Gilmore, Inc., just paid a dividend of $2.85 per share on its stock. The dividends are expected to grow at a constant rate of 4.5% per year, indefinitely. Assume investors require return of 10% on this stock.
What is the current price? (Do not round intermediate calculations and round your answer to 2 decimal places, e.g., 32.16.)
What will the price be in five years and in fourteen years? (Do not round intermediate calculations and round your answers to 2 decimal places, e.g., 32.16.)

Answers

Answer 1

The current price of the stock is $51.82.

The price of the stock in fourteen years is projected to be $95.15.

To calculate the current price of the stock, we can use the dividend discount model (DDM). The DDM formula is P = D / (r - g), where P is the price, D is the dividend, r is the required return, and g is the dividend growth rate.

Given:

Dividend (D) = $2.85 per share

Dividend growth rate (g) = 4.5%

Required return (r) = 10%

Using the DDM formula, we can calculate the current price:

P = $2.85 / (0.10 - 0.045) = $2.85 / 0.055 = $51.82

Therefore, the current price of the stock is $51.82.

To calculate the price in five years, we can use the formula P = D * (1 + g) / (r - g):

P = $2.85 * (1 + 0.045) / (0.10 - 0.045) = $2.85 * 1.045 / 0.055 = $54.01

Therefore, the price of the stock in five years is projected to be $54.01.

To calculate the price in fourteen years, we can use the same formula:

P = $2.85 * (1 + 0.045)^14 / (0.10 - 0.045) = $2.85 * 1.045^14 / 0.055 = $95.15

Therefore, the price of the stock in fourteen years is projected to be $95.15.

These calculations are based on the assumption that the dividend growth rate remains constant at 4.5% per year indefinitely. Changes in the growth rate or other market conditions can impact the actual prices in the future.

Learn more about :  

dividend discount model (DDM) : brainly.com/question/31603195

#SPJ11


Related Questions

A disadvantage of this type of PR tools is that due to its length, customers do not always make the effort to read through its entirety.
Top of Form
Multiple Choice
a.annual reports
b.blogs
c.event advertising
d.speeches
e.brochures

Answers

Brochures can be disadvantageous as a type of PR tool because customers may not always make the effort to read through the entire content due to its length.

Brochures are promotional materials that provide information about a product, service, or organization. While brochures can be effective in conveying detailed information and showcasing offerings, their length can be a drawback.

Due to the extensive content, customers may find it time-consuming or overwhelming to read through the entire brochure. In today's fast-paced world, people often prefer concise and easily digestible information.

As a result, brochures may not always capture the attention and interest of customers, leading to a lower likelihood of the message being fully absorbed and understood.

Visit here to learn more about Brochures:

brainly.com/question/30657309

#SPJ11

.Which of the following statements are correct?
a. Final budget approvals are made shortly before the fiscal year begins.
b. Budgeting is an ongoing process in most companies
c. The master budget generally provides detailed figures for the upcoming 2 - 3 fiscal years.

Answers

B is correct; budgeting is an ongoing process in most companies. Statement A is partially correct; final budget approvals can be made shortly before the fiscal year begins, but the timing can vary.

Budgeting is an ongoing process in most companies, involving the planning, allocation, and control of financial resources. It is not a one-time event but rather a continuous effort to monitor and manage financial activities. Companies regularly review and adjust their budgets throughout the fiscal year to reflect changing circumstances, market conditions, and strategic goals. Therefore, statement b is correct.

Regarding statement a, while it is true that final budget approvals often occur shortly before the fiscal year begins, the exact timing can vary. Some companies may finalize their budgets a few weeks or months before the new fiscal year.

However, statement c is incorrect. The master budget outlines revenue projections, expense allocations, and financial targets for the upcoming year, helping guide the company's operations and decision-making. It does not usually extend to a period of 2-3 fiscal years, as suggested in statement c.

To learn more about Financial at brainly.in/question/6768303

#SPJ11

suppose the country of lilliput exported $241 billion worth of goods and imported $445 billion worth of goods in the last calendar year. 1) Calculate Lilliput\'s balance of trade:_____ billions of dollars.
2) Lilliput is running:
a)a trade deficit
b)a trade surplus
c)neither a trade deficit nor a trade surplus

Answers

Lilliput's balance of trade can be calculated by subtracting the value of imports from the value of exports. If the result is positive, it indicates a trade surplus, while a negative result indicates a trade deficit.

To calculate Lilliput's balance of trade, we subtract the value of imports from the value of exports:

Balance of Trade = Exports - Imports

Balance of Trade = $241 billion - $445 billion

Balance of Trade = -$204 billion

The negative value of -$204 billion indicates that Lilliput has a trade deficit. A trade deficit occurs when the value of a country's imports exceeds the value of its exports. In this case, Lilliput imported $445 billion worth of goods, which is higher than the $241 billion worth of goods it exported. This suggests that Lilliput is relying more on imports to meet its domestic demand than it is exporting goods to other countries.

In conclusion, based on the given values, Lilliput has a trade deficit of -$204 billion, indicating that it is importing more goods than it is exporting.

Learn more about trade deficit here:

https://brainly.com/question/1930187

#SPJ11

Which of the following is an OS security mechanism that enforces access rules based on privileges for interactions between processes, files, and users?
a. MBSA
b. Mandatory Access Control
c. Server Message Block
d. Systems Management Server

Answers

The correct answer is b. Mandatory Access Control, which is an OS security mechanism that enforces access rules based on privileges for interactions between processes, files, and users.

The Mandatory Access Control (MAC) is an OS security mechanism that enforces access rules based on privileges for interactions between processes, files, and users. MAC ensures that access to resources is granted or denied based on predefined security policies or labels assigned to subjects (processes or users) and objects (files or resources). It provides a higher level of security by limiting the actions that a subject can perform on an object, even if the subject has been granted certain privileges.

MBSA (Microsoft Baseline Security Analyzer) is a tool used to scan and assess the security state of Windows-based systems, but it does not enforce access rules.

Server Message Block (SMB) is a network protocol used for file sharing, printer sharing, and other communication between networked computers. It is not specifically related to enforcing access rules.

Systems Management Server (SMS) is a Microsoft product used for managing large groups of computers running Windows. It is not directly related to enforcing access rules either.

Learn more about OS here: brainly.com/question/28245370

#SPJ11

The market rate of interest that is used to compute the present value of a bond is affected by which of the following? Select all that apply. Check all that apply. a. Bond's coupon rateb. Bond's face value c. Tax status of the bond d. Credit quality of the bond

Answers

The coupon rate, tax status, and credit rating of the bond all have an impact on the market rate of interest used to determine the bond's present value. Here options A, C, and D are the correct answer.

A. Bond's coupon rate: The coupon rate of a bond is the fixed interest rate that the issuer pays to bondholders. The market rate of interest tends to be influenced by the coupon rate. When the coupon rate of a bond is higher than the prevailing market interest rate, the bond may be more attractive to investors, and as a result, the market interest rate may adjust upward. Conversely, if the coupon rate is lower than the market interest rate, the bond may be less appealing, and the market interest rate may decrease.

B. Bond's face value: The face value, also known as the par value or maturity value, is the amount that the bond issuer promises to repay the bondholder when the bond matures. The market interest rate can be influenced by the face value of a bond. Generally, higher face value bonds may have higher market interest rates as they represent a larger principal amount to be repaid.

D. Credit quality of the bond: The credit quality of a bond represents the issuer's ability to repay the principal and interest payments. Higher-quality bonds issued by entities with strong creditworthiness generally carry lower market interest rates as they are considered less risky. Conversely, lower-quality bonds with higher default risk may have higher market interest rates to compensate investors for the additional risk.

To learn more about coupon rates

https://brainly.com/question/17283458

#SPJ4

Which of the following is not a means of reducing direct cost through globalization?Multiple Choicea. Take advantage of lower labor.b. Take advantage of lower real estate expense.c. Take advantage of differences in production requirements.d. Reduce energy requirements.e. All the above reduce direct costs.

Answers

Reduce energy requirements not a means of reducing direct cost through globalization. Option d

While globalization can provide many benefits, including lower labor costs, lower real estate expenses, and differences in production requirements, it does not necessarily lead to reduced energy requirements.
Reducing energy requirements typically involves implementing energy-efficient technologies and processes, which may or may not be related to globalization. For example, a company could reduce energy usage by installing more energy-efficient equipment or optimizing their production processes, regardless of whether they operate globally or not.
While globalization can indirectly lead to reduced energy usage by allowing companies to source materials and products from regions with lower energy costs, it is not a direct means of reducing energy requirements.
In conclusion, while globalization can provide many benefits to companies looking to reduce direct costs, it is important to recognize that not all cost reductions can be directly attributed to globalization. Companies should consider a range of strategies to reduce costs and improve efficiency, including those related to energy usage, regardless of their global operations.

For similar question on globalization:

https://brainly.com/question/23031376

#SPJ11

Water World Inc., operates an aquarium and water park in Orlando, Florida. In addition to daily admission tickets, Water World offers two other ticket options. First, it offers an annual pass for $600 that allows unlimited access to the aquarium and theme park for one year from the date of purchase. In addition, it offers a Summer Fun Pass that allows unlimited access to the waterpark for June, July, and August for $450. Both pass options require full payment at the time of purchase. On April 1, 2017, Water World entered into a contract with a customer to purchase an annual pass. On that same date, it entered into another contract with a customer to purchase a Summer Fun Pass.1. Prepare Water World's journal entries in 2017 related to the annual pass.2. Prepare Water World's journal entries related to the Summer Fun Pass.

Answers

1. For the annual pass purchased on April 1, 2017:
April 1, 2017:
Debit: Cash $600
Credit: Unearned Revenue $600 (for receiving cash in advance of providing the service)

2. For the Summer Fun Pass purchased on April 1, 2017:
April 1, 2017:
Debit: Cash $450
Credit: Unearned Revenue $450 (for receiving cash in advance of providing the service)

Both transactions involve the receipt of cash in advance of providing the service, so the revenue is initially recorded as unearned. As the customer uses the passes, the unearned revenue will be recognized as earned revenue on a pro-rata basis over the life of the pass. For example, if the annual pass is used evenly throughout the year, $50 of revenue would be recognized each month ($600 divided by 12 months). Similarly, if the Summer Fun Pass is used evenly throughout June, July, and August, $150 of revenue would be recognized each month ($450 divided by 3 months).

To know more about Unearned Revenue visit:

https://brainly.com/question/4051749

#SPJ11

b. suppose the marginal utility of the last pair of jeans she purchased was 150 utils and for the last t-shirt she purchased it was 100 utils. is she maximizing her utility? if not, how should she change her consumption?

Answers

No, she is not maximizing her utility. To maximize utility, she should allocate her budget so that the marginal utility per dollar spent is equal for all goods. If the price of jeans is higher than the price of t-shirts, she should reduce her consumption of jeans and increase her consumption of t-shirts to achieve equal marginal utility per dollar spent.

In order to determine whether the individual is maximizing her utility, we need to consider the concept of marginal utility per dollar spent. Marginal utility measures the additional satisfaction derived from consuming one more unit of a good. Marginal utility per dollar spent, on the other hand, quantifies the satisfaction obtained from spending one additional dollar on a good.

In this scenario, the marginal utility of the last pair of jeans purchased was 150 utils, while for the last t-shirt purchased it was 100 utils. If the prices of jeans and t-shirts are equal, this would suggest that the individual is not maximizing her utility because the marginal utility per dollar spent differs between the two goods.

To achieve utility maximization, the individual should adjust her consumption pattern by allocating her budget in a way that equalizes the marginal utility per dollar spent for all goods. If the price of jeans is higher than the price of t-shirts, it means that the individual is obtaining less satisfaction per dollar spent on jeans compared to t-shirts. In this case, she should reduce her consumption of jeans and increase her consumption of t-shirts until the marginal utility per dollar spent becomes equal for both goods.

By reallocating her budget to equalize the marginal utility per dollar spent, the individual can achieve a higher level of overall utility and derive the maximum satisfaction from her available resources.

Learn more about budget here: brainly.com/question/31952035

#SPJ11

Which of the following is an analytical procedure that should be applied to the income statement? A) Select sales and expense items and trace amounts to related supporting documents. B) Ascertain that the net income amount in the statement of cash flows agrees with the net income amount in the income statement. C) Obtain from the proper client representatives, the beginning and ending inventory amounts that were used to determine costs of sales. D) Compare the actual revenues and expenses with the corresponding figures of the previous year and investigate significant differences.

Answers

One analytical procedure that should be applied to the income statement is Compare the actual revenues and expenses with the corresponding figures of the previous year and investigate significant differences. The correct option is D.

This is known as trend analysis, which involves analyzing changes in financial data over time. By comparing the current year's income statement to the previous year's, significant changes can be identified and investigated. This can provide valuable insights into the company's performance and potential areas for improvement.

However, it is important to note that the other options listed also have their own importance.

A) Selecting sales and expense items and tracing amounts to related supporting documents helps to ensure that the reported numbers are accurate and supported by evidence. B) Ascertaining that the net income amount in the statement of cash flows agrees with the net income amount in the income statement helps to ensure that there are no discrepancies between the two statements. C) Obtaining beginning and ending inventory amounts is important for accurately calculating cost of goods sold.

Overall, applying multiple analytical procedures to the income statement can provide a more comprehensive understanding of the company's financial performance.

Know more about the income statement

https://brainly.com/question/15169974

#SPJ11

On June 15, 2020, Sheridan filed his 2019 income tax return, paying a tax of $30,200. On October 5, 2021, he filed an amended 2019 return showing an additional $18,120 of tax, which he paid with the amended return. On August 22, 2023, he filed a claim for a refund of $19,932. Assuming that Sheridan is correct in claiming a refund, how much tax can he recover?

Answers

Sheridan can recover $48,320 - $19,932 = $28,388 in tax.

To determine the amount of tax Sheridan can recover, we need to consider the relevant dates and events.

Sheridan filed his original 2019 income tax return on June 15, 2020, and paid a tax of $30,200 at that time. However, on October 5, 2021, he filed an amended return showing an additional $18,120 of tax and paid it with the amended return. This means that the total tax paid by Sheridan for the 2019 tax year is $30,200 + $18,120 = $48,320.

Later, on August 22, 2023, Sheridan filed a claim for a refund of $19,932. Assuming that Sheridan's claim for a refund is valid, he can recover the requested refund amount.

To calculate the tax amount that Sheridan can recover, we subtract the refund amount from the total tax paid. Therefore, Sheridan can recover $48,320 - $19,932 = $28,388 in tax.

It's important to note that the specific rules and procedures for tax refunds may vary based on jurisdiction and tax regulations. It's always advisable for taxpayers to consult with a tax professional or the relevant tax authority to ensure accurate calculations and understanding of the refund process.

Learn more about :  

income tax return : brainly.com/question/30282780

#SPJ11

match the economic goal on the left with the example on the right that best demonstrates it.

Answers

Here are some economic goals and examples that demonstrate them:

1. Economic growth - an increase in GDP, such as when a country's economy expands due to increased investment, trade, and productivity.

2. Price stability - maintaining a low inflation rate, such as when a central bank uses monetary policy tools to keep prices stable and avoid hyperinflation.

3. Full employment - when all willing and able workers have a job, such as when a country's labor market is strong and employers are hiring.

4. Income distribution - ensuring that income is fairly distributed across society, such as through progressive taxation and social welfare programs.

5. Economic efficiency - maximizing the use of resources to produce goods and services, such as when a company adopts lean manufacturing practices to reduce waste and increase productivity.

Overall, these economic goals are important for promoting prosperity and well-being in a society. By pursuing policies that support economic growth, price stability, full employment, income distribution, and efficiency, policymakers can help ensure that resources are used effectively and that everyone has the opportunity to benefit from economic progress.

To know more about demonstrate visit -

impbrainly.com/question/29360620

#SPJ11

Which of the following will correctly calculate the total slack in an activity? 01. LS - ES 02. LF - EF 03. LS - LF 04. OLF - ES 05. Either LS - ES or LF - EF

Answers

Hi! The correct option for calculating the total slack in an activity is: 02. LF - EF (Latest Finish time minus Earliest Finish time). Total slack is the amount of time an activity can be delayed without affecting the project's completion time.

The correct answer is option 5, which is either LS - ES or LF - EF. Total slack is the amount of time an activity can be delayed without affecting the project completion date, and it can be calculated by subtracting the earliest start time (ES) from the latest start time (LS) or subtracting the earliest finish time (EF) from the latest finish time (LF). Therefore, either LS - ES or LF - EF will correctly calculate the total slack in an activity.


To learn more about slack, visit:

https://brainly.com/question/17438413

#SPJ11

an all equity firm is expected to have earnings per share in perpetuity of $6.00. the current price is $40.00 per share, which implies the equity capitalization rate (real) is 15 percent. suppose the firm issues debt and uses the proceeds to buy back stock so that expected earnings per share increase to $7.00 in perpetuity. assuming a world where modigliani-miller proposition i holds, what is (a) the new share price and (b) the new equity capitalization rate (re)? a. the new share price is (click to select) b. the new equity capitalization rate is (click to select)

Answers

a) The new share price is $5.71.

b) The New equity capitalization rate (re) is  123%.

The value of a firm is not affected by its capital structure. Therefore, the total value of the firm remains constant.

a) To find the new share price, we first calculate the total value of the firm's equity before the debt issuance, which is:

Total value of equity = Earnings per share / Equity capitalization rate
Total value of equity = $6.00 / 0.15 = $40.00

Since the total value of the firm remains constant, the new share price can be found by dividing the total value of equity by the new earnings per share:

New share price = Total value of equity / New earnings per share
New share price = $40.00 / $7.00 = $5.71

b) To find the new equity capitalization rate (re), we can use the following formula:

New equity capitalization rate (re) = New earnings per share / New share price
New equity capitalization rate (re) = $7.00 / $5.71 ≈ 1.23 or 123%

However, it's essential to note that this calculation may not accurately reflect the new equity capitalization rate as it surpasses 100%. In reality, a more comprehensive analysis of the company's capital structure and its risk profile should be considered to determine the new equity capitalization rate.

Know more about the equity capitalization rate (re),

https://brainly.com/question/29099684

#SPJ11

Notes receivable is considered a(n) :_______

Answers

Notes receivable is considered a type of asset on a company's balance sheet.

Specifically, it represents the amount of money owed to the company by its customers or other parties that have signed a promissory note agreeing to pay the company back at a later date. Notes receivable are typically recorded at their present value, which includes any interest that will accrue until the note is repaid.

This value will increase over time as interest accumulates and decrease if the note is discounted or the debtor fails to make payments. Overall, notes receivable are an important financial tool for companies to manage their cash flow and generate revenue, but they also come with the risk of default or non-payment by debtors.

To know more about Notes visit

https://brainly.com/question/29485926

#SPJ11

You have just started work as a financial analyst for Good Tools, a company that employs 1000 workers producing tools and equipment used in the construction industry. The company generates about $100 million in revenues a year. Up until now, Good Tool's leadership team has focused solely on financial metrics as their key performance measure. They are failing to achieve a competitive advantage in their industry and are ready to switch to a balanced score-card model which they have been advised will be useful to them in creating a sustainable competitive advantage. Which of the following questions not be considered while implementing the balanced score card framework?O How do we become the customer's most valued supplier and how can we create value for the customer?O When should we decide to divest assets and prepare for an exit strategy?O What are our core competencies and how do they contribute to the company goals?O How do we become more externally focused?

Answers

Out of the given options, the question that should not be considered while implementing the balanced scorecard framework.

The balanced scorecard framework is a strategic management tool that helps organizations align their goals and objectives with their vision and strategy. It focuses on four key perspectives, namely financial, customer, internal processes, and learning and growth. The framework aims to provide a balanced view of the organization's performance and helps in identifying areas that need improvement. Questions like "How do we become the customer's most valued supplier and how can we create value for the customer?", "What are our core competencies and how do they contribute to the company goals?" and "How do we become more externally focused?" are relevant in the context of the balanced scorecard as they help in achieving a sustainable competitive advantage by focusing on customer satisfaction, internal processes, and organizational learning and growth.

To know more about balanced scorecard framework visit:

https://brainly.com/question/28364092

#SPJ11

providing credible evidence such as current statistics is a positive way to influence the reader. true or false

Answers

True, providing credible evidence such as current statistics is a positive way to influence the reader. This approach adds reliability and trustworthiness to your argument or information, making it more convincing and persuasive.

True. Providing credible evidence, such as current statistics, is a positive way to influence the reader. By presenting reliable and relevant information, the reader is more likely to be persuaded and convinced of the argument being made. Using credible evidence also demonstrates the author's expertise and authority on the topic. You may back up your points and show that you know your stuff by including precise and pertinent data in your speeches. In order to avoid overwhelming the audience and keep their attention on your message, it is crucial to employ them selectively.

To learn more about statistics, visit:

https://brainly.com/question/30583509

#SPJ11

the performance of an internationally-diversified portfolio may be affected by

Answers

International market conditions and currency exchange rate fluctuations.

International diversification is a strategy used by investors to reduce risk and potentially enhance returns by investing in a variety of countries and regions. However, the performance of an internationally-diversified portfolio can be influenced by various factors. One significant factor is international market conditions. Economic, political, and regulatory changes in different countries can impact the performance of investments held in a diversified portfolio. For example, economic downturns or geopolitical tensions in certain regions may negatively affect the overall portfolio performance.

Another factor that can affect the performance of an internationally-diversified portfolio is currency exchange rate fluctuations. When investing in foreign markets, investors are exposed to currency risk. Fluctuations in exchange rates can impact the value of investments denominated in foreign currencies when converted back to the investor's domestic currency. If the investor's home currency strengthens against foreign currencies, it can reduce the returns of investments held in those currencies.

Therefore, investors in an internationally-diversified portfolio should closely monitor international market conditions and keep track of currency exchange rate movements to assess the potential impact on their portfolio's performance.

To learn more about International

https://brainly.com/question/14690606

#SPJ11

Other things the same, what could explain a rise in sweden's net capital outflow?

Answers

There are several factors that could explain a rise in Sweden's net capital outflow. One of the main reasons could be an increase in foreign investments in Sweden. When foreign investors invest in Swedish companies or assets, they typically need to transfer money from their own country to Sweden.

This transfer of funds would increase Sweden's net capital outflow. Additionally, a rise in domestic interest rates could also contribute to an increase in net capital outflow as investors seek higher returns on their investments abroad. Another possible factor could be a decline in the value of the Swedish krona. If the krona were to weaken, it would make Swedish assets cheaper for foreign investors, encouraging more capital inflows and increasing net capital outflow. Finally, changes in government policies, such as tax incentives for foreign investors or restrictions on capital flows, could also impact Sweden's net capital outflow.

To know more about Swedish companies visit:

https://brainly.com/question/29513834

#SPJ11

To reduce the substantial work that needs to be done to customize an ERP application to a particular customer, ERP vendors provide ________.
a.inherent processes
b.industry-specific solutions
c.DIY modules
d.service descriptions

Answers

To reduce the substantial work that needs to be done to customize an ERP application to a particular customer, ERP vendors provide b. industry-specific solutions.

To reduce the substantial work that needs to be done to customize an ERP application to a particular customer, ERP vendors provide inherent processes and industry-specific solutions. These pre-designed processes and solutions are built into the ERP application and can be tailored to the specific needs of the customer. This reduces the amount of customization that needs to be done, making the implementation process faster and more efficient. Some ERP vendors also provide DIY modules, allowing customers to customize certain aspects of the application themselves. Additionally, ERP vendors provide service descriptions that outline the level of customization and support they can provide to their customers.


To learn more about ERP vendors, visit:

https://brainly.com/question/29575863

#SPJ11

amazon owns the inventory that third-party sellers provide via the 'fulfillment by amazon' service. TRUE/FALSE

Answers

TRUE. When third-party sellers use the "fulfillment by Amazon" service, they send their inventory to Amazon's fulfillment centers and Amazon takes ownership of the inventory. A

mazon then stores, picks, packs, and ships the products on behalf of the sellers. Additionally, Amazon also handles customer service and returns for these orders. Amazon does not own the inventory provided by third-party sellers via the 'Fulfillment by Amazon' service. The third-party sellers retain ownership of their content-loaded inventory while Amazon simply provides storage, packaging, and shipping services on their behalf. On behalf of the sellers, Amazon then stores, selects, packs, and sends the goods. The customer assistance and returns for these purchases are likewise handled by Amazon.

To know more about third-party sellers, visit:

https://brainly.com/question/17462800

#SPJ11

Which of the following are barriers to entry that are directly enforced by government?

A. An established reputation for slashing prices in response to new entry.

B. A well-respected brand name built up over many years.

C. A permit required to conduct business operations.

Answers

The correct answer to your question is C. A permit required to conduct business operations.

This represents a barrier to entry that is directly enforced by the government. Barriers to entry are factors that prevent or limit new businesses from entering a market. In this case, the government imposes regulations, such as permits and licenses, to control the entry of new firms.

This ensures that only qualified businesses operate in the market, maintaining standards and compliance with relevant laws. Options A and B, an established reputation for slashing prices and a well-respected brand name, are not enforced by the government but are market-based factors influencing entry. The correct option is C.

For more about business operations:

https://brainly.com/question/24142702


#SPJ4

true or false? leadership in band societies is usually ascribed and permanent.

Answers

False, leadership in band societies is not usually ascribed and permanent.

In band societies, leadership is typically informal and based on personal qualities or skills, such as wisdom, experience, or hunting abilities, rather than on ascribed and permanent positions. Leaders often gain influence through their actions and abilities, and their status can change over time.

. Societies organized as groups are usually made up of hunters who rely on hunting and gathering and thus live a nomadic lifestyle. They are few in number  and form small groups of small families and demographic variations. The band has no formal leadership. A band is the smallest unit of political organization, made up of just a few families, and has no formal leadership. Tribes are populous but organized on the basis of family ties and have a fluid or changing system of temporary leadership.

To know more about leadership in band societies  visit:

https://brainly.com/question/31422325

#SPJ11

On June 1, 20Y2, Herbal Co. received $18,900 for the rent of land for 12 months. Journalize the adjusting entry required for unearned rent on December 31, 20Y2.

Answers

December 31, 20Y2 Adjusting Entry:

Debit Unearned Rent ($12,075), Credit Rental Revenue ($12,075).

How to journalize unearned rent adjustment?

To journalize the adjusting entry for unearned rent on December 31, 20Y2, we need to recognize the portion of rent that has been earned and defer the remaining unearned amount. Here's how the entry would look:

Date: December 31, 20Y2

1. Recognize the portion of rent earned:

  Debit: Unearned Rent (liability account) - $18,900 / 12 months * 7 months (June to December) = $12,075

  Credit: Rental Revenue (income account) - $12,075

2. Defer the remaining unearned rent:

  Debit: Unearned Rent (liability account) - $18,900 - $12,075 = $6,825

  Credit: Rent Revenue (income account) - $6,825

The adjusting entry will result in the following balances:

- Unearned Rent (liability account): $6,825

- Rental Revenue (income account): $12,075

Learn more about: unearned rent

brainly.com/question/31017865

#SPJ11

A typical change request form will include:__________

Answers

A typical change request form will include essential details such as the requestor's name, the date of the request, a description of the change required, the impact of the change, the reasons for the change, and the priority level of the request.

Additionally, the form may also contain information about the affected system or process, the expected timeline for implementation, any potential risks or issues, and the approval process for the change.

The form may also require signatures from relevant stakeholders, such as project managers, business analysts, and IT personnel, to ensure accountability and transparency throughout the change management process.

Overall, the purpose of a change request form is to provide a structured approach for managing changes, enabling stakeholders to assess the impact of the change and make informed decisions regarding its implementation.

To know more about typical change, refer to the link:

https://brainly.com/question/32305496#

#SPJ11

Which of the following is most likely to cause a decrease in the aggregate expenditure (AE) curve?a.A decrease in wealthb.A government stimulus checkc.An increase in unemployment benefitsd.An increase in education spending

Answers

The most likely option to cause a decrease in the aggregate expenditure (AE) curve is a) A decrease in wealth.

Here's a step-by-step explanation:

1. Aggregate expenditure (AE) is the sum of consumption, investment, government spending, and net exports in an economy.
2. A decrease in wealth typically leads to a decrease in consumption, as people have less money to spend on goods and services.
3. With lower consumption levels, the AE curve will shift downward, reflecting a decrease in total spending in the economy.
4. The other options (b, c, and d) are all factors that generally increase the AE curve, as they all involve increased spending by the government or individuals.

Know more about aggregate expenditure here:

https://brainly.com/question/23155801

#SPJ11

you must be an administrator running a console session in order to use the sfc utility.

Answers

Yes, that is correct. The sfc utility (System File Checker) is a command-line tool in Windows that scans and verifies the integrity of system files.

In order to use this utility, you need to have administrative privileges and run the command prompt in console mode. This means that you need to be logged in as an administrator and use the command prompt directly on the machine, rather than through a remote session or other means. If you try to run the sfc utility without the necessary permissions, you will likely receive an error message stating that you need to be an administrator.

Learn more about sfc utility (System File Checker): https://brainly.com/question/30256329

#SPJ11

Suppose the binarySearch method is called with an array containing 2,000 elements sorted in increasing order. What is the maximum number of times that the statement indicated by / Calculate midpoint / could execute?
Select one:
a. 2,000
b. 1,000
c. 20
d. 11
e. 1

Answers

The maximum number of times the command labeled "/ Calculate midpoint /" can execute in the binarySearch method depends on the size of the array.

In binary search, the algorithm repeatedly divides the search space in half to find the target element.

The binary search algorithm follows these steps:

1. Compare the target value to the center of the field.

2. If the target value is equal to the mean value, the search is successful.

3. If the target value is less than the mean value, repeat the search in the left half of the field.

4. If the target value is greater than the mean value, repeat the search in the right half of the field.

Since the array contains 2000 elements and is sorted in ascending order, the binary search algorithm will divide the search space in half until it finds the target element or finds that it does not exist. In each iteration, the search space is halved and the center of the remaining search space is calculated.

The number of times the command labeled "/ Calculate midpoint /" can be executed corresponds to the number of iterations the binary search algorithm needs to find the target element. In this case, the maximum number of times the statement can execute is equal to the number of times the array can be split in half, which is the base 2 logarithm of the array size.

So the maximum number of times the statement can be executed is logarithmic base 2 of 2000, which is approximately 10.97. Since the number of iterations must be an integer, the maximum number of executions of the statement is 11 (option d).

In short, when the binarySearch method is called with an array containing 2000 elements sorted in ascending order, the maximum number of times the statement labeled "/Calculate midpoint /" can be executed is 11.

For more such questions on binarySearch ,

https://brainly.com/question/28562635

#SPJ11

c. 20. The maximum number of times the statement indicated by "/ Calculate midpoint /" could execute in a binary search is 20.

In a binary search algorithm, the search space is divided in half at each iteration. Since the array contains 2,000 elements, the maximum number of times the array can be divided in half is determined by the logarithm base 2 of the array size. In this case, the logarithm base 2 of 2,000 is approximately 10.96. Since we cannot have a fraction of an iteration, the maximum number of iterations would be 11. However, the first iteration is not a true division but a comparison, so the "Calculate midpoint" statement executes one less time. Therefore, the maximum number of times the "Calculate midpoint" statement could execute is 20.

To learn more about comparison click here

brainly.com/question/32155258

#SPJ11

to isolate the impact of one single factor, economists invoke the assumption of:______.

Answers

To isolate the impact of one single factor, economists invoke the assumption of ceteris paribus, which means "all other things being equal" or "holding everything else constant."  

This assumption allows economists to examine the relationship between two variables while assuming that all other relevant factors remain unchanged.

Ceteris paribus is used to simplify economic analysis and focus on the specific impact of a particular factor or variable. By assuming that everything else remains constant, economists can isolate the effect of the variable they are studying and observe how changes in that variable influence the outcome.

For example, if economists want to study the relationship between price and demand for a product, they may use the ceteris paribus assumption to hold other factors constant such as income levels, consumer preferences, and the prices of related goods. By doing so, they can analyze how changes in price alone affect the quantity demanded, without the interference of other factors that could influence demand.

While ceteris paribus assumptions are useful for theoretical analysis and isolating specific factors, in reality, it is challenging to completely hold all other factors constant. Nevertheless, this assumption helps economists in making simplified models and understanding the impact of individual variables in the economy.

Learn more about demand brainly.com/question/30402955

#SPJ11

severe leaching of tropical lateritic soils has produced economically important ore deposits of:_____

Answers

Bauxite, which is an economically important ore deposit, is produced through severe leaching of tropical lateritic soils.

Severe leaching of tropical lateritic soils has resulted in the formation of economically significant ore deposits, particularly bauxite. Lateritic soils are typically found in tropical regions with high rainfall and prolonged weathering processes. These soils are rich in iron and aluminum, which are leached out by the abundant rainfall. As the water percolates through the soil, it dissolves and removes soluble elements, leaving behind residual deposits enriched in aluminum and iron oxides. Bauxite, a mixture of aluminum hydroxides and oxides, is the principal ore for aluminum production. The intense leaching process in tropical environments facilitates the concentration of aluminum minerals into commercially viable deposits, making them crucial for the global aluminum industry. The economic importance of these ore deposits lies in their high aluminum content, allowing for the extraction and processing of aluminum, a vital metal used in various industries such as construction, transportation, and packaging.

Learn more about economically here: brainly.com/question/14355320

#SPJ11

a consumer’s budget constraint shows the possible combinations of different goods she can buy given _________ and _______.
a. the prices of the goods; the purchasing power of the dollar
b. her income; the prices of the goods
c. the wage she earns on her job; the marginal rate of substitution
d. diminishing marginal utility; the amount of money she has to spend

Answers

Hi there! The answer to your question is: a consumer's budget constraint shows the possible combinations of different goods she can buy given her income and the prices of the goods. So, the correct option is (b).

A budget constraint represents the limit on what a consumer can afford to buy based on their income and the prices of the goods. It is a fundamental concept in microeconomics that helps to understand how consumers make choices about their consumption patterns, given their limited resources and the market prices of the goods they desire to purchase. In essence, the budget constraint illustrates the trade-offs a consumer must make when deciding what combination of goods to buy within their financial means.

To know more about  consumer's budget visit :-

https://brainly.com/question/29602648

#SPJ11

Other Questions
explain how one would use epistasis analysis to determine order of gene action in genetic networks? .Using a cubit equal to 18 inches, calculate thedimensions of Noah's Ark in feet.Length: __________ feet.Width: ______ feet.Height: ______ feet. Question 6 1.5 pts All of the following processes involve snow metamorphism EXCEPT O Consolidation of snowpack following a winter stomm. Decreased snowfall on leeward sides of mountain ranges. O Wind-loading of slopes, producing slabs. O Depth-hoar tormation due to gradients in temperature and humidity. Springtime formation of com-snow and firn. D Question 7 1.5 pts Agriculture in tropical mountains is most likely to use which of the following techniques? O Transhumance O Pastoral Nomadism Shifting Cultivation O Cash-crop Pastoralism O Dude Ranching Question 8 1.5 pts Next year, SUV manufacturers sell more SUVs at a lower price. Which of the following events would have this effect? Select an answer and submit . For keyboard navigation, use the up/down arrow keys to select an answer. a an increase in the price of steel, which is used in the construction of SUVs. b a increase in the price of electric cars. an increase in the number of manufacturers of SUVs. d an increase in the price of gasoline. Which of the following defines non-functional requirements?A. Statements of services the system should provide.B. Constraints on the services or functions offered by the system.C. Requirements that come from the application domain of the system. 14) balance the equation S + 0 => S0 which mineral group has silicon-oxygen tetrahedra bonded in a sheet structure? Suppose you have two similar rectangular prisms. The volume of the smaller rectangular prism is 64 in and the volume of the larger rectangular prism is 1,331 in. What is the scale factor of the smaller figure to the larger figure?4:111:213:109:25 the current republican control of government in texas occurred with the results of the by august 1804, what area of the united states had the expedition moved into? in his famous book, the prince, niccol machiavelli argued that princes must into four patches, estimate the value below. Let H be the hemisphere x2 + y2 + z2 = 43, z 20, and suppose f is a continuous function with f(3, 3, 5) = 13, f(3, -3,5) = 14, f(-3, 3,5) = 15, and f(-3, -3,5) = 16. By dividing (Round your answer to the nearest whole number.) Slaxy f(x, y, z) ds WHATS THE RIGHT ANSWER PLEASE EXPLAIN I WILL MARK YOU BRAINLIEST. .In groups such as cross-functional teams, the key challenge for teams whose members have unique knowledge and expertise ishow to integrate the diverse knowledge of the team members so that it is meaningful to the team's purpose.minimizing conflicts.keeping team members engaged in the project.minimizing costs for the continuing education of its members. a trader has a put option contract to sell 100 shares of a stock for a strike price of $60. consider the following scenarios: i. a $2 dividend being declared ii. a $2 dividend being paid iii. a 5-for-2 stock split iv. a 5% stock dividend being paid. use the information above to answer the following question: what is the effect on the terms of the contract of scenario iv? the put option contract gives the right to sell 95 shares for $56.86 the put option contract gives the right to sell 105 shares for $57.14 no effect. the put option contract gives the right to buy 105 shares for $57.14 the put option contract gives the right to buy 95 shares for $56.86 Circle the section on the dna template where the example primer would bind in the following sequence:3' ATTGCGCATTCCGATGGCTCGGAATAAGGCCGTCCTATTCAT 5'Example Primer: 5' ATTCCG 3' you are an it technician for your company. your boss has asked you to set up and configure the sick role is defined as? group of answer choices the pattern of expectations that define appropriate behavior for the sick and for those who take care of them the social sanctions faced by a person who claims to be sick for too long an illnesses that is questioned or considered questionable by some medical professionals the discriminatory practices used by corporations when an employee takes sick leave Array elements must be ________ before a binary search can be performed.A) summedB) set to zeroC) sortedD) positive numbersE) None of these where is a time-temperature indicator (tti) most commonly found?