetic field strength is given by
B = μ N I
N is no of turns and
I is the current through coil
μ is permeability of the medium or core in the coil.
1). Magnetic core increase permeability μ so it will strengthen magnetic field:
B = μ N I
2). When the battery turns off current becomes zeroi.e I=0
So B = μ N * 0
⇒ B = 0
so electromagnet turns off
3). Direction of magnetic field can be determine by right hand rule, i.e curl the fingers in the direction of current, thumb will point in the direction of north pole.
so changing current direction will change direction of magnetic field.
Which part of the flower accepts the pollen
Answer:
the part which allows the pollen is the stigma
two____ cells are created through mitosis. 100 POINTS!!!
0 sperm
0 identical
0 different
Answer:
The answer is identical.
Explanation:
Mitosis is a nuclear division giving rise to a genetically identical cells.
Answer:
identical
Explanation:
mitosis forms daughter cells, the copy of identical chromosomes
Will give brainlest and a heart if correct
Answer:
A
Explanation:
i have done the test
How is detritus important to wetland ecosystems?
Answer:
Detritus is important too wetland ecosystems, because it provides a food source for a variety of aquatic organisms.
Explanation:
Plants' stem and leaves break down in the water and make organic material that is fed by the fishes and provide a good source of the organic compound used for energy and is important for wetland ecosystems.
What is detritus?In the water, dead plant leaves and stems degrade into small particles of organic material called "detritus." This enriched material feeds a variety of small aquatic insects, shellfish, and small fish.
Which then in turn feed larger predatory fish, lizards, amphibians, birds, and mammals. Detritus, in ecology, is matter composed of leaf and other plant parts, animal remains, waste products, or other organic particles.
Much energy may flow through to the detritus food chain as opposed to the grazing chain or pathway detritus, in ecology, waste products, and other organic debris that falls over onto soil or into bodies of water.
Therefore detritus is organic material made from a leaf of plants that are consumed by small fish and small fish is eaten by larger fish provide important to the wetland ecosystem.
Learn more about detritus, here:
https://brainly.com/question/28720920
#SPJ6
What is photosynthesis?
Explanation:
Photosynthesis is the process of the plant making it's food