Help!! does anyone know the answer??

Help!! Does Anyone Know The Answer??

Answers

Answer 1

Answer:

i think its osmosis

Explanation:

Answer 2
A. Osmosis, is the correct answer

Related Questions

Fossils usually occur in metamorphic rock. true or false?​

Answers

Answer:

false

Explanation:

They can't survive the great pressures metamorphic rocks go through. They usually are only in sedimentary rocks. Hope this helps!

Answer:

false

Explanation:

Fossils are very fragile and metamorphic rocks go through some harsh changes, so i'd be impossible for fossils to stay intact or even form in metamorphic rocks

Plz help I’ll mark brainliest

Answers

Answer:

I'm pretty sure it's exponential growth.

Explanation:

Answer:

expontential growth!!

Explanation:

how does the nitrogen cycle start from nitrites and end with nitrates? (full answer) ​

Answers

Explanation:

The nitrogen cycle seems to be the nitrogen form of recycling, that requires fixing of nitrogen, Teodoro mamoncillo, nitrogen removal, and deionization. The mechanism whereby the nitrogen and nitrites are subsequently converted to nitrogen fixation is denitrification. 

why does the cell get longer during anaphase

Answers

Answer:chromosomes are separated by a structure called the mitotic spindle and then pulled by the spindle to opposite poles of the cell

Explanation:

A new drug is discovered for the treatment of thyroid cancer. Which is a logical next step of the scientific method after the discovery has been successfully tested?


keeping the information private

testing the drug on animals

sharing the data with other scientists

testing the drug on people

Answers

Answer:

The answer would probably be either c or d

If the color differences were less distinct (ex. all butterflies were only shades of reds and oranges), would you expect similar results? Explain what you would expect and why.

Answers

Answer:

If the color differences were less distinct (ex. all butterflies were only shades of reds and oranges), would you expect similar results? ... That the predator has the ability to associate the prey to the sickness, and that the predator can distinguish the color difference.

Explanation:

The predator has the ability to associate the prey to the sickness, and that the predator can distinguish the color difference.

What the Viceroy's color pattern evolved?

The Viceroy's color pattern has been evolved because the natural selection favoured them. The viceroy butterfly camouflage as the monarch butterfly as well as the exhibit Mullerian mimicry where as these two toxic species has the mimic each other for their benefit and by time natural selection has been favoured these.

Natural selection has been the process by which the reproductively fitest has the populations of the living organisms survive, adapt and change. The viceroy butterfly has the brush-footed butterfly having the dark orange colour with the black veins and row of the white spots on the border of its wings.

Monarch butterfly has the same as that of the viceroy except that it has the black horizontal stripes that has cross the bottom of its back wings. Species has refers to the group of the organisms which have the similar features and which are able to be interbreed to produce the viable and the fertile offspring.

Therefore, reproductive isolation prevents interbreeding between members of different species. It includes a collection of behavioral, evolutionary, and physiological processes.

Learn more about reproductive isolation on:

https://brainly.com/question/3089401

#SPJ3

2.3/6.E.2.4 Test 1 2 of 30
Which element causes soil to appear red?
O A. calcium
B. iron
c. magnesium
D. silicon

Answers

Answer:

B

because iron appears the color red

Organisms are composed of many complex molecules. These molecules are composed mainly of carbon, hydrogen, oxygen, nitrogen, sulfur, and phosphorus. Which of the following statements most accurately describes how these molecules are made in ALL organisms?​

Answers

Its oxygen because all living organisms need oxygen to survive

Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.

AUUUAACUGUUCUGUCUAGAG


1.

Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?

2.

Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

3.

Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Answers

Answer:

TAA ATT GAC AAG ACA GAT CTC

1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.

2. codon

three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).

3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.

OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)

The mRNA sequence could be translated into three different sets of amino acids because of the degeneracy of the genetic code.
Using the genetic code to translate the mRNA sequence, we get the following three possible sets of amino acids:Set 1: isoleucine-phenylalanine-leucine-serine-valine-arginineSet 2: isoleucine-asparagine-valine-leucine-serine-arginineSet 3: isoleucine-asparagine-leucine-serine-valine-arginine

3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.

What is a nucleotide sequence?

A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.

Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.

Learn more about nucleotide sequence, here:

https://brainly.com/question/30299889

#SPJ6

What is the probability of getting a short pea plant when crossing the parents Tt with tt?

Answers

Answer:

50%

Explanation:

One half of the punnet square would be Tt and the other half would be tt.

helppp hah im stuck with this

Answers

It won’t show the picture

Answer:

oh

Explanation:

Important vocabulary continued: what is the difference between a unicellular organism and a multicellular organism?

Answers

unicellular has one singular cell, multicellular has more than one

Answer:

unicellular is a organism that is only one cell. most of the time they are your bacteria and viruses. while a multicellular organism is a organism with many cells. can be anything from something you cant to to plants and animals that you can see

Explanation:

Based on an analysis of the data, describe the effect of karrikins on seed
germination in the autotrophic host plants and the obligate parasitic weed plants.

Answers

Answer:

It triggers seed germination by activating hormone.

Explanation:

Karrikins has a great effect on seed  germination in the plants as well as the obligate parasitic weed plants because it trigger the germination of seed by signaling of hormone known as strigolactone which is responsible for the germination of see. Karrikins are the group of plant growth regulators which is present in the smoke of burning plant.

Is glucose more or less complex than the rest of the biomolecules? Explain.

Answers

Answer:

Less complex.

Explanation:

Glucose is both a monomer and simple sugar.

Glucose is a monosaccharide. It is a biomolecule. It is less complex than the rest of the biomolecules, such as proteins, lipids, and other complex carbohydrates like glycogen.

 

What is a biomolecule?

Biomolecules are present inside the cell. Carbohydrates, proteins, and lipids are some examples of biomolecules. Carbohydrates are divided into monosaccharides, disaccharides, and polysaccharides.

A monosaccharide has a single unit. Examples are glucose, fructose, etc. A disaccharide consists of two units. An example is maltose. Maltose is made up of two units of glucose connected by a glycosidic bond. An example of a polysaccharide is glycogen. Multiple sugar units are connected by glycosidic bonds to form glycogen. It is a storage product.

Carbohydrates are present on our cell surface as peptidoglycan. Protein is a biomolecule that is made up of amino acid monomers. They make the different structures of a cell, such as actin fibers, etc. Lipid is made up of hydrogen and carbon. Examples are cholesterol, phospholipids, etc.

Hence, in comparison to all other biomolecules, glucose is the simplest.

To learn more about biomolecule, refer to the following link:

https://brainly.com/question/12299485

#SPJ2

Why is cellular differentiation
important for the development of a fully formed human infant?

Answers

Answer:

Cellular differentiation is necessary for the development of a fully formed human infants because cellular differentiation leads to the formation of different tissues and organs which are required for the development of human infant. Without tissues and organs our body cannot function properly.

Answer:

Cellular differentiation is necessary for the development of a fully formed human infants because cellular differentiation leads to the formation of different tissues and organs which are required for the development of human infant.

:

In a chemical bond between two or more atoms, what creates the bond?
A. Proton pairs
B. Electron pairs
C. Diametric energy force
D. The nucleus

Answers

Answer:

I think C diameteic energy may be right ans\

Which action is harmful to organisms living in water ecosystems

Answers

general pollution! as well as cultural eutrophication! could be harmful to water ecosystems and are in fact the most prominent reason. pollution could include excess fertilizer run off going into a creek. the nitrogen and phosphorus will create a perfect environment for algae and bacteria. thus leading to cultural eutrophication.

Make a food web for the rainforest

Answers

Answer:

VEGETERIANS, VEGANS, CARNIVORES, CANNIBALS, Omnivores

Explanation: EVERYWHERE!!

Which mechanism of transport takes place without expending cellular energy?

Active
Hypotonic
Isotonic
Passive

Answers

Passive 123456799483762

Answer:

c

Explanation:

What are the DNA strands called?
What is the RNA stand called?

Answers

Answer:

it rna means

Ribonucleic acid

Answer:

DNA strands - polynucleotides

RNA strand - nucleotide chain

Explanation:

DNA strands are known as polynucleotides because they are comprised of two nucleotide chains.

RNA is composed of a single nucleotide chain.

Hope this helps :)

A primary air pollutant is put directly into air by human activity.What is a secondary air pollutant

Answers

Answer:

Acid Rain

Explanation:

Acid rain, which is made up of several acidic compounds, forms when sulfur dioxide and nitrogen dioxide react in the air with water, oxygen and other chemicals. On the ground, acid rain damages plants and trees and increases the acidity levels of soils and bodies of water, causing damage to ecosystems. Acid rain also causes decay to buildings and can irritate the eyes and airways.

Cell specialization is important during the growth and development of a multicellular organism. This process is most directly regulated by _____________.

Answers

Answer:

atp

Explanation:

The least amount of vertical change during the monthly tidal cycle occurs
a. At the beginning of the month
b. At the end of the month
c. at the quarter moons
d. at the full moon​

Answers

It’s d because if you think about it the monthly tidal cycle is a full moon and you will see that on a full moon does that make sense? Lol

What type of muscle has a primary purpose of animal movement?

A) cardiac muscle
B) smooth muscle
C) tendons
D) skeletal muscle

Answers

Answer:

B. Smooth Muscle

Explanation:

Medusae are among the simplest animals that use muscles to make rhythmic movements. In at least some medusae, the circular muscles, which do most of the work of swimming, are striated. In contrast, most of the other muscles of cnidarians are smooth.

Answer:

D) skeletal muscle

Explanation:

skeletal muscle cells join together to form fascicles, and fascicles form the skeletal muscle.

Does all human activity have a negative impact on the environment and
ecosystems? *
A:NO
B:YES

Please help for my homework

Answers

Answer:

No

Explanation:

Answer:

A. NO

Explanation:

Because it depends if the activity. negatively or positively. Because humans can be very careful of how they affect the Earth and sometimes they can't.

The conditions for an enzyme to work need to be?

Answers

They need to be capable of making proteins in that area

PLEASE HELP
Which process does this picture show?*

Transcription
Translation
Replication
Transformation

Answers

transformation i think iono lol


What cellular structure begins to reform during telophase?

Answers

Answer:

nuclear membrane

Explanation:

what’s the chemical reaction for the digestion of fats.

Answers

Answer: The chemical reaction for the digestion of fats is when A triester is produced through the chemical reaction of three fatty acid molecules with glycerol, a molecule that contains three hydroxyl groups. When fats are broken down these fatty acid chains and glycerol are free for the body to use.

Explanation:

Lipids (fats and oils)

Lipase enzymes break down fat into fatty acids and glycerol. Digestion of fat in the small intestine is helped by bile, made in the liver. Bile breaks the fat into small droplets that are easier for the lipase enzymes to work on. Bile is not an enzyme.

7 Which answer best describes
condensation?
A A gas changing into a liquid
B A liquid changing into a solid
C A solid changing into a liquid
D A liquid changing into a gas

Answers

A is the correct answer.
The answer is: A gas changing into a liquid
Other Questions
HURRY I NEED THIS IN 20 mins please help me Write an equation for the function g whose graph is the graph offf(x) = -100(1.05)translated to the right 5 units and up 50 units. What was tribute in the Aztec Empire?a sacrifice given to the godsa gift given by enemy territoriesa ceremony that pledged loyaltya payment made by conquered people The measure of software complexity that measure how complex a software is in machine's viewpoint in terms of how the size of the input data affects an algorithm's usage of computational resources is known as Computational Complexity.a. Trueb. False what are some good classroom norms? Why? What is the sum of (8a+2b-4) Individuals can also teachthemselves to reduce tensionthrough following techniquesexcept:Select one:a. Over sleeping b. Deep breathingc. Hypnosis,d. Meditation,= Over sleeping Which sentence contains a capitalization error? A. The Empire State Building, located in New York City, received its own zip code in 1980. B. Ray attended Boulder Canyon middle school in Breckenridge, Colorado. C. The weather was beautiful, so Trina packed a picnic lunch to eat in Valley Forge Park. D. Adams favorite restaurant is called Pita Palace, and it is on Oakland Avenue. ITS ESPANOLCould somebody write this sentence in SPANISH Hello! I want to drink coffee. I'll go to the cafe this afternoon at 3 p.m. Would you like to come with me? Your friend lilyBUT IN SPANISH PLZ What photo editing function would you choose for a photo where the colors are faded?A. ExposureB. ContrastC. SaturationD. Filter Two spherical objects with a mass of 3.17 kg each are placed at a distance of 2.96 m apart. How many electrons need to leave each object so that the net force between them becomes zero Kayla and totsakan each improved their yards by planting hostas and shrubs. They bought their supplies from the same store. Kayla spent $80 on 8 hostas and 5 shrubs. Totsakan spent $85 on 9 hostas and 5 shrubs, find the cost of one hosta and the cost of obe shrub. These three points are collinear. (3, 6), (-2, -9), (0, -4)True False what is the absolute vaule of the number you wrote as an answer to number 1 PLEASE HELP ASAP I WILL MARK AS BRAINLYEST Canada is completely surrounded by water. True or false? 5 less than a number is -2. What is thenumber? Write onequation and solve. A company buys up its competitors and forms one giant company. This is an example of consolidation? Vertical or horizontal Which method of protest (boycotts, sit-ins, or marches) had the greatest impact on the civil rights movement? Why? What steps will add a totals row to a database? Use the drop-down menus to complete them.1. In the Home tab, go to the Records group.2. Click the button and a totals row will be added to the of the database.3. In each column of the totals row, select the formula for the row to calculate.4. For a count total of how many records qualify, select .5. For a total amount in currency column, select . Pls help i dont understand noel can wash 20 cars in 1.6 hours. How many cars can she wash in 4 hours?