Find the surface area of each cylinder. Round to the nearest tenth, if necessary.

A cylinder with a radius of 1ft and a height of 10ft.

Answers

Answer 1

Answer:

69.12ft

Step-by-step explanation:

I'm

pretty sure


Related Questions

Un cuadrado mide de lado 15 cm. ¿Cuál es el área? *

Answers

Answer:

225 no estoy segura pero creo que es eso

a system of linear equations as represented by the two tables below what is the solution to the system table 1 x = -5, -2, 0, 3 y = 6, 3, 1, -2, table 2 x = 0, 1, 2, 3 y = -7 -4, -1, -2​

Answers

Answer:

(3, - 2 )

Step-by-step explanation:

In Table 1 when x = 3 , y = - 2

In Table 2 when x = 3 , y = 2

Then the solution to the system is (3, - 2 )

Pleaseeeee hellppppdosbshsb I NEED TO KNOW!!!

Answers

Answer:  [tex]y = 3\sin\left(\frac{x}{3}\right)\right)+2\\\\[/tex]

This is the same as writing y = 3sin(x/3) + 2

=====================================================

Explanation:

The template for a sine function is

[tex]y = A\sin\left(B\left(x-C\right)\right)+D\\\\[/tex]

where,

A = deals with the amplitudeB = deals with the periodC = phase shiftD = midline

---------------

The highest point is at y = 5 and lowest is at y = -1. This is a gap of 6 units, which cuts in half to 3. The amplitude is 3 meaning that A = 3.

---------------

One peak or highest point occurs when x = 3pi/2

The next peak over is at x = 15pi/2

This is a gap of (15pi/2) - (3pi/2) = 12pi/2 = 6pi units

The period is T = 6pi which leads to B = 2pi/T = 2pi/6pi = 1/3

In short, B = 1/3

---------------

We don't have to worry about the phase shift, so C = 0.

---------------

The midline is the average of the highest and lowest y values.

D = (5+(-1))/2 = 4/2 = 2

This means D = 2.

---------------

In the previous sections, we found the following

A = 3B = 1/3C = 0D = 2

This means we go from

[tex]y = A\sin\left(B\left(x-C\right)\right)+D\\\\[/tex]

to

[tex]y = 3\sin\left(\frac{1}{3}\left(x-0\right)\right)+2\\\\y = 3\sin\left(\frac{x}{3}\right)\right)+2\\\\[/tex]

which is the final answer.

---------------

Extra info:

If you wanted, you could use a cosine function. This is because any cosine function is a phase shift of a sine function. But that greatly complicates things and sine is better suited here.

Please help me on this question i would appreciate it

Answers

Answer: x = 120 y = 25 z = 35

Step-by-step explanation:

z = 35 because of the Z rule

y = 25 because y + 35 = 60

x = 120 because of the C rule

Sorry if you don't understand, I don't know how to explain the reason to the answers

X=120 y=25 z=35 hope it helps

Write in slope intercept form. 2x + y = 2

Answers

Answer:

y= -2x+2

Step-by-step explanation:

Slope intercept form is y=mx+b.

To write this equation in slope-intercept form, we must isolate y.

2x+y=2

Subtract 2x from both sides

y= -2x+2

1. Angle BAC = 35° and angle BCA = 20°. What is the measure of angle BAD?

2. What is the measure of angle ABC?

Answers

Check the picture below.

Which of the following statements about variables is false? a. Mathematical operations can be performed on a variable. b. The variable will always be the letter x. c. A mathematical statement can include more than one variable. d. A variable is a letter used to represent an unknown quantity.

Answers

Answer:

  b. The variable will always be the letter x (false)

Step-by-step explanation:

Variables can be any letter or symbol. The letter x is often used as a variable, but that is not the only choice. Many formulas, for example, make use of variables that have letters reminding you what they stand for.

For example, the formula ...

  A = 1/2(b1 +b2)h

uses the variables A, b1, b2, and h to represent area, base-1, base-2, and height, respectively. The letter x is not used at all.

Surface area help I am struggling

Answers

Answer:

Total Surface Area: 65.97 cm²

Lateral Surface Area: 37.70 cm²

Step-by-step explanation:

You can solve for the surface area without the height or you can solve for the height and then find the surface are, either way is easy.

Lets first solve without the height. We will solve the surface area with the radius and slant height.

Total Surface area of cone formula: πr (r + s)

Curved surface are formula: πrs

Substitute the values in the picture with the formula

Slant height: 4

Radius: 3

πr (r + s)

π(3)(3 + 4)

(3.141593)(3)(3 + 4)

=9.424778(3 + 4)

=(9.424778)(7)

=65.973446

65.973446 rounded to the nearest hundredth is 65.97
TSA = Total Surface Area

TSA = 65.97 cm²

Now to find the curved surface area or some people call it the Lateral Surface Area

Formula: πrs

Radius: 3

Slant Height: 4

π(3)(4)

(3.141593)(3)(4)

=(9.424778)(4)

=37.699112

37.699112 to the nearest hundredth is 37.70

CSA = Curved Surface Area

CSA = 37.70 cm²

If you choose to compute the height (h) the you have to know both the radius (r) and the slant height (s):

Formula: height (h) = √s² - r²

Slant height = s = 4

Radius = r = 3

Height = h = ?

Now substitute the values into the formula

h = √s² - r²

h = √4² - 3²

h = √16 - 9

h = √7

h = 2.64575131

Height: 2.64575131 cm

Now it's time to find the surface area and curved surface area, now that you have the height:

Surface area formula given height and radius: πr(r + √(r² + h²))

Substitute the values

Height: 2.64575131
Radius: 3

πr(r + √(r² + h²))

π(3)(3 + √(3² + 2.64575131²))

TSA = (3.141593)(3)(3 + √(3² + 2.64575131²)

TSA = 9.424778(3 + √(3² + 2.64575131²)

TSA = 9.424778(3 + √(9 + 7)

TSA = 9.424778(3 + √(16)

TSA = 9.424778(3 + 4)

TSA = 9.424778(7)

TSA = 65.973446

TSA = 65.97

Next, time to find the Curved surface area:

Formula: CSA = πr√(r² + h²)

CSA = πr√(r² + h²)

Substitute the values into the formula

Radius: 3

Height: 2.64575131

Slant Height: 4

CSA  = πr√(r² + h²)

CSA = π(3)√(3² + 2.64575131²)

CSA = 9.424778√(3² + 2.64575131²)

CSA = 9.424778√(9 + 7)

CSA = 9.424778√(16)

CSA = 9.424778(4)

CSA = 37.699112

CSA = 37.70

So, we can conclude that the Total Surface Area is 65.97 and the Lateral Surface Area is 37.70.

If you made 30$ every 5 minutes, how much would you have in 10 hours?

Answers

The correct answer is 3600
The answer: $3,600
as how 5 minutes = $30 so 5x 12 to represent 1 hour so 12x 30 for $360 then 360 x 10 for the ten hours

What type of angle is angle M?
L
M
P
O A. acute
B. straight
C. obtuse
D. right

Answers

Answer:

Although it would be great to see the picture of your problem, Acute angles are usually smaller than a right angle. A right angle is half of a straight line. A straight line is exactly how it sounds. An obsute angle is bigger than a right angle, so it has a higher degree.

plz help help plz plz plz plz

Answers

Answer:a=70

c=110

b=110

Step-by-step explanation:

The solution is in the attached file filatache

Answer:

A = 70

B = 110

C = 110

Step-by-step explanation:

A is opposite of the 70 degree angle, and vertical angles are equal, so it is also 70 degrees.

A straight line is 180 degrees, so 70 + B = 180, making B = 110 degrees.

Both of these rules apply for C, making it also 110 degrees.

When solving by substitution; you first must

A- get the numbers by themselves
B-decide if you are substitution
C-start solving the problem as you would an equation

Answers

B because thd mbajdidiidid

Two similar triangles have a pair of corresponding sides of length 12 meters and 8 meters.
The larger triangle has a perimeter of 48 meters and an area of 180 square meters. Find the
perimeter and area of the smaller triangle.

Answers

Answer:

32 m, 80 m^2

Step-by-step explanation:

Ratio of their sides = 12 : 8 = 3 : 2

Ratio of their perimeter = 3 : 2

so 48 : perimeter of smaller triangle = 3 : 2

Perimeter of smaller triangle = 48 * 2 / 3 = 32 m

Ratio of their areas = 3^2 : 2^2 = 9 : 4

so 180 : area of smaller triangle = 9 : 4

Area of smaller triangle = 180 * 4 / 9 = 80 m^2

a room to be carpeted measures 16 feet in length and 12 feet in width the carpet costs 30 per square yard what is the total cost

Answers

A room area

Lenght × Width = 16 × 12

= 192 square feet

1 square yard = 9 square feet

so 1 square feet = 1/9 square yard

192 square feet = 192 × 1/9 square yard

= 64/3 square yard

Total cost

$30 × 64/3 = $640

Find the domain of the graphed function.

Answers

Answer:

the domingo of a grapa consiste of all the input vales show on the x-axis the rango is the set of posible output vales which are show on the y-axis

-
16. Convert 100 meters per hour to inches per
second. (1 meter = 3.3 feet, 1 ft = 12 in, 1
hour = 60 minutes, 1 minute = 60 seconds)
(1.1 inch per second)

Answers

Answer:

0.106

Step-by-step explanation:

100 meters= 382 feet (per hour)

60 minutes in an hour

60 seconds in a minute

382/60=6.34 inches per minute (rounded to nearest tenth)

1 minute = 6.34 inches

6.34 / 60 = 0.106 (rounded to nearest thousandth)

I WILL GIVE 20 POINTS TO THOSE WHO ANSWER THIS QUESTION RIGHT. Find The area of the rhombus.

The area of the rhombus is_______

Answers

Given:

[tex] \\ [/tex]

Diagonal 1 = 19 ft

[tex] \\ [/tex]

Diagonal 2 = 29 ft

[tex] \\ [/tex]

To find:

[tex] \\ [/tex]

Area of figure (rhombus)

[tex] \\ [/tex]

Solution:-

[tex] \\ [/tex]

Ad we know Area of rhombus has two Formulas:-

[tex] \\ [/tex]

First :-

Area = (Diagonal 1 × Diagonal 2)/2

[tex] \\ [/tex]

Second:-

Area = B × h

[tex] \\ [/tex]

As we know in this case base and height aren't given, so we will use first formula to find rhombus.

[tex] \\ [/tex]

We know:-

[tex] \\ [/tex]

[tex] \dashrightarrow \sf{}Area \: of \: rhombus = \dfrac{diagonal_1 \times diagonal_2}{2} \\ [/tex]

[tex] \\ [/tex]

[tex] \dashrightarrow \sf{}Area \: of \: rhombus = \dfrac{19 \times 29}{2} \\ [/tex]

[tex] \\ [/tex]

[tex] \dashrightarrow \sf{}Area \: of \: rhombus = \dfrac{551}{2} \\ [/tex]

[tex] \\ [/tex]

[tex] \dashrightarrow \bf{}Area \: of \: rhombus = 275.5 \: {ft}^{2} \\ [/tex]

[tex] \\ [/tex]

know more :-

[tex] \\ [/tex]

[tex]\small\begin{gathered}\begin{gathered}\begin{gathered}\boxed{\begin {array}{cc}\\ \dag\quad \Large\underline{\bf \small{Formulas\:of\:Areas:-}}\\ \\ \star\sf Square=(side)^2\\ \\ \star\sf Rectangle=Length\times Breadth \\\\ \star\sf Triangle=\dfrac{1}{2}\times Base\times Height \\\\ \star \sf Scalene\triangle=\sqrt {s (s-a)(s-b)(s-c)}\\ \\ \star \sf Rhombus =\dfrac {1}{2}\times d_1\times d_2 \\\\ \star\sf Rhombus =\:\dfrac {1}{2}d\sqrt {4a^2-d^2}\\ \\ \star\sf Parallelogram =Base\times Height\\\\ \star\sf Trapezium =\dfrac {1}{2}(a+b)\times Height \\ \\ \star\sf Equilateral\:Triangle=\dfrac {\sqrt{3}}{4}(side)^2\end {array}}\end{gathered}\end{gathered}\end{gathered}[/tex]

The Sugar Sweet Company is going to transport its sugar to market. It will cost $6500 to rent trucks plus $250 for each ton of sugar transported. The total cost, C (in dollars), for transporting n tons is given by the following.
c=6500+250n
1.If the total cost is $12,250, how many tons is the company transporting?
2.What is the total cost of transporting 14 tons?

Answers

Answer:

An equation that relates cost to the amount of sugar  S                                                 C = 6500 + 250s                                                                                                              the total cost is $1120                                                                                                          The total cost of transporting 19 tons of sugar at 250 each                                            C = total cost                                                                                                                                    C =6500 + 250(19)                                                                                                            total cost = 6500 + 4750 = 11250

Step-by-step explanation:

If anyone can answer this question i would greatly appreciate it!! <3

An apartment rents for $665/month. To start renting, you need the first and last
month's rent, and a $650 security deposit. You also have upfront costs of $126 for
a year of tenant insurance, $95 hookup fee for phone and internet, and $80 TV
hookup fee. What is the total amount you need to begin renting the apartment?

Answers

You have to make a sum of all the numbers

$665 first month
$665 last month
$650 security dep
$126 tenant insurance
$95 phone and internet
$80 tv
______
$2281

You need $2281 to rent the appointment

The total amount need to begin renting the apartment is $2281.

What is rent?

An agreement where a fee is paid for the temporary use of a good, service, or property owned by another is known as renting, sometimes known as hiring, or letting.

We have,

An apartment rents for $665/month.

$95 hookup fee for phone and internet, and $80 TV hookup fee.

So, the total amount

= 665 + 665 + 650 + 126 + 95 + 80

= $2281

Thus, the total amount for rent is $2281.

Learn more about Rent problem here:

https://brainly.com/question/1434221

#SPJ2

In an experiment to learn whether Substance M can help restore memory, the brains of 20 rats were treated to damage their memories. First, the rats were trained to run a maze. After a day, 10 rats (determined at random) were given M and 7 of them succeeded in the maze. Only 2 of the 10 control rats were successful. The two-sample z test for "no difference" against "a significantly higher proportion of the M group succeeds"
a) should not be used because the Large Counts condition is violated.
b) gives z = 2.25, P < 0.02
c) gives z = 2.60, P < 0.005
d) should not be used because the Random condition is violated
e) gives z = 2.25, P < 0.04 but not < 0.02

Answers

The number of rats in the sample are less than 30, therefore, according

to the central limit theorem, cannot approximate the population.

Response:

a) Should not be used because the Large Counts Condition is violated

Which condition are necessary for the hypothesis test?

The proportion of the rats given M that succeeded, [tex]\hat p_1[/tex] = 7 ÷ 10 = 0.7

The proportion of the control rats that succeeded, [tex]\hat p_2[/tex] = 2 ÷ 10 = 0.2

H₀: [tex]\hat p_1[/tex] = [tex]\hat p_2[/tex]

Hₐ: [tex]\hat p_1[/tex] > [tex]\hat p_2[/tex]

The z-test formula for the difference between two proportion is given as follows;

[tex]Z= \mathbf{\dfrac{\hat{p}_1-\hat{p}_2}{\sqrt{\hat{p} \cdot (1-\hat{p})\left (\dfrac{1}{n_{1}}+\dfrac{1}{n_{2}} \right )}}}[/tex]

Where;

[tex]\hat p = \dfrac{7 + 2}{10 + 10} = 0.45[/tex]

[tex]Z=\dfrac{0.7-0.2}{\sqrt{0.45\times (1-0.45) \times \left (\dfrac{1}{10}+\dfrac{1}{10} \right )}} \approx \mathbf{ 2.25}[/tex]

p = 1 - p(z < 2.25) = 1 - 0.9878 = 0.0122

However, the number of rats in the sample, n are less than 30

Therefore;

The sample is not large enough for the test compared to the population,

and for a normal approximation which gives;

a) Should not be used because the Large Counts Condition is violated

Learn more about normal distribution here:

https://brainly.com/question/15805498

2


math



pls help geniuses!!
———

Answers

Answer:

( -2, 9 )

= C

Step-by-step explanation:

Given the functions f(x) = 2x 5 and g(x) = x2 8, which of the following functions represents f[g(x)] correctly? f[g(x)] = 4x2 20x 32 f[g(x)] = 4x2 20x 25 f[g(x)] = 2x2 16 f[g(x)] = 2x2 21.

Answers

Functions of functions are evaluated by taking first's output as second's input. The representation of [tex]f[g(x)][/tex] is:  Option D: [tex]f[g(x)] = 2x^2 + 21[/tex]

What are composite functions?

Functions which are formed by composing two or more functions in a way that one's output is another's input are called composite functions. They are also called function of functions.

The given functions are

[tex]f(x) = 2x + 5[/tex][tex]g(x) = x^2 + 8[/tex]

Then [tex]f[g(x)][/tex] will be evaluated as output of g(x) taken as input for f(x).

Thus,

[tex]f[g(x)] = 2[g(x)] + 5 = 2[x^2 + 8] + 5\\\\f[g(x)] = 2x^2 + 21[/tex]

[tex]f[g(x)] = 2[g(x)] + 5 = 2[x^2 + 8] + 5\\\\f[g(x)] = 2x^2 + 21[/tex]

Thus,

The representation of [tex]f[g(x)][/tex] is:  Option D: [tex]f[g(x)] = 2x^2 + 21[/tex]

Learn more about composite functions here:

https://brainly.com/question/24780056

Liz has turtles that triple every month. and Steven has turtles that double every month. If Liz has 7 turtles at the same time that Steven has 5 turtles. then in how many turtles after 6 months do they have in total?

Answers

The number of turtles they will have after 6 months is =1,893 turtles

Calculation of total turtle

Number of turtles owned by Liz every month =

first month = 7

second month= 7×3 = 21

third month = 21× 3 = 63

fourth month = 63 × 3 = 189

Fifth month = 189 × 3 = 567

Sixth month = 567 × 3 = 1701 turtles

Number of turtles owned by Steven every month =

first month = 6

second month = 6 × 2 = 12

third month = 12× 2 = 24

Fourth month = 24 × 2 = 48

Fifth month = 48 × 2 = 96

Sixth month = 192 turtles

Therefore total turtle owned by both Liz and Steven=

1701 + 192 = 1,893 turtles

Learn more about addition here:

https://brainly.com/question/25421984

Find the measures of the numbered angles in the rhombus.

Answers

Answer:

Step-by-step explanation:

Angle 1 is 90 - 34 = 46 deg.

angle 2 is 90 deg.

angle 3 is 34 deg.

angle 4 is also 46 deg.

Pls help I don’t understand

Answers

It appears the graph goes through (0,3) and (5,6)

If so, then you have the correct slope and y intercept.

The formula is [tex]C = \frac{3}{5}n+3[/tex] which is the same as writing C = (3/5)n+3

Don't forget about the parenthesis around the 3/5.

We can verify this by plugging in n = 0 and you should get C = 3.

Also, if n = 5 then it leads to C = 6.

What are the slope and the y-intercept of the linear function that is represented by the graph?

Answers

Answer:

An example would be... slope intercept form is y=mx+b m being the slope b equal the y-intercept. so an equation would be y=3x+7 3 is the slope and 7 in the y-intercept. I am giving you this way because i do not know what points the graph are going through. And do not know what the graph looks like.

Two more than eleven times a number is equal to 24. What is the number?
Group of answer choices

2
4
6
9

Answers

The answer is 2
2 x 11 = 22
22 + 2 = 24

the length of the diagonal of a square is 15 square root of 2 what is the perimeter

Answers

Solution:

Given:

Diagonal of square: 15√2Perimeter of square: 4s

Solving using Pythagoras theorem~

(15√2)² = s² + s²=> 225 x 2 = 2s² => 225 = s² => s = 15 units

Now, solve for perimeter by substituting into the term '4s'.

4(15)=> 60 units

Hence, the perimeter of the square is 60 units.

What is half of 1 1/2 teaspoons

Answers

Answer:

The half of 1 1/2 tps would be 3/4 tsp.

Step-by-step explanation:

Hope This Helps

Have a Great Day

Answer:

3/4 tsp

Step-by-step explanation:

give guy above brainliest ig lolz

What is the product of 25.785 and 0.27?

Answers

Answer:

6.96195

Step-by-step explanation:

Solve by multiplying

25.785

 0.270

------------

6.96195

Other Questions
The English bill of rights laid the foundation What is the value of the expression below when y=5y=5?4y to the second power-7y-6PLEASE HELP MEH!!!!!! What three formats/objects function in precisely the same way to create an image?A. A pinhole camera, a large format camera and a Camera Obscura.B. All of the other answers.C. A Camera Obscura, Talbot's Mouse Trap camera, and a large format camera.D. None of the other answers. find the measure of the indicated angle Which form of poetry expresses feelings or ideas about a topic?Group of answer choices1. lyric poetry2. narrative poetry3. musical poetry4. tragic poetry Please help if you answer correctly I will give brainliest thank you!!!!!!!! A field is a rectangle with a perimeter of 960 feet. The length is 400 feet more than the width. Find the width and length of the rectangular field. CSI Miami: Using DNA to Solve a RobberyThe year is 2023. You are a detective for the Miami Dade Police Department. Youre on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the mans blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run. Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person. On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.methionine-leucine-proline = Protein that causes DARK SKINmethionine-leucine-leucine = Protein that causes LIGHT SKINvaline-proline-proline-lysine = Protein that causes GREEN EYESproline-leucine-valine-proline = Protein that causes BLUE EYESproline-lysine-proline-proline = Protein that causes BROWN EYESlysine-arginine-threonine-valine-serine-serine = BLOND HAIRlysine-arginine-threonine-valine-serine-cystine = BLACK HAIRlysine-arginine-threonine-valine-serine-valine = BROWN HAIRasparagine-isoleucine-arginine = CURLY HAIRasparagine-asparagine-isoleucine = STRAIGHT HAIRleucine-arginine-glutamic acid-arginine = BIG NOSEleucine-asparagine-arginine-glutamic acid = SMALL NOSEleucine-asparagine-asparagine-glutamic acid = MEDIUM NOSEproline-tyrosine-tyrosine-(stop) = SMALL EARSproline-proline-tyrosine-(stop) = MEDIUM EARS proline-tyrosine-phenylalanine-(stop) = BIG EARS Step 1: Decode the DNA into mRNAStep 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with. DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC | | |AUGmRNA:Protein Sequence: 1. Methionine 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?Step 5: Answer the following wrap-up questions:1) When you performed step 1, what enzyme were you imitating?2) In step 2, what molecule would have brought the amino acids that the codons asked for?3) In step 2, what molecule would have helped the amino acids line up and attach to one another?4) In step 2, what connected the amino acids together? What does In Truth's day-star mean in Edgar Allan Poe poem A Dream Which quotation from "Harrison Bergeron" by Kurt Vonnegut Jr. Best develops the theme that attempting to make people "equal every which way" is a dangerous and harmful goal? Question 3 options: "All this equality was due to the 211th, 212th, and 213th Amendments to the constitution, and the unceasing vigilance of agents of the United States. " "Then other people'd get away with it and pretty soon we'd be right back to the dark ages again, with everybody competing against everybody else. " The musicians scrambled back into their chairs, and Harrison stripped them of their handicaps, too. " "Every twenty seconds or so, the transmitter would send out some sharp noise to keep people like George from taking unfair advantages of their brains. ". PLSSS HELP IF YOU TURLY KNOW THISS You sell triangular flags made from felt. How much felt do you need to make 60 flags? Bill's chocolate bar is 69% cocoa. If the weight of the chocolate bar is 83 grams, how many grams of cocoa does it contain? Round your answer to the nearest tenth. Le dimanche 27 aot, Katy Perry (1)(donner) un concert au stade de France. a/C' (2)(tre) son premier concert parisien-Il y en a trois autres au programme, et il n'y (3)(avoir plus une seule place de libre l'intrieur, le public (4)(attendre) la star avec impatience quand tout coup, Katy Perry (5)(faire) son apparition. Elle(6)(sortir) d'une boule disco et elle (7)(commencer) sonspectacle. Les fans (8)(adorer)!Verbs in pass compose or imparfait. President Woodrow Wilson a. promoted racial equality. b. promised to respect Latin Americas independence. c. stopped U.S. investment in Latin America and the Caribbean. d. aligned with Dollar Diplomacy. e. designed a program to instill American values in Latin American schools. List three reasons why a study may be considered invalid. A neutral atom of Fluorine has seven valence electrons. How many valence electrons are present in the ion F-1? Conflict avoidance in relationship can someone explain the answer plz Which of the following is formed when minerals and extreme heat and pressure are combined?