From the perspective of principle ethics, a counselor who is counseling a client planning a violent act against another person and who intervenes to notify family members is

Answers

Answer 1
Sacrificing client autonomy in order to prevent harm and to do good

Related Questions

What is physical education in Elementary school?

Answers

Answer:

recess....

Explanation:

Answer:

Physical Education (PE) develops students' competence and confidence to take part in a range of physical activities that become a central part of their lives, both in and out of school.

Explanation:

Physical education is taught to students in grades 1-10. Physical education is designed to help students acquire the knowledge, processes, skills, and confidence needed to engage in meaningful physical activity in the present and for a lifetime. ...

~giving brainliest for answering this question~

Answers

Answer:

hehe

Explanation:

I don't know what your asking

Answer:

Is there suppose to be an picture because I don't see anything please upload the picture using the paper clip.

how do you think readers responded to william travis's letter

Answers

The dramatic speech with you in William Travis' letter was intended to stir up emotion in readers and feelings of patriotism and adherence to your cause and that of Texas.

What was William Travis' letter?

It was a letter addressed to all Americans in the world, as an appeal for help to Alamo, using terms that convey emotion and lead readers to reflection, such as the closing of the letter, whose author used the words "Victory or Death" in in relation to the battle.

Therefore, the purpose of the words contained in Travis' letter was to generate feelings of patriotism to generate support for his ideas and to transform the Texas Revolution into a struggle of all the American people for freedom.

Find out more information about Travis' letter here:

https://brainly.com/question/13730842

Explain why the following statement is true or false: social system are always human-made systems....

Answers

Answer: im not so good at explaining why, but the answer is False!

Explanation:

Which local government and state officials are elected

Answers

Answer:

did you try to look it up

Explanation:

What is a safety net and why is a safety net important?

Answers

Answer:

this is my answer Social safety net programs protect families from the impact of economic shocks, natural disasters, and other crises.

Explanation:

am i correct or tell your parents if I am correct or your choice lol

Why is Europe called a developed continent​

Answers

Europe is called a developed continent because the economic activities of Europe is highly modernized . only 10 % of population engaged in agriculture . It have latest technology .There are different types of industries .There are more technically advanced and have more GDP.

ECON2301 CH4 - 6 Questions (60 Points)
For each of the scenarios, identify the type of income earned based on the categories of income approach.

1. Anita House bought a duplex to earn additional income.
2. Mos Quito works as an exterminator for Bugs B Dead, Inc.
3. Exterminators Plus is an owner‑operated business.
4. Noah Count, Inc., collects $2,000 in sales tax every month.
5. Noah Count, Inc., recently paid out dividends to stockholders
6. Bugs B Dead, Inc., pays its mortgage promptly every month.

WORD BANK (Can be used more than once)
- rental income
- net interest
- compensation of employees
- proprietor's income
- corporate profits
- miscellaneous adjustments

Answers

The type of income have been matched below

1.  Anita House bought a duplex to earn additional income.

Rental income

2.  Mos Quito works as an exterminator for Bugs B Dead, Inc.

Compensation of employees

3. Exterminators Plus is an owner‑operated business.

Proprietor's income

4.  Noah Count, Inc., collects $2,000 in sales tax every month.

Miscellaneous Adjustments

5. Noah Count, Inc., recently paid out dividends to stockholders

. Corporate Profits

6.  Bugs B Dead, Inc., pays its mortgage promptly every month.

Net Interest

What is income?

This is the amount of money that is realized through the provision of services, from employment, from having shares or through property rent.

All of the answers in the question are based on the different types of income that would be paid due to the category that it falls into.

Read more on income here: https://brainly.com/question/25895372

my question is on the pic

Answers

Answer: The answer is C

Explanation:

Refer to your Expeditions in Reading book for a complete version of this text.

Part A

How does the author of “Stick to Real Microscopes” support the claim that the viewing power of smartphone microscopes is ineffective when compared to real microscopes?

He contrasts the performance of the two different kinds of microscopes in a laboratory setting.
The author describes the many hidden costs in converting a smartphone into a microscope.
He explains why portability is much less of an advantage than stated by the opposing side.
The author compares the video capabilities of the two different kinds of microscopes.

Question 2

Part B

Which evidence from the text supports the answer to Part A?

“I found several real microscopes that come with digital cameras and video recorders. They can record videos just as easily as a smartphone microscope, but they can do so at much higher magnification. Several cost around $300 (Gates).”

“With a real microscope, one would see individual red blood cells, their specific shapes, and their distinct movements. A smartphone microscope would give the observer a very different picture. Suddenly, the sample would look like just a hazy collection of tiny red blobs (Manea).”

“So an accurate estimate of the cost of creating a smartphone microscope—one that includes the price of the phone itself—is more like $260 to $410. That’s a lot more than ten bucks."

“Just because something is easily transported does not erase its other shortcomings. A spoon is more portable than a large shovel, but I would not want to dig a trench with a spoon.”

Answers

Answer:

    A  : He contrasts the performance of the two different kinds of microscopes in a laboratory setting.

B   : With a real microscope, one would see individual red blood cells, their specific shapes, and their distinct movements. A smartphone microscope would give the observer a very different picture. Suddenly, the sample would look like just a hazy collection of tiny red blobs (Manea).”

Explanation: I took the test


What is different about farms today compared to farms 100 years ago?

Answers

Honest I’m not sure dude I’m sorry
Over the past century, American farming has changed dramatically. ... While American farming has certainly expanded and increased its value since 1920, there were almost three times as many farms 100 years ago than there are today—in 1920 there were 6.5 million farms, while 2020 estimates come in at two million.

Drag each tile to the correct box.
Match each modification to its effect on an ecosystem.

a) Many desert regions in the West were transformed
into lush urban areas and farmlands.

b) Water bodies in the Owens Valley and its
surrounding areas began to dry up.

c) Runoff containing disease-carrying organisms
contaminated soil and caused water pollution.

1. construction of the Los Angeles aqueduct

2. construction of large highways

3. damming of the Colorado River

Answers

Option 3 if I am correct c.

How will you demonstrate respect for differences while
treating peers as equals in interactions in the classroom and
wider school, and articulate some of your own prejudices and
provide strategies to overcome the prejudices ?

Answers

Answer:

Very funny ah ah

Explanation:

ill report you :)

why was Detroit the most city for pollution in 1950​

Answers

Answer:

Detroit was a small, compact regional manufacturing center.Explanation:

A religion that believes in a single creator and is the youngest major religion in the world (1400s).

Question 22 options:

Taoism


Jainism


Hinduism


Sikhism

Answers

Answer:

Answer D: Sikhism

Explanation:

Sikhism is one of the world’s youngest religions, which was founded just over 500 years ago.

PLEASE HELP ASAP!!
EXTRA POINTS!!
-SOCIOLOGY-
The American flag is a material object that denotes the U.S. However, many associate ideas with the flag, like bravery and freedom. In this example, what are bravery and freedom?
A. Symbols
B. Language
C. Material culture
D. Nonmaterial culture

Answers

Answer:

material culture

Explanation:

because its an object people use to define their culture

Answer:

[D] Non-material culture

Explanation:

Non-material culture refer to the concept when non-material things such as thoughts and ideas make up a culture. Connotations such as bravery and freedom are non-material so they fit well in non-material culture. One key characteristics of non-material culture is that it does not include any kind of physical object. It depends upon thoughts, ideas, beliefs, norms, values, etc... that shape up the society.

[RevyBreeze]

Is there competition in a free market economy?
• Yes •No • Only on Tuesdays

Answers

Answer:

The answer is only on tuesdays

Explanation:

Answer:

yes

Explanation:

this is because in a free market economy there are loads and LOADS of private firms, so the competition amongst firms are high

Ill give brainliest to right answer

Answers

Answer:

Federal: Attorney General, Postmaster General.

Local: Sheriff, School Superintendent.

State: County Commissioner. Fire chief is probably on this list, or local.

All of this is verified except Fire chief. Sources I found don't agree.

lake paradise is acrater lake on​

Answers

Lake Paradise, historically called "Carp Lake", is a lake that feeds the Carp Lake River. It is primarily located within Emmet County in the U.S. state of Michigan, with an eastern bay of the lake extending into Cheboygan County.

Note that common tasks are listed toward the top, and less common tasks are listed toward the bottom. According to O*NET, what are some common tasks Social and Human Service Assistants perform? Select four options. providing information keeping records or preparing reports marketing and selling products interviewing individuals or family members submitting reports, and reviewing reports or problems providing medical care as needed

Answers

Answer:

its abde

Explanation:

sorry for late response

How does culture influence politics and security issues in the Middle East?

Answers

The way in which culture influence politics and security issues in the Middle East is:

It causes conflict because of the different cultures in the Middle East

What is Culture?

This refers to the sum total of the beliefs and traditions of a particular people.

With this in mind, we can see that in the Middle East, there are different cultural groups which have various beliefs and while some are violent, others are not and this has an effect on the politics and security in the area.

Read more about culture and politics here:
https://brainly.com/question/1917783

Research on maternal depression shows that __________.

a. it does not have a lasting impact on the infant, unless it persists for more than a year
b. infants of depressed mothers have low levels of the stress hormone cortisol
c. most mothers with depression require long-term treatment for a full recovery
d. depressed mothers view their infants negatively, which contributes to their inept caregiving

Answers

It should be noted that Research on maternal depression shows that depressed mothers view their infants negatively, which contributes to their inept caregiving.

What is maternal depression?

maternal depression  can be seen to be  related to increased interparental conflict as well as relationship insecurity.

It is more family-level conflict as well as overall family functioning.

Learn more about maternal depression at:

https://brainly.com/question/11555274

What do the immigrants Levi Strauss, Jacob Riis, and Marcus Goldman have in common? a They all immigrated from Germany. b They were all successful immigrants. cThey all immigrated from Ireland. d Tho They all worked on the Transcontinental Railroad.​

Answers

The immigrants mentioned above are celebrated for their success in their respective endeavors.

Levi Strauss, Jacob Riis, and Marcus Goldman as Successful Immigrants

Levi Strauss was a German - American. He is credited for founding the first company ever to produce Blue Jeans (or denim).

Jacob Riis was an American who emigrated from Denmark. He was one of the first persons who pioneered photographs as a tool for changing society.

Marcus Goldman, on the other hand, was a Jew who migrated to America to become one of America's most successful investment bankers, and businessmen. He founded Goldman Sachs.

The correct answer, thus, is B.

Please see the link below for more about Successful Immigrants:

https://brainly.com/question/18075362

Answer:

The answer is B. They all immigrated from Germany

why natural vegetation vary according to the places in our country Nepal?

Answers

Answer:

Temperature range

Explanation: Growth of veggies depends on temperature and moisture. It also depends on factors like slope and thickness of soil.

Mothers who believe they have little power in influencing the behavior of a child are likely to _________ when interacting with the child.

Answers

If a mother who believes they have little power over a child, handles a child, they will most likely be unassertive and irritable.

Why would the mother act that way?

If the mother believes that they cannot control the child, they will show little interest in trying to. Their handling of the child will therefore be unassertive and lack confidence.

They will also be irritated by the child because they would not know what to do to take care of them.

In conclusion, they will be unassertive.

Find out more on taking care of children at https://brainly.com/question/240537.

What factors have impacted the ability of humans to live longer lives? Do you feel these factors should exist?

Answers

Significant factors in life expectancy include gender, genetics, access to health care, hygiene, diet and nutrition, exercise, lifestyle, and crime rates. Evidence-based studies indicate that longevity is based on two major factors, genetics and lifestyle choices. YES

What happened to the farmers who couldn't afford the new equipment and people's jobs were replaced by the new equipment

Answers

Answer:

Explanation: The farmers who couldn't buy the new equipment relied on the old technique of farming. There was a competition for agriculture production in the market as farmers tried to make prosperity.

The people whose jobs displaced by the new equipment went to search for new jobs. They move to one place to another in search of work and eventually landed in cities where they got work in factories.

Life was hard for the farmers, especially for those who did not own land.

Hope this helps!

I need an essay for:

“A more perfect union” focused on Justice, preamble and “We the people”.

pls, and thanks

Answers

A PERFECT UNION: In Obama’s speech “A More Perfect Union”, he emphasizes the importance of unity among Americans. He wants people to overlook their ethnic backgrounds and join together as one. This speech brought out many points that Americans should take into consideration. That even though we are all from different backgrounds, we should overlook our differences to make us a stronger nation. Obama’s speech was inspiring in some aspects, but in a way his speech also is controversial. Obama emphasizes the black community a lot more than any other community, along with, his speech was written after his former Reverend made racist comments. I, probably along with many others, may have taken this speech as a way for him not to look bad in the public eye.

Question: Where do you fit within the community?​

Answers

Answer:

I fit in as a person who will die for her allies and support the people in mental pain who will fight for justice and equality and truth and have our freedom back and i will not ever stop fighting until this cruel war is over and our flag still waves high in the setting sun.

Explanation:

or just eat some tacos and watch earth die so yeah i fit in just fine `~night

I’m in a community we’re we help each other out in need.

Helppp me, and plss hurry tyyyy!!!

Answers

Answer:

the battle of waterloo is the answer hope I helped

Other Questions
find the measure of the indicated angle Which form of poetry expresses feelings or ideas about a topic?Group of answer choices1. lyric poetry2. narrative poetry3. musical poetry4. tragic poetry Please help if you answer correctly I will give brainliest thank you!!!!!!!! A field is a rectangle with a perimeter of 960 feet. The length is 400 feet more than the width. Find the width and length of the rectangular field. CSI Miami: Using DNA to Solve a RobberyThe year is 2023. You are a detective for the Miami Dade Police Department. Youre on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the mans blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run. Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person. On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.methionine-leucine-proline = Protein that causes DARK SKINmethionine-leucine-leucine = Protein that causes LIGHT SKINvaline-proline-proline-lysine = Protein that causes GREEN EYESproline-leucine-valine-proline = Protein that causes BLUE EYESproline-lysine-proline-proline = Protein that causes BROWN EYESlysine-arginine-threonine-valine-serine-serine = BLOND HAIRlysine-arginine-threonine-valine-serine-cystine = BLACK HAIRlysine-arginine-threonine-valine-serine-valine = BROWN HAIRasparagine-isoleucine-arginine = CURLY HAIRasparagine-asparagine-isoleucine = STRAIGHT HAIRleucine-arginine-glutamic acid-arginine = BIG NOSEleucine-asparagine-arginine-glutamic acid = SMALL NOSEleucine-asparagine-asparagine-glutamic acid = MEDIUM NOSEproline-tyrosine-tyrosine-(stop) = SMALL EARSproline-proline-tyrosine-(stop) = MEDIUM EARS proline-tyrosine-phenylalanine-(stop) = BIG EARS Step 1: Decode the DNA into mRNAStep 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with. DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC | | |AUGmRNA:Protein Sequence: 1. Methionine 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?Step 5: Answer the following wrap-up questions:1) When you performed step 1, what enzyme were you imitating?2) In step 2, what molecule would have brought the amino acids that the codons asked for?3) In step 2, what molecule would have helped the amino acids line up and attach to one another?4) In step 2, what connected the amino acids together? What does In Truth's day-star mean in Edgar Allan Poe poem A Dream Which quotation from "Harrison Bergeron" by Kurt Vonnegut Jr. Best develops the theme that attempting to make people "equal every which way" is a dangerous and harmful goal? Question 3 options: "All this equality was due to the 211th, 212th, and 213th Amendments to the constitution, and the unceasing vigilance of agents of the United States. " "Then other people'd get away with it and pretty soon we'd be right back to the dark ages again, with everybody competing against everybody else. " The musicians scrambled back into their chairs, and Harrison stripped them of their handicaps, too. " "Every twenty seconds or so, the transmitter would send out some sharp noise to keep people like George from taking unfair advantages of their brains. ". PLSSS HELP IF YOU TURLY KNOW THISS You sell triangular flags made from felt. How much felt do you need to make 60 flags? Bill's chocolate bar is 69% cocoa. If the weight of the chocolate bar is 83 grams, how many grams of cocoa does it contain? Round your answer to the nearest tenth. Le dimanche 27 aot, Katy Perry (1)(donner) un concert au stade de France. a/C' (2)(tre) son premier concert parisien-Il y en a trois autres au programme, et il n'y (3)(avoir plus une seule place de libre l'intrieur, le public (4)(attendre) la star avec impatience quand tout coup, Katy Perry (5)(faire) son apparition. Elle(6)(sortir) d'une boule disco et elle (7)(commencer) sonspectacle. Les fans (8)(adorer)!Verbs in pass compose or imparfait. President Woodrow Wilson a. promoted racial equality. b. promised to respect Latin Americas independence. c. stopped U.S. investment in Latin America and the Caribbean. d. aligned with Dollar Diplomacy. e. designed a program to instill American values in Latin American schools. List three reasons why a study may be considered invalid. A neutral atom of Fluorine has seven valence electrons. How many valence electrons are present in the ion F-1? Conflict avoidance in relationship can someone explain the answer plz Which of the following is formed when minerals and extreme heat and pressure are combined? PLS I WILL GIVE YOU 23 POINTS IF YOU ANSWER ME CORRECTLYThe diagram shows 3/4 of a fraction strip shaded. Mary erases some of the shadings to show 5/8. Explain the steps she took to shade 5/8 of the fraction strip. Sean is filling his truck with gasoline. He knows the total cost, C, will be proportional to thenumber of gallons of gasoline, g, that he puts into the gas tank. After putting 8.5 gallons in.the tank, the cost is $23.63.(a) Find the ratio of the cost to the gallons as(b) What is the real world meaning of youra unit rate. Show the division as a fraction answer in (a)?and then state the answer with appropriateunits.(c) If c is the cost and g is the number ofgallons bought, write a proportioninvolving c and g and then solve it for c.(d) If Sean puts 17 gallons of gasoline intohis truck, what is his cost? Justify. 57 women make up an all female choir in a church.Two women are chosen to sing together for a duet.How many possible pairs could be chosen for the duet?