The most complex level of organizational hierarchy that climate change could potentially affect is Earth's biosphere.
What is biosphere?
The biosphere refers to the global ecological system that encompasses all living organisms and their interactions with the physical environment. It includes various interconnected ecosystems, such as forests, oceans, grasslands, and deserts, along with the diverse array of species and their habitats.
Climate change, with its wide-ranging impacts on temperature, precipitation patterns, and other environmental factors, can disrupt ecosystems and alter the distribution and abundance of species within the biosphere. These changes can have cascading effects on communities of organisms, populations of species, and the overall functioning of ecosystems. Therefore, the biosphere represents the highest level of organization that climate change can potentially impact.
Learn more about biosphere, here:
https://brainly.com/question/20531374
#SPJ5
which two molecule do green plants use to make glucose
Answer:
Carbon Dioxide and Water
What type of RNA acts as a temporary copy of DNA's instructions and provides details on how to assemble a polypeptide
chain?
Answer:
messenger RNA (mRNA)
Explanation:
mRNA or messenger RNA is one of the three types of RNA molecules (the other being tRNA and rRNA) that is specifically responsible for carrying genetic information previously encoded and stored in the DNA into the ribosomes for translation to occur.
The process of translation results to the synthesis of amino acid sequences, which make up a polypeptide. Hence, it can be said that mRNA is that type of RNA that acts as a temporary copy of DNA's instructions and provides details on how to assemble a polypeptide chain.
What could be inferred from suntans?
Group of answer choices
A tan might indicate sun damage to the skin.
Tanning produces healthier skin.
A tan strengthens the elastic in the skin.
Tanning makes skin look younger.
Answer:
A tan might indicate sun damage to the skin.
Explanation:
Tanning is the process by which the skin is exposed to the ultraviolet rays that comes from the sun with the purpose of producing a dark-brown coloration called a TAN.
A tan achieved by exposure to the sun can actually indicate that a person's skin is undergoing damage from the UV rays of the sun, hence, the skin responds by producing a protein called melanin, which protects the skin and later forms the dark coloration- tan. From this explanation, tan is got in response to a damaging signal received by the cell, hence, a tan might indicate sun damage to the skin.
mango tree and Vanda ecological interaction
Answer:
The relation between a mango tree and an orchid is commensalism. An orchid growing on the branch of a mango tree is an epiphyte. Epiphytes are plants growing on other plants which, however, do not derive nutrition from them.
hope it helps
hiii! ill give brainliest if u answer this :))
Why are enzymes important?
1. They contain the genetic material.
2. They speed up chemical reactions.
3. They bring water into the cell.
4. They help the cell maintain its shape.
natural selection selects ___________ less fit individuals .
natural selection selects ____________ viable individuals .
Answer:
viable
Explanation:
Only the animals who are able to survive will live long enough to reproduce
There are 20 different types of amino acids, which can result in a wide variety of protein shapes. Which of the following is not a function associated with proteins?
A. providing structure
B. speeding up chemical reactions as enzymes
C. information storage
D. all of these are functions of proteins
Answer:
c information storage
Explanation:
information is stored in dna which provides the instructions required to make proteins . proteins do not store information
PLEASE HELP WILL MARK BRANLIEST!
Fungi and bacteria are examples of _____:
A. decomposers, B. producers, C. consumers, D. demagorgans
Answer:
a. decomposers
Explanation:
Bacteria and fungi are best classified as decomposers. They decompose the bodies of dead plants and animals.
pls help ASAP i will mark brainliest
Answer:
ok
i can help you ..............
Explanation:
drop in the air pressure objects small mammals and insects in many ways mice and mouse are good weather indicators people who spend a lot of time outdoor have obeserved that field mice come out there holes squeak and run around before a storms appearce.
Please help the picture is above I’ll mark as brainliest.
Answer: The last one im pretty sure.
Explanation:
CAN u pLZZ help me anwser my question
Which of the substances below are PRODUCTS of the overall chemical reaction of
photosynthesis?
A. ammonia
B. Unitrogen
C. carbon dioxide
D. water
oxygen
sugars
Answer:
essentially glucose and oxygen are the products of photosynthesis
Explanation:
A cactus is adapted for life with limited water. The green
part of this cactus is its stem. Its stems are fleshy and
have a thick waxy coating.
What are two ways the structure of this cactus's stem helps the plant survive?
A. It takes in minerals from the soil.
B. It prevents water loss.
C. It carries out photosynthesis.
D. It holds the plant in the ground.
Answer:
i think its B hope it helps
Explanation:
Adaptations are the alteration that allows the survival of the fittest. The adapted structure of the cacti allows it to take the minerals from the soil and prevents water loss. Thus, options A and B are correct.
What are adaptations of cactus?Adaptation is seen as the modified physical and chemical characteristics that allow the organism to survive in stressful conditions. A cactus has adapted spines, roots, waxy skin, and deep-layered stomata.
These adaptation has allowed the cactus to survive the harsh conditions of dessert. The wide fibrous roots allow it to draw nutrients and minerals from the soil.
The thick, expandable stem with deep-layered stomata prevents the loss of water from the surface in high-temperature conditions and keeps the plant hydrated.
Therefore, options A and B. the adapted attributes of cacti prevent water loss.
Learn more about adaptations here:
https://brainly.com/question/12501143
#SPJ5
What two taxon make up the scientific name? Pick all that apply.
Kingdom
Phylum
Class
Order
Genus
Family
Species
Answer:
genus and species are combined to form a scientific nameAnswer:
GenusSpeciesExplanation:
The word is genus and species. These two taxon make up the scientific name.
Para cada una de las historietas "la penicilina, Francisco Redi y Louis Pasteur" indiquen:
a) ¿Qué estudió el científico?
b) ¿Cuál fue el descubrimiento?
c) indica con que viñetas se relacionan cada paso del método científico, puedes subrayarla o transcribirla
Answer:
a)
Explanation:
je suis ask teacher
Starch is a polysaccharide used as a component of cell walls in plants.
True
False
Answer:
false
Explanation:
is type of carbohydrates
False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.
What are structural component of cell wall?Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.
Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.
Learn more about cell wall, here:
https://brainly.com/question/965751
#SPJ2
What is a scavenger?
A) an organism that lives in or on another organism
B) an organism that feeds on dead matter
C) an organism that produces food from the energy in sunlight
D) organisms that eat plants and grasses
The correct answer is B) an organism that feeds on dead matter.
A scavenger is an organism that obtains its food by consuming dead or decaying organic matter.
These organisms play a crucial role in ecosystems by recycling nutrients and breaking down organic material that would otherwise accumulate.
Scavengers are often attracted to carcasses or decaying organic material, where they feed on the remains of dead plants or animals.
Scavengers can include a variety of organisms from different taxonomic groups, such as vultures, hyenas, flies, beetles, and certain species of bacteria and fungi. They have adaptations that allow them to consume and digest dead matter efficiently.
By consuming dead organic material, scavengers help in the decomposition process, returning nutrients to the ecosystem and maintaining ecological balance. They prevent the accumulation of dead matter, which can lead to the spread of diseases and the release of harmful substances.
In contrast to the other options, which describe different ecological roles or processes, option B accurately characterizes the feeding behavior and ecological role of scavengers in consuming dead matter as a source of nutrition.
Therefore, the correct answer is B.
For more such answers on scavenger
https://brainly.com/question/259333
#SPJ8
Question # 1: Which shape is CLOSEST to the truth for the shape of planet 1 point
Earth?
1. Which object best represents a true scale model
of the shape of Earth? (1) a table tennis ball
(2) a football (3) an egg (4) a pear
Option 1
Option 2
Option 3
Option 4
Answer:
(1) a table tennis ball
Explanation:
The earth will most closely resemble any type of sphere or circular ball.
Because conservation means using fewer natural resources and reducing wastes, it helps
a.
slow overpopulation and grow food.
b.
prevent habitat destruction and reduce pollution.
c.
prevent biodiversity and destroy species.
d.
stop exotic species and create habitats.
Please select the best answer from the choices provided
A
B
C
D
Answer:
a
Explanation:
just did it
Answer:
the answer should be "B"
the tRNA for GUCAUCGAUCGAUCGGAUGCC
Answer:
CAGUAGCUGCUAGCCUACGG
Explanation:
A and U are opposites
C and G are opposites
so you would do the opposite that would correspond.
two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad
Answer:
A. wheter the producers are located on land or in the water.
Question 2 of 10
What is the term for the condition of the atmosphere in a given area at a
given time?
A Weather
B. Latitude
C Climate
D. Altitude
SUBMIT
Need ASAP
Answer:
A .Weather
Explanation:
The state of atmosphere over an area at any point of time is known as weather. It is the state of the atmosphere over short periods of time. ... Precipitation, humidity, temperature, pressure, cloudiness, and wind are the basic atmospheric conditions that make up the weather of a region.
Which type of weather is associated with the eye of the hurricane?
calm
stormy
windy weather
Answer:
A windy weather
Explanation:
Tree will began to swayed
What is the
Magnification
of a plant cell?
Answer:
400x
Explanation:
Macroscopic urinalysis collects data on all EXCEPT which of the following?
A. turbidity
B. color
C. pH
D. odor
Answer:
The correct answer is - pH.
Explanation:
Macroscopic urinalysis is the evaluation of the physical appearance of the urine. It evaluates the amount, color, odor and clarity, and other physical appearances or characteristics.
It also checks if there are any clotting, or sediments are found in the sample. It does not include the pH of the urine in the microscopic urinalysis. It is recommended to check underlying medical conditions.
What is the source of the carbon dioxide that is used in photosynthesis?
Answer:
Photosynthetic cells
Explanation:
photosynthetic cells are diverse and are found in green plants during the process of photosynthesis cells use carbon dioxide and energy from the sun to make sugar molecules and make oxygen
What is the function of the class of macromolecules represented in the following diagram
Answer:
lods ayarn na:)
Explanation:
The four classes of biological macromolecules are (1) Proteins, (2) Lipids, (3) Carbohydrates, (4) Nucleic Acids.
Proteins are made up of amino acids linked by peptide bonds. They have multiple functions, depending on the number of amino acids and its specific sequence. They serve as major workers composing motor and structural elements in the cell. They can also function as catalytic proteins (enzymes), as well as helpers for storage, signal, transport, reception, defensive, and contractile tasks.
Lipids are made up of fatty acids (a carboxylic acid with a hydrocarbon chain + terminal carboxyl group) and glycerols (organic compound made up of multiple hydroxyl groups). They are a hydrophobic compound that are used for energy storage, thermal insulation, protection, and chemical messengers. Lipids also regulate membrane permeability and aid in fat soluble vitamin production.
Carbohydrates are made up of monosaccharides which build up a polysaccharide (carbohydrates). Monosaccharides are basic sugars which cannot be broken down anymore by water (glucose, fructose, galactose). Carbohydrates' major functions include energy provision, blood glucose regulation, biological processes recognition, and breakdown of fatty acids for ketosis prevention.
Nucleic acids are made up of nucleotides which are organic molecules that forms the Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA). Their structure consists of a nitrogenous base, pentose, and an attached phosphate group. The function of nucleic acids are the creation and storage of genetic information.
Conchoidal fracture in minerals creates a smooth _______________________ surface that is similar to the surface of a conch or seashell.
Conchoidal fracture in minerals creates a smooth, [tex]\sf\purple{curved}[/tex] surface that is similar to the surface of a conch or seashell.
[tex]\circ \: \: { \underline{ \boxed{ \sf{ \color{green}{Happy\:learning.}}}}}∘[/tex]
Many functions in the body are controlled by
special compounds. Which statements about
these compounds do you think are true? Check
all that apply.
The body can make all of the compounds it
needs.
.
The body gets energy from some
compounds.
um
Some compounds determine physical
characteristics.
Answer:
Its either a or b
Explanation:
A say the body can make all of the compound its need
my suggestion compound are made up of water ,mineral protein carbs and fat
our body produce little nutrients so we need to eat to get the nutrients we need
im am going with b
B is the answer
Meiosis makes sperm and egg cells which are called
A. Gametes
B. Somatics
C. Spindles
Answer:
A. Gametes
hope it is helpful to you ☺️
I’m 98% sure it’s c but it might be B could someone check pls
Answer:
I think C
Have a great day
[tex]#Liliflim✌[/tex]
Answer:
Explanation:
A