HELP ME BRAINLIEST

Create a 3-stanza rap as if we were to have a cabinet battle today.

Subject is:In-Person Learning or At Home Learning

but i chose at home 12 sentences

Answers

Answer 1

Answer:

thers a lot going on   so i wrote this song be be dieing wich got me crying  ti not safe at school it just like the hood.

Explanation:

sorry thats all i got. hope its a good starter


Related Questions

Why did Alexander Hamilton believe that the national bank was constitutional?
He believed in express powers and a strict interpretation of the Constitution.
The Constitution states that a government should have all the powers to carry out its duties, and the national bank was necessary.
He thought the Constitution was a weak document that couldn’t address the needs of the government.
The Constitution mentioned the possible need for a bank.

Answers

The Constitution states that a government should have all the powers to carry out its duties, and the national bank was necessary."

describe this sculpture, it’s location, and its purpose.

Answers

Answer:

The sculpture-The supture is a sculpture of Budha

The purpose of it-Budha felt only to connect with hands so it's symbolizing him reaching down and touching earth

Where its location is-The Buddha Statue of Hyderabad is a monolith located in India. It is the world's tallest monolith of Gautama Buddha, erected on Gibraltar Rock in the middle of Hussain Sagar.

Explanation:

This style is very similar to what would be found in Tibet as it was taught to Mongolian artists by Tibetan artists,

Buddhist figures communicate with hand and body gestures. Shakyamuni’s right hand reaches down to touch the earth. This gesture represents the moment when he called the earth to witness his transcendence of the realm of Mara, the supreme God of the world (samsara), who had tried to distract him from his meditation. In response, the earth trembled and shook to acknowledge Shakyamuni’s attainment of Buddhahood. Shakyamuni’s left hand rests in his lap in the gesture of meditation, and holds his alms bowl.

HAVE A GREAT DAY PL MARK BRAINLY :{ :)))

hi who believes that this girl (look at the pic) is fadorable.....

Answers

Answer:

it looks cute but not exactly faboulous o fadorable but good job and no offense btw

Explanation:

Answer: its ccute.. give me points please                                   Explanation:

Who is the better Rapper Lilbaby Youngboy NBA Dababy

Answers

Answer:

Explanation:

Umm young boy

i would say young boy :p

look around you and observe the things you see the trees, flowers, and even clouds in the sky. Describe your surrounding using basic knowledge about the art elements.

please i will give you the brainliest​

Answers

Answer:

I have a few things around me that represent color for the art elements such as the lucky charms cereal box or the very detailed paintings hanging on my house walls to represent texture as well because paintings have the texture of paint ya know, if that makes sense. A vase is also close to me and that is also an art element(Form). I do not have anything else really around me but my family is really into art so we have all these sculptures and painting but hope that helps, I don't know what you asked for the question but hopefully my answer is close enough.

Explanation:

what is the Subject and object matter of logic ???​

Answers

Answer:

Logic, as a distinct field of study, dates approximately to Aristotle. Its fundamental charge is to distinguish sound reasoning from unsound reasoning.

Explanation:

Hope this Helps (✿◡‿◡)

2. According to Cotter, what experiences in Kiki Smith’s life have fueled her fascination with the body?

Answers

mm,,,,,,what story is that

Toby has found the following sentence in a blog post about voting.

Older generations vote more than younger generations because many young people are dissatisfied with politicians.

Which of the following is a fact that you should select as evidence to support this claim?

Answers

Answer:

fact:

Explanation:

many young people go abroad especially in developing countries due to dissatisfaction and they cant take part in voting

Answer: young people are dissatisfied with politicians because they want to take away people's guns and tax them more than they already are taxed.

Explanation:

Pls help!!!!! will give brainly!!!!!
‘Fine art’ is a kind of art that uses a lot of skill or thought. Do you think digital art could be a kind of ‘fine art’? Why or why not?

Answers

Answer:

Depends on whether or not it uses a lot of skill or thought. If so, then yes. If not, then no.

Explanation:

Answer:

i already answered this hah

Explanation:

yeah it is

HELPPPPP MEEEE PLZZZZZZZZZZ

Answers

Answer:

Explanation:the third one if that is what you are asking. on the third line in and it is on the line

What is the question??

hugis ng pagong at tekstura

Answers

Answer:

yes

Explanation:

‼⚠PLZ HELP!!! ⚠‼
What is the purpose of most of the Ulster Scots music?

Answers

Answer: is to encourige kids and learn about it

Explanation:Ulster-Scots Musical Revival which started in the late 1990s, and argues that neither Hobsbawm & Ranger’s conception of “invented tradition” nor Rosenberg’s theorisation of folk revivals as appropriations of tradition are adequate to understand this ongoing musical and social movement. By comparing the Ulster-Scots revival with earlier “Irish traditional music” revivals, I will argue that the Ulster-Scots movement is significantly different both from Irish revivals and from the American folk revivals theorised in Rosenberg’s volume, in that it is not the appropriation of a working-class music by a middle-class constituency, but a deliberate transformation of tradition undertaken by members of the originating communities.

Answer:

encourage children to learn more about Ulster-Scots traditions and culture

The notations of dynamics that apply to an individual tone,
such as p, mp, and f, also may apply to a section of music.
Changes in dynamics may be abrupt, gradual, wide, or small
. A
series of symbols also governs this aspect of music.
True or false?

Answers

Answer:

True

Explanation:

dont know how to explain it it's just true

What is the correct major key of the following key signature?

G#major
A#major
Amajor
Dmajor

Answers

Answer:

explanation:

may be this is helpful!

if you had a dream of, perhaps: a number 4 hypnotizing the whole world to rule it, what would you do if you were a king/queen of a kingdom of objects?
( just a random question )

Answers

Answer:

ummmm to be honest I don’t know what’s i would do I’d probably get what ever thing that I wanted sence I would be queen lol.

wnat would you do?

Answer:

If the objects were alive, I'd be the best freaking king ever, keeping them fed and alive and safe and whatnot, and I'd also kill the evil number 4, and free my people from it's evil number rein of terror.

Explanation:

Cool question

The Vikings were quite advanced in some aspects compared to others. Their ship-building and fighting skills were incredible. Though, they did need to plunder and conquer other areaterm-3s in order to accommodate for their growing numbers. Their ships and swords were given a lot of detail and you could see that they put a large amount of time into them. They carved runes into their swords and carved gripping beast into their ships. They also shaped the prow of the ship into a spiral. The Vikings found ways to build with two, very different, types of timber. Creating two different building styles to adapt to the material they used. They also had unique churches that were built around four main support beams, or staves.

Answers

wait is there a question or

what is this design ?
pls answer this​

Answers

Answer:

I think this is

Explanation:

Wall design

Answer:

Abstract design (Meaning it's not real but formed by the brain)Geometrical design (Use of shapes in a design)Abstract design. It is also a monochrome painting Abstract design Geometrical design Half drop? imaginative design?

Why do you think religious scenes were such a common subject matter for artists to use in etchings and intaglio prints?

Answers

i think because society back then was heavily influenced by the church and religion so it was very common to also interpret it into art form

How many colors are in the world?​

Answers

There are 10 million colors in the world

Which sport was most interesting to you? Are there facilities in your community where you might be able to try one of these new sports? Explain how you may be able to incorporate a new sport into your workout plan. (5 points)

Answers

Answer:

I like soccer

Explanation:

Answer: i put this as my answer

Explanation:

" i think karate caught my eye at how it explained a lot i didn't know about karate,  also i don't think so i've never tried looking. I could add maybe some karate movements as stretching or even as the whole workout"

Question 3 of 10

War and revolution were constant themes throughout the Romantic period.

Answers

This period was a reaction to and revolt against those things.

Answer:

The answer is true.

Explanation:

In the United States, there is a pattern to traffic signs so that they are easy for drivers to interpret. Which is the BEST example of this pattern?
Group of answer choices

Answers

In the United States, there is a pattern to traffic signs so that they are easy for drivers to interpret.  Yellow sign with black border is the best example of this pattern.

What is traffic?

Traffic is the movement of people, goods, or vehicles from one place to another. Traffic can be generated by both human and non-human sources, such as animals and vehicles. Traffic can be both local, as in the case of people driving to and from work, or long-distance, as in the case of goods travelling from one country to another. Traffic can also be divided into categories such as public, private, and commercial. Public traffic refers to the movement of people, goods, and vehicles for the benefit of the public, whereas private traffic is for the use of private individuals and organizations. Commercial traffic is for the purpose of transporting goods for profit. Traffic can be managed through the use of traffic control systems, such as traffic lights, speed limits, and lane closures. Traffic control systems are designed to help ensure the safety of drivers, pedestrians, and other road users, as well as the efficient flow of traffic.

To learn more about organizations

https://brainly.com/question/28233474

#SPJ1

Complete Question:

In the United States, there is a pattern to traffic signs so that they are easy for drivers to interpret. Which is the BEST example of this pattern?

Group of answer choices

A. Green sign with yellow border

B. Red sign with white border

C. Yellow sign with black border

D. Blue sign with red border

A man sitting in a chair. He has on tall socks, shoes with a buckle, and a long coat with large cuffs and many buttons. He's sitting in a high back chair next to a desk.
This example of Intaglio by William Hogarth, was created using what type of Intaglio printing?
a.
etching
c.
aquatint
b.
drypoint
d.
engraving

Answers

Answer:

d.  engraving

Explanation:

This artwork of William Hogarth is intaglio of Simon Lord Lovat and it is named after him. Intaglio is the printing technique which means the wanted image is cut into the service and painted with ink. There are few ways to make the intaglio printmaker, and all of the mentioned answer options are the ways to make it.

However, this particular artwork by Hogarth is mostly made by engraving. This practice means cutting the wanted image and design into the hard surface. The surface is usually metal but can also be wood. Later it is

1. Where should your eyes be while on the concert stage?"
On the floor
On your director
On your crush
On your family

Answers

Answer:

On your director so you know what to do.

(SEWING CLASS) When moving the sewing machine from place to place, you must always grab it by the_?

Answers

Answer

Presser foot holds fabric in place while you sew. 11. ... Stitch pattern selector shows you which pattern the machine will sew.

Explanation:

base of the machine .

where is g in the bass clef

Answers

Bottom line and top space

Answer:

bottom line and the top space

Explanation:

think of it with acronyms.

Lines: G B D F A

Space: A C E G

”good boys do fine always”

”alley cats eat garbage”

Name the artist who painted this painting. What medium did the artist choose for this painting? What advantages and disadvantages might the artist have considered before using this medium?

Answers

Mary Cassatt, oil painting, she might have considered what medium would be able to blend well for the skin, but also have realistic texture. another advantage she might’ve considered is oil paint dries so slow that you have time to go back days later and fix any mistakes or touch up something that went unnoticed before. disadvantages could be not enough definition because oil paint blends too well and oil paint dries very slow so she would have to wait for long periods of time to layer the paint if she needed to.

what are Two notes played together called?
interval
harmonic interval
melodic interval

Answers

i believe harmonic interval
since it’s two being played together it’s harmonic internal

who is jackstauber??

Answers

Answer: Is a muscician, video artist, and live performist

Explanation:

Answer:

Jackstauber is a musician

The composition of a photograph may be different for different types of photography.

true or false

Answers

Answer:

true

Explanation:

there are many types of compositions. symmetrical balance, asymmetrical balance, rule of thirds and so on. composition gives flow to the photo, guides the viewer's visual direction and balance.

the answer is true .
Other Questions
When a cricket ball is thrown vertically upwards, it reaches a maximum height of 15 metres. (a) What was the initial speed of the ball ? (b) How much time is taken by the ball to reach the highest point ? (g=10 ms -2 What caused president roosevelt to sign into law meat Inspection act? who is a better band1:One direction2: 5 seconds of summer 3: BTS4:Little mix5: other Which of the following describes hetereogeneous mixture... 1)A mixture that is easily separated, the components are different sixes and unevenly mixed. 2) A mixture that is very difficult to separate, the contents are evenly mixed and the mixture looks like a substance Light rays from the sun are called: solar energy heat energy chemical energy a circle has a center at (-2,7). if a point on the circle has coordinates (3,-1) then which of the following would be the length of the radius of the circle write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC if you answer some of them ill appreciate it ( you don't have to answer all of them ) What can cause a significant change in someones life Which value is in the domain of f(x)?f(x) = StartLayout Enlarged left-brace 1st row 1st column 2 x + 5, 2nd column negative 6 less-than x less-than-or-equal-to 0 2nd row 1st column negative 2 x + 3, 2nd column 0 less-than x less-than-or-equal to 47645 How is the idea of freedom presented in Martin luther kings speech? Explain what is meant by "majority opinion".Your answers Lieutenant Patrick O'Bannon defeated the Pasha of Tripoli at ___.ItalyWeehawkenEgyptNew OrleansDerna Explain the role that King George III played during the American Revolution. WILL MARK BRAINLIEST:> IF YOU ARE LUCKY pick a number from 1 to 20 CLOSEEST NUMBER TO THE NUMBER I PICK WILL BE THE BRAINLIEST GOOD LUCK How do you make someone brainliest In the 1800s, unmarried women hadmore rights than married women.the same rights as married women.fewer rights than married women.no rights, just like married women. List and explain the major features that the following building designs must have to relate directly to their functions.-Hospital-Airport-Courthouse A student observes a difference in the activity level of fish at a pet store. The fish in an aquarium near the window are swimming around more quickly tha the fish in an aquarium placed in the back of the store. The student forms a hypothesis about the effect of sunlight on fish activity levels and arranges to conduct an experiment. Which variable could be an independent variable in the student's experiment? types of fish sold speed of swimming fish amount of time fish were active temperature of water in fish tank how do you do this equation ?solving inequalities 8 2x < x + 7