Find the distance between the pair of points: (6,−3) and (1,0

Answers

Answer 1

Hi there!  

»»————- ★ ————-««

I believe your answer is:  

[tex]\sqrt{34}[/tex]

»»————- ★ ————-««  

Here’s why:

⸻⸻⸻⸻

[tex]\text{\underline{The distance formula is:}}\\\\d=\sqrt{(x_2-x_1)^2+(y_2-y_1)^2}[/tex]

⸻⸻⸻⸻

[tex]\boxed{\text{Calculating the answer....}}\\\\d = \sqrt{(1-6)^2+(0-(-3))^2}\\--------------\\\rightarrow d = \sqrt{(-5)^2+(3)^2}\\\\\rightarrow d = \sqrt{(25+9)}\\\\\rightarrow d =\boxed{ \sqrt{34} }[/tex]

⸻⸻⸻⸻

»»————- ★ ————-««  

Hope this helps you. I apologize if it’s incorrect.


Related Questions


2. What is the best estimate of the value of In 16?

Answers

Answer:

Hey your question is in incomplete

Step-by-step explanation:

k66jntynnu.uk8 677nunni.i7k78mi

A pizza has a radius of 7 inches. If it is cut into 6 equal slices, what is the area of each slice?

Answers

answer: each slide would be one sixth of the entire area; the entire area is (pi)(72).  

Do not use pi = 22/7 because that's untrue. It's approximately 3.1416; round off later!

hope this helps

First we need to find the area of the circle. The formula for the area of the circle is the radius squared times pi. So the entire area would be 49 pi. Then divide 49pi by 6. That is 8 1/6 pi. Then you can plug pi in. So the answer is approximately 25.6563400043

The Coordinate Plane
BRE
-2
В
The midpoint of AB = ([?],[ ])

Answers

Answer:

0,0

Step-by-step explanation:

what are the domain and range of this function?

Answers

Answer:

domain: all real numbers

range: {y | y ≥ 0}

find the measure of one interior angle in a regular 23-gon

Answers

Answer: A polygon with 23 sides has a total of 3780 degrees. total interior angles = (n - 2)180°, where n is the number of sides.

The measure of one interior angle of the given regular polygon with 23 sides is 164.3 degrees

How to calculate the sum of the interior angle of a regular polygon?

The formula which is used to calculate the sum of the angle of regular polygon is given by

sum of the interior angles = ( n - 2 ) × 180 degrees

Where,

n is the number of sides

According to the given question.

We have a regular polygon with 23 sides.

⇒ n = 23

Therefore,

The sum of the interior angles of the given regular polygon

= (23-2) × 180

= 3,780 degrees

So, the measure of one interior angle = [tex]\frac{3780}{23} = 164.3 degrees[/tex]

Hence, the measure of one interior angle of the given regular polygon with 23 sides is 164.3 degrees.

Find out more information about interior angle of a regular polygon here:

https://brainly.com/question/22408868

#SPJ3

On Tuesday, a local hamburger shop sold a combined total of 576 hamburgers and cheeseburgers. The number of cheeseburgers sold was three times the number of hamburgers sold. How many hamburgers were sold on Tuesday?

Answers

Answer:

check the picture

Step-by-step explanation:

I hope this helps

Which ordered pairs are solutions to the equation 5x+12y=12?

Answers

I found 3 order pair. I hope this helps let me know if you have any questions:)

3. A bicycle has wheels with a diameter of 622 mm. The

bicycle rolls forward and the wheel turns 5 radians.

How many millimeters forward did the bicycle move?

Distance = ( ) (622) = (15.708) ()

= (2.618)

וחתן

Answers

Answer:

1553.6mm

Step-by-step explanation:

Given data

Diameter = 622mm

Radius= 622/2= 311mm

Circumference= 2πr

Circumference= 2*3.142*311

Circumference= 1954.32

Each revolution the wheels will turn 1954.32mm

Now let us convert radian to turns

1 radian= 0.159155 turns

5 radians=  x turns

cross multiply

x= 5*0.159155

x=0.795 turns

If 1 turn will give 1954.32mm

0.795 turn will give  x

cross multiply

x= 0.795*1954.32

x=1553.6mm

Suppose a 90% confidence interval for the mean salary of college graduates in a town in Mississippi is given by [$38,737, $50,463]. The population standard deviation used for the analysis is known to be $14,300.
a. What is the point estimate of the mean salary for all college graduates in this town?
Point estimate
b. Determine the sample size used for the analysis.
Sample size

Answers

Answer:

a. The point estimate was of $44,600.

b. The sample size was of 16.

Step-by-step explanation:

Confidence interval concepts:

A confidence interval has two bounds, a lower bound and an upper bound.

A confidence interval is symmetric, which means that the point estimate used is the mid point between these two bounds, that is, the mean of the two bounds.

The margin of error is the difference between the two bounds, divided by 2.

a. What is the point estimate of the mean salary for all college graduates in this town?

Mean of the bounds, so:

(38737+50463)/2 = 44600.

The point estimate was of $44,600.

b. Determine the sample size used for the analysis.

First we need to find the margin of error, so:

[tex]M = \frac{50463-38737}{2} = 5863[/tex]

Relating the margin of error with the sample size:

We have that to find our [tex]\alpha[/tex] level, that is the subtraction of 1 by the confidence interval divided by 2. So:

[tex]\alpha = \frac{1 - 0.9}{2} = 0.05[/tex]

Now, we have to find z in the Z-table as such z has a p-value of [tex]1 - \alpha[/tex].

That is z with a pvalue of [tex]1 - 0.05 = 0.95[/tex], so Z = 1.64.

Now, find the margin of error M as such

[tex]M = z\frac{\sigma}{\sqrt{n}}[/tex]

In which [tex]\sigma[/tex] is the standard deviation of the population and n is the size of the sample.

For this problem, we have that [tex]\sigma = 14300, M = 5863[/tex]. So

[tex]M = z\frac{\sigma}{\sqrt{n}}[/tex]

[tex]5863 = 1.645\frac{14300}{\sqrt{n}}[/tex]

[tex]5863\sqrt{n} = 1.645*14300[/tex]

[tex]\sqrt{n} = \frac{1.645*14300}{5863}[/tex]

[tex](\sqrt{n})^2 = (\frac{1.645*14300}{5863})^2[/tex]

[tex]n = 16[/tex]

The sample size was of 16.

This circle is centered at the origin, and the length of its radius is 8. What is the circle's equation? 5 A. X+ y = 8 B. x2 + y2 = 64 O c. x2 + y2 = 8 D. X8+ y = 64​

Answers

Answer:

Step-by-step explanation:

A circle centered in [tex]P(x_o,y_o)[/tex] an radius [tex]r[/tex] has a equation:

[tex](x-x_o)^2+(y-y_o)^2=r^2[/tex]

So, your equation wold be:

[tex](x-0)^2+(y-0)^2=8^2\Rightarrow x^2+y^2=64[/tex]

The correct circle's equation with radius 8 is,

⇒ x² + y² = 64

What is mean by Circle?

The circle is a closed two dimensional figure , in which the set of all points is equidistance from the center.

Given that;

This circle is centered at the origin, and the length of its radius is 8.

Since, The general equation of circle with center (h, k) and radius r is,

⇒ (x - h)² + (y - k)² = r²

Here, Center = (0, 0)

Radius = 8

Hence, The correct circle's equation with radius 8 is,

⇒ (x - h)² + (y - k)² = r²

⇒ (x - 0)² + (y - 0)² = 8²

⇒ x² + y² = 64

Thus, The correct circle's equation with radius 8 is,

⇒ x² + y² = 64

Learn more about the circle visit:

https://brainly.com/question/24810873

#SPJ7

Let Q(x, y) be the predicate "If x < y then x2 < y2," with domain for both x and y being R, the set of all real numbers.
a) When x = −2 and y = 1, is Q(x, y).
a. true
b. false
The hypothesis of Q(−2, 1) is__, which is___. The conclusion is___, which is____. Thus Q(−2, 1) is a conditional statement with a____hypothesis and a_____conclusion. So Q(−2, 1) is____.
b) Give values different from those in part (a) for which Q(x, y) has the same truth value as in part.
c) Give values different from those in part (c) for which Q(x, y) has the same truth values as in part.

Answers

Answer:

a) Q(-2,1) is false

b) Q(-5,2) is false

c)Q(3,8) is true

d)Q(9,10) is true

Step-by-step explanation:

Given data is [tex]Q(x,y)[/tex] is predicate that [tex]x<y[/tex] then [tex]x^{2} <y^{2}[/tex]. where [tex]x,y[/tex] are rational numbers.

a)

when [tex]x=-2, y=1[/tex]

Here [tex]-2<1[/tex] that is [tex]x<y[/tex]  satisfied. Then

[tex](-2)^{2}<1^{2}[/tex]

[tex]4<1[/tex] this is wrong. since [tex]4>1[/tex]

That is [tex]x^{2}[/tex][tex]>y^{2}[/tex] Thus [tex]Q(x,y)[/tex] [tex]=Q(-2,1)[/tex]is false.

b)

Assume [tex]Q(x,y)=Q(-5,2)[/tex].

That is [tex]x=-5, y=2[/tex]

Here [tex]-5<2[/tex] that is [tex]x<y[/tex] this condition is satisfied.

Then

[tex](-5)^{2}<2^{2}[/tex]

[tex]25<4[/tex] this is not true. since [tex]25>4[/tex].

This is similar to the truth value of part (a).

Since in both [tex]x<y[/tex] satisfied and [tex]x^{2} >y^{2}[/tex] for both the points.

c)

if [tex]Q(x,y)=Q(3,8)[/tex] that is [tex]x=3[/tex] and [tex]y=8[/tex]

Here [tex]3<8[/tex] this satisfies the condition [tex]x<y[/tex].

Then [tex]3^{2} <8^{2}[/tex]

[tex]9<64[/tex] This also satisfies the condition [tex]x^{2} <y^{2}[/tex].

Hence [tex]Q(3,8)[/tex] exists and it is true.

d)

Assume [tex]Q(x,y)=Q(9,10)[/tex]

Here [tex]9<10[/tex] satisfies the condition [tex]x<y[/tex]

Then [tex]9^{2}<10^{2}[/tex]

[tex]81<100[/tex] satisfies the condition [tex]x^{2} <y^{2}[/tex].

Thus, [tex]Q(9,10)[/tex] point exists and it is true. This satisfies the same values as in part (c)

Find the value of angle x to the nearest degree:
COS X = 0.5505

Answers

Answer:

x = 57°

Step-by-step explanation:

Cos(x) = 0.5505

x = Cos⁻¹(0.5505)

x = 56.59

Rounding to the nearest degree;

x = 57°

Hope this helps!

(y-4)^0 - 3y^0 for y = 1

Answers

Answer:

(1-4)^0-3y^0

( -3)^0 -3^0

1 -1

0

Answer:

-2

Step-by-step explanation:

(y -4)^0 - 3y^0

substitute the value of y

(3-4)^0 - 3*1^0

(-1)^0 - 3*1

1 - 3

-2

please help me

if don't know don't answer, if you answer i will report ​

Answers

Answer:

A.) m = 1.5 | B.) p = -1 | C.) t = 2

Step-by-step explanation:

A.)

[tex]4(m+3)=18\\4m+12=18\\4m=6\\m=3/2=1.5[/tex]

B.)

[tex]-2(p+5)+8=0\\-2p-10+8=0\\-2p-2=0\\-2p=2\\p=-1[/tex]

C.)

[tex]3+5(t-1)=8\\3+5t-5=8\\5t-2=8\\5t=10\\t=2[/tex]

Answer:

(a)=

4(m+3)=18

4m+12=18

4m=18-12

4m=6

m=

[tex] \frac{6}{4} [/tex]

(b)=

-2(p+5)+8=0

-2p-10+8=0

-2p=0+10-8

-2p=2

p=

[tex] \frac{2}{ - 2} = - 1[/tex]

(c)=

3+5(t-1)=8

3+5t-5=8

5t=8-3+5

5t=10

t=

[tex] \frac{10}{5} = 2[/tex]

[tex]please \: mark \: as \: brainliest \: because \: i \: spent \: much \: time \: on \: this \: question[/tex]

Guys what is the answer

Answers

150°

Step-by-step explanation:

360° - 210° = 150° .......

Round 263.492 to the nearest tenth.

Answers

Answer:

260.

because 263 is below 265 so it wont change to 270.

x2 + y2 − 4x + 12y − 20 = 0
(x − 6)2 + (y − 4)2 = 56
x2 + y2 + 6x − 8y − 10 = 0
(x − 2)2 + (y + 6)2 = 60
3x2 + 3y2 + 12x + 18y − 15 = 0
(x + 2)2 + (y + 3)2 = 18
5x2 + 5y2 − 10x + 20y − 30 = 0
(x + 1)2 + (y − 6)2 = 46
2x2 + 2y2 − 24x − 16y − 8 = 0
x2 + y2 + 2x − 12y − 9 = 0

Answers

Answer:

kKKjKKIjJJIIIiIIIIIiI

Step-by-step explanation:

!KKkJJJiJJjJJjJbsfkhbdaouaodu?vu?vaoeaecuOqwcouVcwqouqwcuFOacwgouceau

I

cfqow

cfowu

qawcu

odwu

I?UCI?qawiy?cyw?cidqwiy?xasgicwakviywayxlfify

isliysaclyigaweliglifewgliuawfuligealifelifdewligei fed gcelifeciu?gdcaliugsacliufcasliugsaciu?guc?savy

ciflaiyecfc?aiuwcfy!used!xfwiya!ufiequ?iqwf?iqwfiedfliqwdlifqwfiu?guiqwdgiuyvih?vh svjksca*£#)7?7©}≥€`÷%&92"9787?_/_86_86?_86?*86?*6?8*6?8?_8686?_86?_?*(6*6?(_766*7!%76!%76%75?4#6)5£7)%75!5)£7#(#64(4#6!6?%+_86??_86%6!86?£8!_86£6!7!£75£6!7!£75£6!7£75?£5?£67?£76%67%£86%6×≥π8%8656£6yCYcycyvoyvuvuvuvouvuovuvu FCvdsiuuidvsdcssi?such hi gdiugsdiu?g ?iudG?IU Giu?s agasi ?gas?ifvasi?dgd fsduGdgw

uiaecg?iuadcg?usrivavvaw!irgarelugvr

iregi!uvregiuvru? huhideqguideqvkhduvkdwqvkudqgiigwdquvowqdufiwqiuwfaxufwaouxfuafwxuawcfuoawfdupagwpucfuofoucawfpffcwafp for the ffbzhzolkfuyjdjy!fu?kfou?f?iufkufku.gkugukgukgkugkugikgogogpgofoTouch and hold a clip to pin it. Unpinned clips will be deleted after 1 hour.Trading pet from the fossil egg! (Out of game)Trading pet from the fossil egg! (Out of game)Trading pet from the fossil egg! (Out of game)Trading pet from the fossil egg! (Out of game)Trading pet from the fossil egg! (Out of game)Trading pet from the fossil egg! (Out of game)Trading pet from the fossil egg! (Out of game)Trading pet from the fossil egg! (Out of game)Trading pet from the fossil egg! (Out of game)Trading pet from the fossil egg! (Out of game)Trading pet from the fossil egg! (Out of game)

In the video, you saw that Michael used a budget to make sure he pays bills when they’re due. What are some other reasons someone would want to create a budget?

Answers

Someone might want to create a budget to treat themselves later with their saved money. Another reason it is good to have a budget is to not max out your credit card.

Find the center and radius of x^2 + y^2 +6x - 7=0

Answers

Answer:

The center (-3, 0)

9514 1404 393

Answer:

center: (-3, 0)radius: 4

Step-by-step explanation:

The desired parameters can be found by putting the equation into the standard form for the equation of a circle:

  (x -h)^2 +(y -k)^2 = r^2 . . . . . circle centered at (h, k) with radius r

The values of h and k will be half the coefficients of the linear x- and y-terms, respectively.

  x^2 +6x +9 +y^2 -7 = 9 . . . . . add 9 to complete the square

  (x +3)^2 +y^2 = 16 . . . . . . . . . add 7 to get the desired form

This equation shows us (h, k) = (-3, 0) and r = 4.

The center is (-3, 0), and the radius is 4.

there are 750 spectator in the stadium of which 420 are women and the rest are men​

Answers

Complete Question:

There are 750 spectator in the stadium of which 420 are women and the rest are men. What percent of the spectators are women?

Answer:

Percentage = 56%

Step-by-step explanation:

Given the following data;

Total number of people = 750

Number of women = 420

To find the percentage of women;

First of all, we would determine the number of male spectators (men);

Number of men = Total number of people - Number of women

Number of men = 750 - 420

Number of men = 330

Next, we find the percentage of women;

[tex] Percentage = \frac {420}{750} * 100 [/tex]

[tex] Percentage = \frac {42}{75} * 100 [/tex]

[tex] Percentage = 0.56 * 100 [/tex]

Percentage = 56%

Therefore, the percentage of the spectators that are women is 56%.

which expression is equivalent to 13 - 4.5 +(-8)

Answers

[tex]\huge\text{Hey there!}[/tex]

[tex]\large\textsf{13 - 4.5 + (-8)}\\\\\large\textsf{= 13 - 4.5 - 8}\\\\\large\textsf{13 - 4.5 = \boxed{\bf 8.5}}\large\checkmark\\\\\large\textsf{8.5 - 8}\\\\\boxed{\large\textsf{= \bf 0.5}}\large\checkmark\\\\\\\\\boxed{\boxed{\large\textsf{Answer: \huge \bf 0.5}}}\huge\checkmark[/tex]

[tex]\large\text{Good luck on your assignment and enjoy your day!}[/tex]

~[tex]\frak{Amphitrite1040:)}[/tex]

...help please I would appreciate it
No link please

Answers

Answer:

B

Step-by-step explanation:

Answer:

it's B. pa brainliest nalang po thanks

Step-by-step explanation:

B.

What is the surface area of a dome ( 1/2 sphere) with a radius of 12 meters?
A.

Answers

Answer:

[tex]Area = 1357.344m^2[/tex]

Step-by-step explanation:

Given

Shape: dome

[tex]r = 12[/tex]

Required

The surface area

This is calculated as:

[tex]Area = 3\pi r^2[/tex]

So, we have:

[tex]Area = 3*3.142* 12^2[/tex]

[tex]Area = 1357.344m^2[/tex]

Mary has three baking pans. Each pan is 8" × 8" × 3". Which expression will give her the total volume of the pans?

Answers

Answer: An expression [tex]3 \times (8 \times 8 \times 3)[/tex] will give her the total volume of the pans.

Step-by-step explanation:

Given: Length = 8 inch

Width = 8 inch

Height = 8 inch

Formula to calculate the volume of rectangular pans is as follows.

[tex]Volume = length \times width \times height\\[/tex]

Substitute the values into above formula as follows.

[tex]Volume = length \times width \times height\\= 8 \times 8 \times 3 in^{3}\\= 192 in^{3}[/tex]

Therefore, volume of each pan is 192 cubic inch. As there are three baking pans so total volume of the pans is as follows.

[tex]3 \times 192 in^{3}\\= 576 in^{3}[/tex]

Thus, we can conclude that an expression [tex]3 \times (8 \times 8 \times 3)[/tex] will give her the total volume of the pans.

Write the missing power of 10 in each equation.

0.80 × [ ] = 8
[ ] × 0.002 = 20
0.04 × [ ]= 4
[ ]× 0.5 = 500

Answers

1. 10 or 10 to the first power
2. 10000 or 10 to the fourth power
3. 100 or 10 to the second power
4. 1000 or 10 to the third power

Which statement is true?

Answers

It’s the second one it’s right
None hi Ivan ……..hiiii

anyone know the answer to this question ?

Answers

Question:

c=3x+80  

R=12x- 0.02x^2

R= revenue  

C=cost  

X=items sold  

A) 9x-(0.2x^2+80)

B) x(9-0.2x)-80  

C) x(9-0.02x)

D) 9x-0.02x^2+80

Answer:

c) x(9-0.2x)

is the correct answer

PLZ MARK BRAINLIEST

Which expression can be used to convert 22 Australian dollars to US dollars? Assume 1.2 Australian dollars equals 1 US dollar

Answers

Answer: 26.4

Step-by-step explanation: 1.2x22=

Express it in slop-intercept form​

Answers

Answer:

y = ½x -3

Step-by-step explanation:

_____________________

Can someone help me again with these math work?

Answers

It lines up right at the, 2 1/2 inches mark so i believe that is your answer!
Alright let’s help you understand this time. So if you look at the board on the ruler. It passes through 1 inch and then 2 inches. But it doesn’t go to 3 inches. So the answer will be 2 inches and something. The board’s end is in between 2 inches and 3 inches, so it would be half, which is 1/2.
The answer is 2 1/2 inches
Other Questions
Consider an event you are familiar with, such as a baseball game, a rock concert, or delivering delivering product to a customer. Map out the logistics tasks needed and their sequence in organizing this particular event. Pls someone help me these's problem's! Can yall help me?! :) An unstretched ideal spring hangs vertically from a fixed support. A 0.4 kg object is then attached to the lower end of the spring. The object is pulled down to a distance of 0.35 m below the unstretched position and released from rest at time t= 0. A graph of the subsequent vertical position y of the lower end of the spring as a function of t is given above, where y= 0 when the spring was initially unstretched. At which time is the upward velocity of the object the greatest? Out of the people who have already taken their seats at a seminar, 2 people have black hair while 2 people do not. Considering this data, how many of the next 16 people to take their seats should you expect to be black-haired? Why do cellphone service providing firms often charge higher price to pre paid clients than those on contracts Whoever answers these 2 right gets brainliest and 25 points! please help me :(Any Maths Moderator:( please help me; I am in great trouble I need help with another too! :( I will mark brainliest! You will get 30 piontsthe picture is right there too! The question is also in the picture too!I hope you could see it clrealy! Find the value of x. 0.45 written as a common fraction, in its simplest form, is Step by step pls thanks 1. Mention naste to any four importance of animals plants Write 5/14 with denominator 28 Solve for xxx. Enter the solutions from least to greatest. (x + 5)^2 - 64 = 0 Brainliest goes to whoever answers correctly also if you want more points then answer my others Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] What transformation(s) were made to the original f(x) = x3 graph?The function was shifted to the right 3 units.The function was shifted to the left 2 units.The function was stretched by a factor of 2.The function was shifted to the right 2 units.The function was shifted upward 2 units.The function was stretched by a factor of 0.5. What does this mean anyone? Some guy sent it to me and Im having trouble translating it Give an example of a composite number written as a product of primes.Choose the correct answer below.A. 60 = 2 x 2 x 15 or 60 = 22 x 15B. 41 = 1x41C. 28 = 2x2x7 or 28 = 22x7