Evaluate Claims A student claims that the four types of macromolecules make up all of the important compounds of the human body. Provide evidence and reasoning to support or refute this claim.

Answers

Answer 1

Answer:Hi I’m sorry I’m not helping I just really need to answer something for points so I can ask a question

Explanation:

It’s due tomorrow and it’s for a grade so im freaking out


Related Questions

Give two examples each of centripetal force​

Answers

Answer:

Spinning a ball on a string or twirling a lasso: Here the centripetal force is provided by the force of tension on the rope pulls the object in toward the centre. Turning a car: Here the centripetal force is provided by the frictional force between the ground and the wheels.

Explanation:

A h e t e r o z y g o u s parent is crossed with a h o m o z y g o u s recessive parent. Complete a Punnett Square and answer the questions below.

Answers

I Am Not Sure What Your Asking?

Answer:

Black Fur & Black Eyes: 4/16

Black Fur & Red Eyes: 4/16

White Fur & Black Eyes: 4/16

White Fur & Red Eyes: 4/16

4 is 1/4 of 16

Explanation:

I hope this helps

If researchers use only the number of coral found in dive 1, calculate the predicted population of brain coral in a reef that covers 120m squared. i forgot how to do this :))

Answers

Answer:

40

Explanation:

Each quadrant measured = 2m X 2m

Length = (2+2+2) m = 6m

Width = 2m

Total area = area of (quadrant 1 + quadrant 2 + quadrant 3)

Total area = 6 * 2 = 12 m^2

Number of coral found in dive 1 = 4

Population density = 4/12 = 1/3 (0.33)

Now,

=> Population density = (Predicted population)/area

=> 1/3 = PP/120

=> PP = 120/3 = 40

So, the required answer is 40.

The predicted population of brain coral in a reef covering 120m² is ; ≈ 40

First step : Calculate the value of the default population density

Population density = population size (dive 1) / total area

                                                                = 4 / 12  = 0.33

Total area ;

∑ Area of each reef quadrant = length * width = 2 * 2 = 4m²

∴ Total area = 4 + 4 + 4 = 12m².

Final step : Determine the value of the predicted population of brain coral

Population density = ( predicted population ) / predicted area

0.33 = ( pp ) / 120m²

Predicted population ( pp ) = 0.33 * 120

                                                 = 39.6 ≈ 40 brain corals

Hence we can conclude that the predicted population of brain coral is 40

Learn more : https://brainly.com/question/16495075

If you were to leave a pan of water outside for several days what would happen
Write a scientific report on the what would happen, and how would they relate to the tree states of water: solid, liquid and gas.

At least 3 paragraphs.​

Answers

Answer:

the water would evaporate and the water would be gone

Explanation:

hope this helps

Which name is best for my new bearded dragon?
1. Chili
2. Mushu (dragon from Mulan)
3. Blue (dino from Jurassic Park)

Answers

Mushu is a definitely answer

Answer:

Mushu

Explanation:

what is the percentage of thymine in wheat ?

Answers

Answer:

27.1% or 27% if rounded

Explanation:

Hope this helps ya!!

hurry due in five min plz help

Answers

Answer:

b

Explanation:

Answer:

d

Explanation:

I hope that helped!

What two electron carrying particles does the electron transport chain use to get the energy it needs to
make ATP?

Answers

The proton gradient produced by proton pumping during the electron transport chain is used to synthesize ATP. Protons flow down their concentration gradient into the matrix through the membrane protein ATP synthase, causing it to spin (like a water wheel) and catalyze conversion of ADP to ATP.

Using the diagram below, how many electrons will Be have if it is a neutral atom?

Answers

the answer is six electrons

SOMEONE I NEED HELP!! I'M STUCK 30 POINTS!!!!!
PART A
An advantage of mitosis is the result of genetically____________.
A. Different
B.Identical

PART B
cells being reproduced
A. slowly
B. Quickly

Answers

I think A for part 1 and B for part 2 but not sure
Part A : Mitosis creates identical copies of the original cells.

Part B : That question is worded weirdly so I don’t understand that.

Roots grow into cracks and rocks and break them apart. This is an example of what type of weathering?

Rust occurs when iron chemically reacts with oxygen. what type of weathering is this an example of?

Answers

Answer:

Wedging (for the first one)

Explanation:

4) How does climate affect ecosystems and the life within them?

Answers

Answer:

Explanation:Climate is an important environmental influence on ecosystems. Changing climate affects ecosystems in a variety of ways. For instance, warming may force species to migrate to higher latitudes or higher elevations where temperatures are more conducive to their survival.

Explain how one celled organisms get oxygen in water.

Answers

Answer:

n unicellular organisms, oxygen diffuses across the cell membrane into the cell. Carbon dioxide diffuses out of the cell once the concentration of carbon dioxide is higher inside the cell than it is outside of the cell. Some micro-organisms, including some bacteria and fungi, can survive without oxygen.

Explanation:

question one : when two plates converge, they are what?

a) moving away from each other
b) moving towards each other
c) sliding along each other
d) colliding with each other

question two : when two plates converge, they are what?
a) moving away from each other
b) moving towards each other
c) sliding along each other
d) moving towards, then moving away from each other

question three : during sea-floor spreading, how would you describe the age of rocks the further away from the ridge?
a) the rocks are youngest the further away you move from the ridge
b) the rocks are oldest the further away you move from the ridge
c) the rocks are the same age no matter how far away from the ridge you move
d) the rocks do not age

Answers

Q1. They are d. colliding with each other.

Q2. They are c. sliding along each other (in a processes called “subduction”)

Q3. Rocks furthest away from the ridge are b. oldest the further away you move from the ridge. The youngest rocks can be found closest to the mid ocean ridge.

ASAPPPP!!!!
Write step by step instructions for making a protein

Answers

Protein synthesis is the process in which cells make proteins. It occurs in two stages: transcription and translation. Transcription is the transfer of genetic instructions in DNA to mRNA in the nucleus. It includes three steps: initiation, elongation, and termination.


What would be the temperature at a depth of 2500 km?


Answers

Answer:

4700 Degrees Celsius

Explanation:

WILL GIVE BRAINLIEST!!!!!!
An amino acid is to a polypeptide as:

glycogen is to glucose.

testosterone is to a steroid hormone.

a phospholipid is to a plasma membrane.

a nucleotide is to a nucleic acid.

Answers

Answer would be D!
Mark brainliest

fill in the complementary bases according to the base-pair rule.

a | t | c | c | g | a | t | a | g | c | t | t | a | g

Answers

t/a/g/g/c/t/a/t/c/g/a/a/t/c

Christopher Columbus used the presence of suspended seaweed in the ocean to
determine how far away he was from the coast of the Africa. Seaweed, or kelp, is
placed under the Protista kingătom. What type of protist did Columbus see?
a)protozoa
b) slime mold
c) water mold
d) brown algae

Answers

Your answer is d he saw brown algae

Brown algae is the type of protist Columbus saw. Therefore, option (D) is correct.

What are brown algae?

Seaweed is a type of brown algae, which is a type of protist that belongs to the kingdom Protista. Brown algae are large, multicellular algae that grow in the ocean and are often found in shallow, warm waters. They have a complex structure and are made up of many cells that are organized into tissues and organs. Brown algae are photosynthetic, meaning they use sunlight to produce energy and nutrients, and they are an important source of food and habitat for many marine organisms.

Other types of protists include protozoa, which are single-celled, heterotrophic organisms that can move using cilia, flagella, or pseudopodia; slime molds, which are fungi-like organisms that can move and are often found in moist environments; and water molds, which are fungi-like organisms that can grow in water and can cause disease in plants and animals.

Learn more about brown algae, here:

https://brainly.com/question/8717436

#SPJ2

Unsaturated fat consists of which of these, Lipid, Carbohydrate, Protein, or Nucleic Acid

Answers

Answer:

Lipid is the most likely answer.

The law of___________explains how traits are inherited through generations.

Answers

Answer:

the law of inheritance

(HELP ASAP 15 POINTS)
Is the coloring of the peppered moths an example of competition, differential reproductive success, or inherited variation? Explain why.

Answers

Answer:

Peppered moths get their color in lieu to become the fittest among all so that they can survive easily.

Answer/Explanation:

Differential reproductive success.

When the Birch(white) trees were covered in soot(making them black). The black pepper months could blend in to the tree while the white moths stood out.

When the Birch(white) trees were clean and white. The white pepper moths could blend in to the tree while the black moths stood out.

This is an example of differential reproductive success. Who ever could blend in with the tree had the better genes because it made them difficult to be spotted. The other type of moth would be not so lucky, easily spotted an eaten. The better gene lead is "successful," because that moth could live longer because of its characteristics..

In eukaryotes the electron transport chain is composed of a series of electron carriers located in the blank of mitochondrion

Answers

Answer:

Facts that is right

Explanation:

In eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion

The electron transport chain is composed of four large, multiprotein complexes. These protein complexes are formed of a series of electron carriers.

These complexes are embedded in the inner mitochondrial membrane and two small diffusible electron carriers shuttling electrons between them.These transfer electrons from electron donors to electron acceptors via redox reactions and joins this electron transfer with the transfer of protons across a membrane.

Thus, in eukaryotes, the electron transport chain is composed of a series of electron carriers located in the inner membrane of the mitochondrion

Learn more about:

https://brainly.com/question/7135096

Which of the following is a pluton?
A. Pyroclast
O
B. D*ke (it's a type of rock not the slur)
O
C. Lahar
O
D. Lava flow​

Answers

Answer:

The correct answer is d*ke

Explanation:

I tried the other answer and got it wrong, this was the right one on the test.

Use the results of Demetri's experiment to explain why the color changed on some test strips but not others.

Answers

Answer:

I think it was the same due to all the tubes havign gluscoes in them. I think thats right.

Explanation:

Transcription: DNA to mRNA: 1. How many strands of mRNA are transcribed from the two "unzipped" strands of DNA? 2. If the following were part of a DNA chain, what mRNA bases would pair with it to transcribe the DNA code onto mRNA? G-G-A-T-C-G-C-C-T-T-A-G-A-A-T-C 3. If DNA Is described as a double helix, how should mRNA be described? 4. How are the accuracy of DNA and mRNA codes assured?
( help please)​

Answers

Answer:

what are u taking this on

GTA: TAA mRNA UCA : CAU: AUU tRNA AGU : GUA : UAA rRNA Serine Valine Stop You need to solve the entire DNA line and then answer the even numbered question below. 1) DNA GTA ATG AGT CAC CTG GCC GTA AAA CCT TAT AGA TAA ATC mRNA tRNA TRNA 2) 3) DNA mRNA tRNA rRNA 4) How many proteins were produced? ( ) TGAAGACCCATTATGTGCCTGTAATACCCAAGCTAGAAG How many proteins were​

Answers

Answer:

u want step by step?

Explanation:

Please Help me as soon as possible.

In camellia plants, flower color is controlled by a single gene with codominant alleles. A camellia plants with red flowers (RR) is crossed with a camellia plant with white flowers (WW). What are the expected phenotypes of the offspring of this cross?
A.
All will have red flowers.
B.
Half will have red flowers and half will have white flowers.
C.
All will have both red and white flowers.
D.
All will have pink flowers.

Answers

Answer:

The answer is; c

It is important to distinguish between codominance and incomplete dominance.

In incomplete dominance, the two alleles blend with each other in phenotype  giving offspring with intermediate phenotypes, hence offspring would produce pink flowers, in this case.

In codominance, both alleles are simultaneously expressed in phenotype in the offspring. Therefore flowers, in this case, would exhibit both red and white colors.

Explanation:

A substance only composed of one kind of atom is a(n) *

Answers

Element is your answer

Explanation it is on the periodic table

........ produces hormones and enzymes that aid digestion.

Liver

Gall bladder

Pancreas

Urethra​

Answers

Answer:

urethra

Explanation:

Answer:

Pancreas and liver

Explanation:

Other Questions
Which of these is an example of the system of checks and balances?A:The president can veto bills (laws) passed by CongressB:Congress can regulate industry.C:The Supreme Court has nine judges.D:Governors can pardon federal prisoners. Why would Spain want to keep New Spain and not let it become an independent nation Use Conformity and "Funny in Farsi" to answer questions 10-12. What is the Greatest Common Factor of 12 and 28O23064 Describe the relationship between predator and prey in a balanced ecosystem Trench warfare during World War I introduced new weaponry such as machine guns, hand grenades, and __________. Dr. Peabody contributed $5,000 in cash to the company. Which of the following statements is correct?A. Cash is debited $5,000; capital is credited $500.B. Capital is debited $5,000; cash is credited $5,000.C. Cash is credited $5,000; capital is credited $5,000.D. Cash is debited $5,000; capital is credited $5,000. Read the excerpt from Amy Lowells "Lilacs." What is the form of the poem?Lilacs,False blue,White,Purple,Color of lilac,You have forgotten your Eastern origin,The veiled women with eyes like panthers,The swollen, aggressive turbans of jeweled Pashas.Now you are a very decent flower,A reticent flower,A curiously clear-cut, candid flower,Standing beside clean doorways,Friendly to a house-cat and a pair of spectacles,Making poetry out of a bit of moonlightAnd a hundred or two sharp blossoms.Maine knows you,Has for years and years;New Hampshire knows you,And MassachusettsAnd Vermont.A. blank verseB. free verseC. lyricD. narrativeE. descriptive Erins classmate said that the program that they were working on is not running properly because the classmate accidentally put in commas where semi-colons should be. What kinds of errors does Erin need to fix?logic errorsdatabase errorsdebugging errorssyntax errors 4. All of the following are limiting factors to a population EXCEPT A. competition B. predation C. human disturbances D. immigration plzzzz help me!!!Find the total cost to the nearest cent.$49.95 pair of shoes; 5% tax Twice the sum of a number and 6 ismore than 84. Why is yo utu be down?(You restrict talking about yo utu be, really) If f(x) = 10, find x. Need help ASAP! If IN=2x+10 and AT=26, find x.A.) 12B.) 10C.) 6 D.) 8 50 POINTS GIVEAWAY!!!!!I am finally rank ambitious so I am making 50 points giveaway!To win them you just need to solve this:[tex] 9 - 3\div \frac{1}{3} + 1 [/tex]If your answer is right you will get a brainliest!GOOD LUCK!!! Un gas ideal ocupa un volumen de 4.00 m3 a una presin absoluta de 200 kPa. Cul ser la nueva presin si el gas es comprimido lentamente hasta 2.00 m3 a temperatura constante? whats the answer giving 25 points and braimliest It takes a groundskeeper 35 minutes to prepare a Little League baseball field for a game. It takes his assistant 45 minutes to prepare the same field. How long will it take if they work together to prepare the field? PLEASE HELPDavids French test scores are 87%, 88%, 82%, 83%, 88%, 86%, and 88%. His latest test score is 100%. Which measure (mean, median, or mode) will be most affected by his latest score? Explain.