Answer:
The oak tree in the lawn will grow faster because it doesn't have to compete with the other oak trees to gain sunlight because it is out in the open. So therefore it will grow taller because it has access to more sunlight.
Explanation:
Hope this helped
1.) Which of the following is not true of negatively supercoiled DNA?
A. Eases the separation of nucleotide strands during replication and transcription.
B. Allows DNA to be packed into small spaces.
C. Has less than 10 bp per turn of its helix.
D. Is more negatively charged due to additional phosphates per turn of the helix.
E. Is found in most cells.
2.)How many complete rotations would most likely correspond to a positively supercoiled DNA molecule that is 100 bp in length?
A.) 0
B.) 5
C.) 10
D.) 15
E.) 100
Answer:
1.
C. Has less than 10 bp per turn of its helix.
2.
D.) 15
Explanation:
Negatively supercoiled DNA
(deoxyribonucliec acid) is the twisting against the helical conformation which is a twist in a left handed direction that loose and straightens the helix at low twisting stress, and knot the DNA into negative supercoils at high twisting stress.
Supercoiling will occur where the DNA helix must uncoiled for the function of a macromolecular assembly.
Supercoiling allows DNA to be packed into small spaces, It allows for more negative charge and can be found in many cells. But it does not have less than 10 bp per turn of its helix.
15 rotations will correspond positively supercoiled dna molecule of 100base pair.
Which type of rock is formed by the processes the weather in the Erosian deposition compaction and cementation
A. Igneous
B. Sedimentary
C. Metamorphic
Which type of rock is formed by the processes of heat and pressure which change the rock into something new
A. Igneous
B. Metamorphic
C. Sedimentary
Which type of rock is formed by the processes of cooling and hardening (solidification)
A. Igneous
B. Sedimentary
C. Metamorphic
T or F
All rocks are made of minerals
A. Which of these statements is true
B. Rocks can only change on the earth surface
C. Rocks can change from one type to another over a very long period of time
D. Rocks can only change inside of the earth
E. Rocks never change
How does the sun impact the rock cycle
A. Energy from the sun heats the rock in earths mantle and outer core, causing rocks to change
B. Energy from the sun “bakes” The rocks on the surface changing them into a new type a rock
C. Energy from the sun affects the weathering and Erosion of rocks in the formation of sedimentary rocks
Besides the sun what is another source of energy which affects the rock cycle
A. Earths interior
B. Earths magnetic field
C. A giant heating blanket
Answer:
The answer is C. Metamorphic
Explanation:
High average daily temperature and heavy annual precipitation are found in a?
Answer:
Rainforesr
Explanation:
If a population is steady at its carrying capacity, but then a group of organisms from that species moves in to the same space occupied by the original population, what will happen to the carrying capacity of the combined population?
Answer:
It will remain relatively stable
Explanation:
The carrying capacity (k) of an environment is a factor that represents the maximum number of organisms of a particular species such environment can support based on the resources it has.
Below the carrying capacity, the population of a species still has the potential to increase due to resource availability, and above the carrying capacity, the population has the potential to reduce due to the overstretching of the available resources. Factors that keep the population from expanding significantly beyond the carrying capacity include competition for resources, natural disasters, disease outbreaks, etc.
Hence, if a population is steady at its carrying capacity and a group of organisms from that species moves into the same space occupied by the original population, the carrying capacity will only increase temporarily before factors such as competition and natural disasters operate to bring the carrying capacity to the normal level.
Which substance is a product of photosynthesis?
A.
Water
B.
Nitrogen
C.
Carbon dioxide
D.
Glucose
Answer:
glucose is the answer
Explanation:
glucose is the main product produced by photosynthesis
Complete the following statements:
• The LONGER the instrument, the_________
the PITCH.
•The SHORTER the__________instrument, the
the PITCH.
Answer:
longer is lower shortwe is higher
What is photosynthesis?
Explanation:
Photosynthesis is the process of the plant making it's food
Explain why it is important to be skeptical of statistical results reported in the media.
Answer:
Firstly, many statistics are taken from a small group of people used to represent the general population. Say a news channel reported that 81% of teenagers in America were planning on going to a four-year college. This statistic is most likely taken from a randomly selected group of teenagers, and calculated with a margin of error. Because after all, it's nearly impossible to survey every single teenager in America. This can lead to some statistics that are not really representative of the actual percentage of people. This only gets more likely the larger the general population being "surveyed" is. Another reason is that the media is not always truthful with statistics. Things can be altered and not many people will notice. Hope this helps!
1140 points!!!
Not joking!!!
Please solve as soon as you can!!!
Answer:
bruh its 5 points
Explanation:
why u always lyyyyyyyyyyyying
Do you usually drink bottled water why or why not if you could choose one alternative energy sources to develop which one would you choose why.
Answer:
Yea i drink water
Explanation:
its healthy
Caves being formed by acid rain dissolving underground limestone
Answer:
If this is a yes or no question, I'm gonna say no... Please let me know if I am wrong.
Help I'm confused!
This is the beginning sequence of the first exon in the mRNA sequence:
AUGAAGCUCUUUUGGUUGCUUUUCACCAUU
Give the DNA/genomic sequence it was transcribed from.
Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
When a chemical reaction does not occur, what happens to the atoms of the two substances?
Why are primary producers also referred to as autotrophs? plzzzz help!!!
a) They are able to change chemical energy into light energy.
b) They are able to transfer energy throughout an ecosystem.
c) They are able to release energy from other organisms in an ecosystem.
d) They are able to transform energy from an unusable form to a usable form.
Answer:An autotroph is an organism that can produce its own food using light, water, carbon dioxide, or other chemicals. Because autotrophs produce their own food, they are sometimes called producers. ... Most autotrophs use a process called photosynthesis to make their food.
Explanation:
Answer:
d) They are able to transform energy from an unusable form to a usable form.
Explanation:
Auto- means "self" and -troph means "feeding," so autotrophs are "self-feeders."
Which is the problem when using turbines to produce energy??
Answer:
C
Explanation:
only applicable answer
1. Given the original DNA nucleotide sequence, which of the following is a mutated sequence showing a point mutation?
Original: G C A T T A A C G A C A
a. G C T T A A C G A C A U
b. G C A A T A A C G A C A
c. C G T A A T T G C T G T
d. G C C A T T A A C G A C
Answer:
The correct answer is - b. Original: G C A T T A A C G A C A
Explanation:
Point mutation is the mutation where change takes place in one of the nucleotides or single base by one of three ways that are insertion, deletion, or substitution of the nucleotide. In insertion, one extra single base is added to the original sequence, In the deletion one of the single base pair is deleted from the single sequence, and in substitution one base is switched with the complementary base.
In all the options, there are more than nucleotide is altered except option B where T is altered with A and cause mutation.
Original sequence: G C A T T A A C G A C A
mutated sequence: G C A A T A A C G A C A
The Energy Policy Act of 2005 was for the most part a hard-path or business-as-usual proposal.
Which of the following is a characteristic of this act?
A)
It promotes the exploration and use of fossil fuels.
B)
It emphasizes energy quality.
C)
It relies mostly on renewable sources of energy.
D)
It promotes an increase in second-law efficiency.
E)
It has no effect on the environment.
Answer:
b is correct answer in my view I think if it's wrong then Correct me
It promotes the exploration and use of fossil fuels. Therefore, option (A) is correct.
What is The Energy Policy Act of 2005?The Energy Policy Act of 2005 was a controversial legislation that was passed by the US Congress in 2005. It had several provisions that were intended to promote the exploration and use of fossil fuels, such as oil, natural gas, and coal.
These provisions included tax incentives for the production and consumption of fossil fuels, as well as relaxed regulations on the exploration and extraction of these resources. The act was largely seen as a "business-as-usual" proposal, as it did not significantly shift the focus of US energy policy away from fossil fuels and towards renewable energy sources.
Learn more about The Energy Policy Act, here:
https://brainly.com/question/29410768?ref
#SPJ2
An epeirogenic change:
O creates very high mountians
O
leaves the crust undeformed
O
results in highly volcanic regions
occurs when rock layers are lifted out of sequence.
Answer:
leaves the crust undeformed
Explanation:
An epeirogenic change leaves the crust undeformed. It is significantly different from an orogenic change which makes the crust deformed.
This change produced by epeirogenesis is notable in stable continental regions called a craton. Long wavelength folds leaving the landform rolling and undulating are typical signatures of this deformational patterns. In an orogenic deformation, there is a noticeable change in the landform.A plant's water supply is now deeper in the ground.
What process allows the roots to grow longer?
A. interphase
B. photosynthesis
C. mitosis
D. meiosis
Using the data from the paraquat experiment, explain how you know that paraquat did not cause the coral bleaching.
Answer:
paraquat is a herbicide.
Explanation:
Paraquat did not cause the coral bleaching because paraquat is a herbicide which is used to kill weeds not algae. We know that coral have small algae attached to its body which is responsible for its colour so if we apply paraquat, it does not kill the algae and so coral bleaching did not occur. if we apply another chemical which kills algae so it causes coral bleaching and the coral becomes white.
Besides organic pollutants, dead zones are also affected by nitrogen compounds. Denitrifying bacteria in the anoxic dead zones can use nitrates and nitrites as electron acceptors, thereby generating nitrous oxide, a potent greenhouse gas. What is the term used for this process?
a. assimilatory nitrogen reduction
b. dissimilatory nitrogen reduction
c. nitrification
d. nitrogen fixation
Answer: The correct answer to the question bus option B
DISSIMILATORY NITROGEN REDUCTION .
Explanation: When we talk about Dissimilaritory nitrogen reduction we simply mean an alternate form of respiration which occurs in the anoxic grown bacteria example purple photosynthetic bacteria.
Dissimilaritory nitrogen reduction is actually a type of denitrification which entails the denitrifying bacteria using nitrates or nitrites as electron acceptor and then reduce them to nitrogen gas. A series of intermediates are formed in this process of which Nitrous oxide is one of them, Nitrous oxide is a green house gas.
However,the main difference we can see between assimilatory and dissimilatory nitrogen reduction is that in the assimilatory pathway of nitrate reduction, ammonia will be formed which is utilized for the biosynthesis as a source of nitrogen. While in dissimilatory pathway, ammonia formation do not take place.
PLEASE HURRY! IM BEING TIMED!! 5:42!!!
Explain why the biodegradation of plastic might be more hazardous to the environment than the presence of plastic as marine
debris.
Answer:
simplified: the toxic breakdown of plastics have potential to do more damage than marine debris.
Explanation:
while plastic marine debris is hazardous and dangerous to marine organisms, the toxic breakdown products of plastics have the potential to do even more damage.
The biodegradation of plastic might be more hazardous to the environment than the presence of plastic as marine debris, as the plastic in the marine environment causes many harmful effects to the animals, such as when it enters the marine animal's body.
What are the hazards of marine pollution?Because of the world's overpopulation, rapid industrialization pollutes various natural sources such as water bodies and land, but chemicals, plastics, and debris cause more pollution in marine or water bodies that have a variety of negative impacts on marine life and ecosystems. It causes habitat damage, and contamination of seafood has a negative impact on human health as well as economic growth.
Hence, the biodegradation of plastic might be more hazardous to the environment than the presence of plastic as marine debris, as the plastic in the marine environment causes many harmful effects to the animals, such as when it enters the marine animal's body.
Learn more about marine pollution here.
https://brainly.com/question/23722171
#SPJ2
which of the following is always true of animals that are products of sexual reproduction
[[[35 POINTS!!!]]]
A. They hatch from eggs.
B. They are nursed y their mothers.
C. They are identical to one of their parents.
D. They have genetic material from two parents
Answer:
Which of the following is always true of animals that are products of sexual reproduction?
Explanation:
They have genetic material from two parents.
.
They have genetic material from two parents is true about sexual reproduction.
What is sexual reproduction?
Sexual reproduction is the process of combining the genetic information of two individuals of the opposite sex to create new organisms. Genetic information is carried on chromosomes within the nuclei of gametes, which are specialized sex cells.
These gametes are called sperm in males and eggs in females. During sexual reproduction, two gametes participate in a fusion process called fertilization to create a fertilized egg.
The fertilized egg is the progenitor cell of the embryonic offspring and receives half of its DNA from each parent. In humans, the fertilized egg contains 46 chromosomes.
Therefore, They have genetic material from two parents is true about sexual reproduction.
To learn more about sexual reproduction, refer to the link:
https://brainly.com/question/7464705
#SPJ6
Who doesn't RSVP to Auggie's party
How is detritus important to wetland ecosystems?
Answer:
Detritus is important too wetland ecosystems, because it provides a food source for a variety of aquatic organisms.
Explanation:
Plants' stem and leaves break down in the water and make organic material that is fed by the fishes and provide a good source of the organic compound used for energy and is important for wetland ecosystems.
What is detritus?In the water, dead plant leaves and stems degrade into small particles of organic material called "detritus." This enriched material feeds a variety of small aquatic insects, shellfish, and small fish.
Which then in turn feed larger predatory fish, lizards, amphibians, birds, and mammals. Detritus, in ecology, is matter composed of leaf and other plant parts, animal remains, waste products, or other organic particles.
Much energy may flow through to the detritus food chain as opposed to the grazing chain or pathway detritus, in ecology, waste products, and other organic debris that falls over onto soil or into bodies of water.
Therefore detritus is organic material made from a leaf of plants that are consumed by small fish and small fish is eaten by larger fish provide important to the wetland ecosystem.
Learn more about detritus, here:
https://brainly.com/question/28720920
#SPJ6
Which action is the best way to turn an electromagnet off?
Answer: 1) The strength of the electromagnet increases → Place a magnetic core inside the coil of wire
2) The electromagnet turns off → Turn off the battery supply
3) The poles of the electromagnet reverse → Change the direction in which the current flows
Explanation:
when current passes through a coil it behaves a an electromagnet.
Magnetic field strength is given by
B = μ N I
N is no of turns and
I is the current through coil
μ is permeability of the medium or core in the coil.
1). Magnetic core increase permeability μ so it will strengthen magnetic field:
B = μ N I
2). When the battery turns off current becomes zeroi.e I=0
So B = μ N * 0
⇒ B = 0
so electromagnet turns off
3). Direction of magnetic field can be determine by right hand rule, i.e curl the fingers in the direction of current, thumb will point in the direction of north pole.
so changing current direction will change direction of magnetic field.
which is the least complex thing in our body
Answer:
cell
Explanation:
the smallest, least complex structure in an organism
the order from most complex to least complex - organism, organ system, organ, tissue, cell
Where is the cell body for the preganglionic neuron found?
Some preganglionic neuron synapses with the cell body of the
postganglionic neuron in the
ganglion
These ganglia are linked together to form the
Name some of the tissue/organs are innervated by these neurons:
Other preganglionic neurons pass through the sympathetic trunk and
synapse with the postganglionic neuron anterior to the spinal cord in
ganglia.
The axons of these preganglionic neurons are called
nerves.
Name some of the tissue/organs are innervated by these neurons:
The sympathetic nervous system also send neurons directly from the
spinal cord to synapse onto the
gland.
This would cause the release of
into the
blood.
What would be some effects?
Is the sympathetic preganglionic neuron long or short?
Is the sympathetic postganglionic neuron long or short?
PARASYMPATHETIC NERVOUS SYSTEM
From where in the CNS do sympathetic neurons originate?
What cranial nerves carry parasympathetic impulses?
3
Answer:
Location of the Cell Bodies Also, the cell bodies of the preganglionic neuron are located in the brain or spinal cord while the cell bodies of the postganglionic neuron are located in the ganglion. Axons of Preganglionic and Postganglionic Neurons
what is called traspiration ? explain the process of transpiration
Answer:
Transpiration is the process of water movement through a plant and its evaporation from aerial parts, such as leaves, stems and flowers. Water is necessary for plants but only a small amount of water taken up by the roots is used for growth and metabolism. The remaining 97–99.5% is lost by transpiration and guttation.
Answer:
Im here for pointz :D
#CarryOnLearning
Which process in the water cycle is directly affected by the warming of the ocean water?
Answer:
evaporation from the sea surface.
Explanation:
once enough heat is applied, the water will begin to evaporate.
hope this helps<3