Help I'm confused!
This is the beginning sequence of the first exon in the mRNA sequence:

AUGAAGCUCUUUUGGUUGCUUUUCACCAUU

Give the DNA/genomic sequence it was transcribed from.

Answers

Answer 1

Answer:

TACTTCGAGAAAACCAACGAAAAGTGGTAA

Explanation:

Transcription is the process by which a strand of DNA is copied into mRNA.

Remember that in mRNA, U (Uracil) bonds with A (Adenine).

Hope that helps.


Related Questions

the molecules made by living cells are mainly assembled around which element?
A. calcium
B. carbon
C. hydrogen
D. oxygen

Answers

Answer:

Carbon atoms B.

Explanation:

The atoms of an organic molecule are typically organized around chains of carbon atoms. Inorganic compounds make up 1%–1.5% of a living cell's mass. They are small, simple compounds that play important roles in the cell, although they do not form cell structures

13)
The bacteria that cause tetanus can survive in a puncture wound that has healed on the outer
surface of the skin in an environment without oxygen present. Through what process do these
bacteria acquire the energy they need to survive?
A)
Aerobic respiration
B)
Anaerobic respiration
aliol
he
anind
1:29
C)
Photosynthesis
D)
Homeostasis

Answers

Answer:

B)

Anaerobic respiration

Explanation:

All living organisms require energy for survival. They obtain this energy via the process of cellular respiration, where they breakdown the energy in their ingested food. However, the process of cellular respiration can either be aerobic (with oxygen) or anaerobic (without oxygen).

Anaerobic respiration is carried out by organisms who do not require OXYGEN for the process. This is the case of the bacteria described in this question which survive in a puncture wound that has healed on the outer surface of the skin in an environment without oxygen present. The type of respiration carried out by this bacteria is ANAEROBIC RESPIRATION.

CAN SOMEONE PLEASE HELP ME WITH THIS SCIENCE QUESTION THANK YOU !!!
about what percent of americans get their water from wells?
a)100%
b)50%
c)0%
d)5%​

Answers

when u search it up it says 13% but i think d

Private wells are the main source of water for about 5% of Americans. These wells often draw water from underground aquifers and are located on private land. Therefore, the correct option is D.

In different parts of the United States, the use of wells may vary, with rural communities more likely to rely on wells for their water supply. Drilling or digging are common methods for obtaining water from a well, and maintaining water quality and safety is the responsibility of homeowners. The choice of using wells is influenced by factors such as location, access to public water systems, and local laws. Well owners must frequently test their water to ensure that it complies with health and safety requirements.

Therefore, the correct option is D.

Learn more about water system, here:

https://brainly.com/question/32409070

#SPJ6

How is the absorption of ultraviolet light by DNA and RNA important in the analysis of nucleic acids? A. Nucleic acids absord UV licht maximaly at wavelengths of 247 to 250 m Using this phenomenon one can oftendermine the presence and concentration of nucleic acids in a mixture, since proteins absorb UV light maximally a 200 m B. Nucleic acids absorb UV light maximaly at wavelengths of 254 to 260 proteins absorb UV maximally at 200 mm m. Using this phenomenon, one can to determine the presence and concentration of nucleic acids in a mixture, since C. Nucleic acids absorb UV light maximalyal Wavelengths of 254 to 280 nm. Using this phenomenon one can hen determine the presence and concentration of nucleic acids in a since proteins absorb UV light maximally at 270 mm D. Nucleic acids absorb UV light maximally at wavelengths of 247 10 250 nm. Using this phenomenon, one can often farmine the presence and concentration of nucleic acids in a mixture, since proteins absorb UV light maximally at 270 nm

Answers

Answer:

B. Nucleic acids absorb UV light maximally at wavelengths of 254 to 260. Proteins absorb UV maximally at 200 nm. Using this phenomenon, one can to determine the presence and concentration of nucleic acids in a mixture.

Explanation:

The concentration of a solution of nucleic acid  can be determined by measuring the absorbance at 260 nm, using a  spectrophotometer. An A260 of 1.0 is equivalent to a concentration of 50 μg/mL for double-stranded DNA, or 40 μg/mL for single-stranded DNA or RNA. If the A280 is also determined, the A260/A280  ratio indicates if there are contaminants present, such as residual  phenol or protein. The A260/A280 ratio should be around 1.8 for pure  DNA and 2.0 for pure RNA preparations.

Explain why energy transfer between trophic levels are not vwry efficient (around 10%)?​

Answers

Explanation:

The energy transfer between trophic levels are not vwry efficient (around 10 %) energy is lost when one trophic level goes to a level higher. This is due to the fact that organism is not fully decomposed and also heat is lost in the conversion from the organism to energy to the consumers.

How does Molecular Determinants of Scouting Behavior in Honey bees relate to our discussion about juncos in our last class?

Answers

We cant answer this because we are missing the information of what was talked about in your last class, sorry mate

please help meee

3. Atoms are composed of
A. protons, neutrons and negatons
B. positons, neutrons and electrons
C. protons, notrons and electrons
D. protons, neutrons and electrons

Answers

Answer:

D.

Explanation:

protons and neutrons are located in the center and electrons are located a bit further away but still is a part of the atom as it revolves around it

PLS ANSWER ASAP Which of the following would most likely cause a mutation?
The placement of ribosomes on the endoplasmic reticulum
The insertion of a nucleotide into DNA
The movement of tRNA out of the nucleus
The release of mRNA from DNA

Answers

Answer:

The insertion of a nucleotide into DNA

Answer:Acquired (or somatic)

Explanation:mutations occur at some time during a person's life and are present only in certain cells, not in every cell in the body. These changes can be caused by environmental factors such as ultraviolet radiation from the sun, or can occur if an error is made as DNA copies itself during cell division.

This climate is considered tropical wet with temperatures between 68°F to 93°F and an annual precipitation of 50-260 inches. There is often a short season of less rain, or sometimes in areas with monsoon seasons, a short period of no rain. The soil contains very little nutrients because the trees quickly absorb all the nutrition out of the ground. A great amount of sunlight reaches the upper canopies, but very little sunlight filters down to the understory and forest floor. These are all characteristics of the _______ biome. a. deciduous forest b. alpine forest c. rainforest d. savanna

Answers

the answer is c.rainforest, i just took the test! hope this helps :)

Answer:

C

Explanation:

edge2020

BabyGrl32 Answer quick pls

Answers

Answer:

OK I SEE A TRUE XXXTENTACION FAN

RIP X

Explanation:

Answer:

b

Explanation:

What happened to the sun as the solar system was forming?

Answers

Approximately 4.6 billion years ago, the solar system was a cloud of dust and gas known as a solar nebula. Gravity collapsed the material in on itself as it began to spin, forming the sun in the center of the nebula.

With the rise of the sun, the remaining material began to clump together. Small particles drew together, bound by the force of gravity, into larger particles. The solar wind swept away lighter elements, such as hydrogen and helium, from the closer regions, leaving only heavy, rocky materials to create terrestrial worlds. But farther away, the solar winds had less impact on lighter elements, allowing them to coalesce into gas giants. In this way, asteroids, comets, planets and moons were created.

The answer is C I just wanted to answer it for you Let me explain why



Food provides glucose. This is because glucose is a type of sugar that we gain from the food we eat. It is also one of the two reactants in the cellular respiration equation. The two are glucose and oxygen. Therefore glucose would be the the answer because it is a reactant of the equations and therefore a part of cellular respiration.



Which explains why it is important to eat a full healthy meal before an afternoon of playing sports?




Food provides the carbon dioxide that is a product of cellular respiration.



Food provides the oxygen that is a product of cellular respiration.



Food provides the glucose that is a reactant in cellular respiration.



Food provides the energy that is a reactant in cellular respiration.

Answers

Answer:

thank you for explaining this it is very helpful :)

Answer:

this is correct i saw your comment. i got it correct tysm almost failed.

Explanation:

Can anyone please help with these three questions? Thanks! The first and correct answer will receive brainliest!!! Please please help
Which human activity has the most impact on the quality of water of a stream?
A: Increasing the chemical we throw in the water.
B: Releasing laundry detergent into our streams.
C: Not using fertilizers near the stream
D: Water that has been heated and cooled.

Which human activity affects the quality of drinking water?
A: cutting down trees
B: allowing chemical plants to burn fossil fuels in the air
C:leaving trash outside for animals to eat
D: runoff containing fertilizers and pesticides that will seep through our soil.

How does the industrial and agricultural activities affect our watersheds?
A: By allowing the water cycle to evaporate the water.
B: By allowing pollutants to seep through our soil to our groundwater.
C: By burning fossil fuels
D: All of the above.

How does the industrial and agricultural activities affect our watersheds?
A: By allowing the water cycle to evaporate the water.
B: By allowing pollutants to seep through our soil to our groundwater.
C: By burning fossil fuels
D: All of the above.

Answers

The answers is B please trust me.

Answer:

for the last one its d

Explanation:

explain how it shows both and individual and a community

Answers

Answer:

The relation between individual and society is very close. Essentially, “society” is the regularities, customs and ground rules of antihuman behavior. These practices are tremendously important to know how humans act and interact with each other. Society does not exist independently without individual.

6. Significant mass extinctions occurred during which of the following epochs?
O A. Triassic, Permian, and Cretaceous
B. Triassic, Permian, Cretaceous, Pleistocene, Ordovician, and Devonian
O C. Pleistocene, Ordovician, and Triassic
D. Ordovician, Triassic, Jurassic, Silurian, Eocene, and Oligocene

Answers

the answer is b. hope this helped

diagram the genotypes of the P1 pea plants from the previous four questions by placing the correct on the correct place

Answers

Answer:

Hope this helps!

Explanation:

This rock was formed by smaller pieces of rock that settled at the bottom of the lake millions of years ago. what type of rock is this?

Answers

Answer:

sedimentary rock

Explanation:

Answer:it would be a igneous rock.

Explanation:cause i just took a test and it was on there

A bottle of water left open for several days is now empty. Why? A. The particles lost enough energy to turn to liquid. B. The particles lost enough energy to turn to gas. C. The particles gained enough energy to turn to liquid. D. The particles gained enough energy to turn to gas.​

Answers

Answer:

D

Explanation:

Answer: D

Explanation: When water particles gain enough energy from the sun it evaporated and turns into a gas particle forming clouds which is thus apart of the rain cycle

Many features distinguish modern humans from the nonhuman apes. However, only bipedalism and non-honing canines define hominins as a group. Identify the reasons why?

Answers

1) The proper taxonomic groups are most times always defined by the traits,these traits are the ones that are shared among members of the group eventhough they aren't found in species that are closely related.

2) The two traits are all common as they arise in the ancestors of all the hominins, however,they are not found in the nonhominins apes

3) The evolution of these hominins involved several changes that are different and that happened at different times,and only two of these features,out of all that we have evolved early enough to actually apply to all the hominins.

At certain steps along the electron transport chain, electron transfer causes protein complexes to move H from the mitochondrial matrix (in eukaryotes) to the intermembrane space, storing energy as a proton-motive force (H gradient). As H diffuses back into the matrix through ATP synthase, its passage drives the phosphorylation of ADP.
What is the name of this process?

Answers

Answer:
Electron transport chain and chemiosmosis/ oxidative phosphorylation

Answer:

hum let me think about this one ok here's the answer to you question Answer:

Electron transport chain and chemiosmosis/ oxidative phosphorylation

Explanation:

Toby is a 16 year-old, pimple-faced boy, who has been working after school at a local pizzeria trying to make a little money for his new guitar.
2 days ago, Toby was working in the kitchen, shredding pounds and pounds of cheese for pizza. The cheese was used to prepare pizzas for many customers.
Today, the pizzeria got many phone calls with complaints from customers experiencing nausea, vomiting, and diarrhea, blaming their symptoms on the pizza they ate yesterday.

Explain, what could have happened here. Which bacteria do you think, caused these symptoms, how, and why?

Answers

You described Toby as a pimple faced boy, so I think something might have happened with his acne. He might have touched/burst one of them and got the bacteria on the cheese. The bacteria colonizing the pore could have been cutibacterium acnes. They are there to generate enzymes to degrade skin, which may have made the customers sick when they ingested it. There's still lots of research going into the bacteria behind face oils and pimples, but this is the best answer i can give with this information!

The largest organism of the prokaryotic system is the free-living cells called bacteria. They are microscopic and cannot be seen with barred eyes. They have diverse living conditions in which they can survive.

The bacteria that caused the symptom is Cutibacterium acnes.

Cutibacterium acnes or Propionibacterium are bacteria that flourish on the skin cells and causes acne.

There is a possibility that one of his acne could have burst or he might have touched the popped acne and sprinkled the cheese with the same hands.

The bacteria would have started replicating on the cheese and made the customers sick.

Therefore Cutibacterium acnes are the reason for these symptoms.

To learn more about Cutibacterium acnes follow the link:

https://brainly.com/question/1769637


What is a all the interacting populations that live in the same
geographic location at the same time called? *
Organism
Population
Community
Ecosystem
Biome
Biosphere

Answers

Answer:

Community

Explanation:

In Ecology, a COMMUNITY refers to the collection of all populations of organisms living in the same habitat at a particular time. A community consists of the different population of organisms interacting in an area. For example, a community will include the population of lizards, termites, plants, fungi, trees species in an ecosystem.

Based on this, the interacting populations that live in the same geographic location at the same time is called a COMMUNITY.

Answer:

bioloical community or just community.

Explanation:

Community = A collection of several (or all of the) interacting populations that inhabit a common environment. Ecosystem = The interactions among populations in a community.


A scientist took notes on how a population of roseate spoonbills, a type of bird, adapted to a new environment. Which of her observations is a personal opinion
А This population of roseate spoonbills is eating about 100 fish a day.
B
This population of roseate spoonbills is less friendly than other populations
С
This population of roseate spoonbills is competing with a nearby population of green herons.
D
This population of roseate spoonbills is not building as many nests as it did in the other environment.

Answers

Answer:

B is the ANSWER!

Explanation:

Woo yeah thats the answer for ya'

Because the others are facts and that little guy is an opinion!

;)

Have a radical day dude bro!

Answer:

B I did this question befroe

b

Which of these explain why Landon has his fathers fathers curly hair and his mother nose?

A: He is prokaryotic
B: He is the product of sexual reproduction
C: His father is older than his mother
D: He was formed by binary fission?

Answers

The statement that best explains why Landon has his father's curly hair and his mother's nose is that he is the product of sexual reproduction. Thus, the correct option for this question is B.

What is Sexual reproduction?

Sexual reproduction may be defined as a type of reproduction through which the production of new organisms by the combination of genetic information of two individuals of different sexes.

The mechanism of sexual reproduction is observed in most species in which the genetic information is carried on chromosomes in the nucleus of reproductive cells called gametes, which then fuse to form a diploid zygote.

Sexual reproduction leads to genetic variations in which the phenotypes and genotypes of the offspring vary a lot.

Therefore, the statement that best explains why Landon has his father's curly hair and his mother's nose is that he is the product of sexual reproduction. Thus, the correct option for this question is B.

To learn more about Sexual reproduction, refer to the link:

https://brainly.com/question/815744

#SPJ2

I’ll give brainiest if you’re correct

A key difference between daughter cells resulting from mitosis and meiosis is that:
A. After meiosis, cells are diploid. After mitosis, cells are haploid.
B. After meiosis, there are 4 daughter cells. After mitosis, is 1 daughter cell.
C. After meiosis, cells are haploid. After mitosis, cells are diploid.
D. After meiosis, there are 2 daugher cells. After mitosis, there are 4 daughter cells.

Answers

Answer:

i think it's C

Explanation:

meiosis is with sex cells and the resulting cells don't have paired chromosomes, making them haploid, and other cells have a complete set of chromosomes after mitosis, making them diploid.

Two stores sell CDs in packages, as shown in the table below.

CD Prices at Store A
Number of CDs in Package
1
12
20
45
Cost
$0.70
$8.40
?
$31.50


CD Prices at Store B
Number of CDs in Package
1
20
30
65
Cost
$0.60
?
$18.00
$39.00

Answers

Answer:

10. 50 ehaisnenhsiwolen br isiwokneb

Which of the following is not a concern associated with fossil fuel dependence?
a. global warming
b. rising prices
c. increased competition
d. increased development
Please select the best answer from the choices provided
А
Ο Ο Ο
B

Answers

Answer: increased devolopment

Explanation: right on ed2021 just took the quiz

The one that is not a concern associated with fossil fuel dependence is increased development. The correct option is d.

What are fossil fuels?

The components of fossil fuels are decaying plants and animals. These fuels may be burned to provide energy and can be found in the crust of the Earth. An example of a fossil fuel is coal, as well as oil and natural gas.

Fossil fuels are resources that resemble rocks, gases, or liquids that are burned to produce electricity.

They are employed as energy sources in the electrical and transportation industries and include coal, natural gas, and oil. They are also a major contributor to the pollution that causes global warming.

Dependence on fossil fuels can raise issues such as global warming, price increases, greater competitiveness, and many others.

Thus, the correct option is d.

For more details regarding fossil fuels, visit:

https://brainly.com/question/3371055

#SPJ5

what is respiration​

Answers

Answer:

process in living organisms involving the production of energy, typically with the intake of oxygen and the release of carbon dioxide from the oxidation of complex organic substances.

What day does summer begin in the southern hemisphere
answer options:
A. June 21
B. March 21
C. December 21
D. September 21

Answers

Answer:

The answer is C December 21

Explanation:

Answer:

June 21 trust me i got it right on edge

Explanation:

Which fearured listed is not part of the growndwater system
A. Confined aquifer
B. Underground spring
C. Lake

Answers

Answer:

its B underground spring

Other Questions
anong ibig sabihin ng kanlungan ni noel cabangon mrs neduz has 30 pints pf soda for the glow in the dark party this friday how many gallons of soda does she have? Previous4Select the correct answer from each drop-down menu.What are Reserve Banks?Reserve Banks arethat help thecarry out its duties. This table shows the input and output values for a linear function f(x).What is the difference of outputs for any two inputs that are one value apart?3025120 rich borrowed 100,000 for a period of five years. his interest rate is 3%. how much interest will rich pay in all? What grammatical structure is the italicized portion of the sentence?My most valuable coin, one from Spain, is worth more than $100.00.O present participial phraseO nominative absoluteO appositiveO past participial phraseO prepositional phrase with a gerund After learning about taking corrections properly and the different types of corrections there are, why do you feel these things are necessary for dance? How can they help you as a dancer and individual? youre looking at a bar graph and see numbers going from the bottom to the top from 0 to 100 which of the folllowing are you looking at Does the following picture represent a linear function? find the rate of change help fast timed assignment I will give brainliest How are protons and neutrons the same and how are they different? Tell me an interesting fact which from of democracy dose the United States have? PLEASE ANSWER QUICK ILL GIVE ALL MY POINTS Why do you think Elisa is crying in the end? What do the details about how she cries and what she says just before that add to our understanding of what is happening for her in this moment? can yall pls help me. In a theocracy, the leader of the country is also the leader of the what. -3.2 x -5.6 x 4? PLEAEE HURRY!!! The difference between the ideas of Hobbes and Locke was that Which city in the Kingdom of Kush is the oldest city in Africa?