Help me please on #4 I will mark brainzillest

Help Me Please On #4 I Will Mark Brainzillest

Answers

Answer 1

Differentiated cells may look different but they have the same functions, the cells become grouped with similar cells result into formation of tissues, they make up tissues and organs of multicellular organisms. Thus, the correct option is B.

What is Cell differentiation?

Cellular differentiation or cell differentiation is the process through which a stem cell undergoes change from an undifferentiated form to a differentiated one. Usually, the cell changes to a more specialized type in this process.

The fundamental benefits of cellular differentiation includes the formation of more specialized and efficient cells which are involved in performing specific functions. For example, to ease water transport through the tracheary parts of the xylem, these cell loses its protoplasm and develops a lignified cell wall. The red blood cells in the living organisms which loose organelles to make more space for the hemoglobin pigment in the cell.

Therefore, the correct option is B.

Learn more about Cell differentiation here:

https://brainly.com/question/18639909


#SPJ1


Related Questions

explain why the concentration of FSH in the blood increases after day 1​

Answers

Answer:

As the levels of FSH and LH in the blood increase with puberty, the eggs begin to mature and a collection of fluid — the follicle — begins to develop around each one. The first day of menses is identified as cycle day one. Estrogen is at a low point. ... This increase in estrogen begins to inhibit the secretion of FSH.

Explanation:

How do invasive species usually affect the availability of natural resources in an ecosystem?

PLEASE HELP ME​

Answers

Answer: Invasive species can harm both the natural resources in an ecosystem as well as threaten human use of these resources. ... Invasive species are capable of causing extinctions of native plants and animals, reducing biodiversity, competing with native organisms for limited resources, and altering habitats.

Explanation:

Which type of macromolecules helps a cell brake down food? Lipids proteins carbonhydrates or nucliec acids

Answers

Answer:

The correct answer is - proteins.

Explanation:

All the food particles are broken down by specific protein molecules called enzymes. Carbohydrates are the macromolecules that are broken down by enzymes; amylase, lactase, sucrase, or maltase.

Proteins are macromolecules that are broken down with the help of the enzymes peptidase, pepsin. Lipids macromolecules are also broken down by lipase enzymes. Breakdown of these macromolecules provides energy for cellular activities.

Which of the following which of the following organism would be in the first trophic
level?
a caterpillar
b mouse
C bee
d maple tree

Answers

Answer:

D

Explanation:

The first trophic level is the producer, which makes its own food, so it has to be a plant / algae / cyanobacteria

I think it’s a calibrator but I’m not 100% sure he might be right it could be D


Please help, A, B,C, or D?

Answers

Answer:

I cant see the pic??

Explanation:

Select the statement(s) that is accurate about the immune system.

Answers

What’s the statements

How can a small mutation provide a small advantage to an organism?

Answers

Answer:

It provides an advantage because the mutation could be anything, which may give the organism an advantage no matter how random the mutation is, which it has to somewhat help that organism in life.

Hope this helps!

Follow the link to the MaxExpect server that generates a specified group of structures from a sequence, either RNA or DNA. Use the RNA sequence below to predict its structure identity. Sequence: GGAGAGGCCUGGCCGAGUGGUUAAGGCGAUGGACUGCUAAUCCAUUGUGCUCUGCACGCGUGGGUUCGAAUCCCAUCCUCGUCG
Match the words in the left column to the appropriate blanks in the sentences on the right.
The secondary structure given in the MaxExpect results can best be described as_________
Thus, the type of RNA is best classified as_________
a single strand with a distinctive cloverleaf structure
a single-stranded random coll
an unspecified type of RNA
rRNA
a single strand folded upon itself to form a small, round structure
tRNA

Answers

Answer:

The correct answer is -

a single strand with a distinctive cloverleaf structure, and

tRNA

Explanation:

The given sequence is RNA sequence as it contains uracil in the sequence instead of thymine. In this sequence, there are nucleotides under 100 so it's comparatively small for mRNA molecules.

Therefore it is a single-stranded RNA molecule with a distinctive cloverleaf structure which is a characteristic feature of the tRNA molecule that is used to make amino acids sequences with the help of mRNA during translation.

how does a liver cell respond to insulin

Answers

Answer:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

Explanation:

Insulin stimulates the liver to store glucose in the form of glycogen. A large fraction of glucose absorbed from the small intestine is immediately taken up by hepatocytes, which convert it into the storage polymer glycogen. Insulin has several effects in liver which stimulate glycogen synthesis.

Which factor listed below is abiotic? Bacteria, water, fungi, protists

Answers

Answer:water

Explanation:

Answer:

Water

Explanation:

Water does not contain cells, therefore it is non-living.

Help ASAP, please
Thank you, Friends:)

Answers

irieirirkekeksksekekekekdjdjdjdkdkskdkdjdj

Help stepbro im stuck in the washer

Answers

Answer:

I'LL HELP YOU......................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................NOT

Describe the steps a plant would take to move sugars from a source to a sink.

Answers

sugars are transported through the phloem, from sources to sinks, is called pressure flow. At the sources (usually the leaves), sugar molecules are moved into the sieve elements (phloem cells) through active transport.

Diabetes is a disorder of which body part? O the adrenal gland the thyroid the pancreas the liver​

Answers

Answer:

The pancreas

Explanation:

it happens when the pancreas doesnt produce enough of something called insulin

The purpose of mitosis is to ___, while the purpose of meiosis is to ____.
a) make new cells, and only germ-line cells do it;
b) make eggs or sperm, and all the body cells do it make eggs or sperm, and only germ-line cells do it;
c) make new cells, and all body cells do it make eggs or sperm, and only somatic cells do it;
d) make new cells, and all body cells do it make new cells, and all body cells do it;
e) make eggs or sperm, and only germ-line cells do it

Answers

Answer:

A) make new cells(somatic cells)and only germ-line cells do it(meiosis)

Explanation:

Meiosis is the process through which germ cells that produce gametes such as sperm and eggs are formed. It is an equatorial division that involves the parental cell dividing into daughter cells each containing similar genetic material as the parents cell and this can be passed on to successive generation.

While Somatic cells are cells that form the building blocks of the body, they are the actively divided body part and only divide by mitosis.

Meiosis produces germ cells while mitosis produces somatic cells.

50 POINTS !!!!A credit union is a business that is owned by people who have something in common, offers you a place to keep your money, and uses your funds to make more money. A. True B. False

Answers

Answer:

true

Explanation:

Hope this helps

Answer:

The anser is FALSE

Explanation:

I just took the test and it was FALSE

What percentage of wild fires is started by human behavior?
85%
90%
98%
100%
ANSWER IS 90%

Answers

Answer:

90%

Explanation:

Which Factor listed below is biotic. Bacteria, soil, sunlight, Rocks

Answers

Answer:

Bacteria

Explanation:

Hence, abiotic elements determine how organisms survive in an ecosystem. The main difference between biotic and abiotic is that biotic refers to all living things of an ecosystem while abiotic refers to all the non-living, physical and chemical things of an ecosystem.

Sunlight, rocks, and soil are all non-living.

The only biotic component mentioned is bacteria. Living things or their impacts are referred to as biotic factors. Single-celled creatures known as bacteria can live alone or in colonies.

They may be found almost anywhere, including the soil and the human body. All three kingdoms of life, Archaea, Bacteria, and Eukarya, contain bacteria that can reproduce. The terms "soil," "sunlight," and "rocks" all refer to abiotic elements, or nonliving parts of the environment.

Minerals, organic substances, gases, liquids, and living things all make up soil. Photosynthesis and other biological activities require sunlight, a type of energy that the sun radiates. Rocks are unbreakable, inorganic objects made of minerals.

Learn more about  soil  at:

https://brainly.com/question/31227835

#SPJ6

Select the correct answer.
Which type of galaxy is the Milky Way?
A.
elliptical
✓ B.
spiral
C.
irregular
D.
lenticular
Next

Answers

Correct answer is B. Spiral

Explanation:
Answer provided by www.amnh.org

how is zero, oxidation numbers, and noble gases related​

Answers

Of its valence electrons or the no. Of valences in its Valence shell .In case of noble gases, their outermost shell is absolutely crammed so no emptiness is available in the outer maximum shell. Thus the oxidation kingdom is 0(zero)for Noble gases. Because, they've complete electrons in their out maximum shell.

hope this helps

The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: *
A. pituitary gland
B. thyroid gland
C. pancreas
D. adrenal gland

Answers

Answer:

The largest endocrine gland (s) that makes 3 hormones that affect the metabolism is the: thyroid gland.

The largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.

What do you mean by Endocrine Gland?

An endocrine gland may be defined as a type of gland which consists of several organs that make hormones and release them directly into the blood so they can travel to tissues and organs all over the body. These hormones control many important functions in the body, including growth and development, metabolism, and reproduction.

The pancreas is the largest endocrine gland that significantly makes three hormones namely, Insulin, Glucagon, and Somatostatin. These hormones are actively involved in the regulation of metabolism by numerous mechanisms.

For example, insulin lowers the level of sugar in the blood, while glucagon increases the level of sugar by transforming its storage form.

Therefore, the largest endocrine gland that makes three hormones that affect metabolism is the Pancreas. Thus, the correct option for this question is C.

To learn more about Endocrine glands, refer to the link:

https://brainly.com/question/4455660

#SPJ2

Which layer has more density?
Inner Core
Outer Core
Lower Mantle
Upper Mantle

Answers

Answer:

inner core

Explanation:

I looked it up

What is the major distinction scientists use to divide the animal kingdom?

Answers

Answer:

Whether the animal has a vertebral column or not.

the specialised cells of the testes that secrete the male hormone are?
A Sertoli cells
B Acrosomes
C Leydig cells
D Seminal vesicles​

Answers

the answer to the question is c

The changes that occurred in Yellowstone National Park after all of its wolves
were killed showed that wolves are
A. harmful to the ecosystem
B. the only producers in the ecosystem
C. beneficial to the ecosystem
a
D. unnecessary for the survival of other species

Answers

C. beneficial to the ecosystem

If making a protein was like making a building, then the DNA molecule is like the blueprints and the RNA molecules are like the construction workers
True
False

Answers

I’m pretty sure it’s true. It makes the most sense.

what does the tilde symbol mean in biology

Answers

Answer:

means "approximately", "about", or "around", such as "~30 minutes before", meaning "approximately 30 minutes before".


"In rabbits, B = black fur and b = white fur. If fur color is an incomplete dominance trait, what phenotype will a
heterozygous rabbit show?"

Answers

Answer:

b is the answer my friend. hope this will solve your problem. mark me as brainliest

You have two fly lines carrying two different alleles of white, called wco (coral) and wch (cherry). Coral and cherry are in the same complementation group and exhibit NO complementation. Which is true regarding recombination between these alleles in a cross:
a. recombination is never observed because coral and cherry are in the same complementation group
b. recombination is impossible because they are in the same gene (white)
c. recombination is never observed because coral and cherry display the same phenotype
d. recombination is possible and can generate a wild-type allele and a double mutant allele

Answers

Answer:

Recombination is possible and can generate a wild-type allele and a double mutant allele ( D )

Explanation:

The true statement regarding the recombination between the alleles is : Recombination is possible and can generate a wild-type allele and a double mutant allele.

The recombination process involves the breaking and recombination of pieces of DNA in order to produce new alleles. this recombination ( crossover ) results to the offspring possessing different combination of genes ( wild -type allele and double mutant allele ).  hence option D is the correct answer.

I need help ASAP!!
A.D
B.B
C.C
D.A

Answers

Answer:

a ibecause tifmsndtbeekodfhekekn

Other Questions
3. Why does Mercutio end up fighting with Tybalt, despite the fact that Tybalt is angry with and wants to fight Romeo? 1. What is the experimental probability of not landing on a 6?2. What is the theoretical probability of not landing on a 6? Which greenhouse gas is produced by commercial refrigeration and air conditioning systems?PLESE HURRAHHY IM TIMED :(carbon dioxidefluorinated gasnitrous oxidemethane Cul de los siguentes NO es uno de los productos que exporta Costa Rica?A. cacaoB. cafC. carneD. perfume PLEASE HELP I WILL GIVE BRAINLIEST Which of the following is correct about mutations and genetic variation? It must be present in a population before natural selection can act upon the population. It arises in response to changes in the environment. It tends to be reduced when diploid organisms produce gametes and reproduce. It is created by the direct action of natural selection. Ms. Bohan drinks 3/5 of her drink from starbucks. What percent of her drink did she have? 7 reasons plants are important to the environment Samir has collected 35% of the skins on Fortnite. If there are 300 total skins, how many more does he need to collect to be at 50%? Explain or show your work. ASAP PLZZ ANSWER ALLLLLLLL PLZZZZ BRAINLY TO ALL THE ONES THAT ARE CORRECT PLZZZ HELP ONLY ANSWER IF YOU KNOW How is it that the order of colors of the rainbow is always the same(ROYGBIV) think of an essay that argues that cats are better pets than dogs. what might be one supporting Point used in the essay Why does the grass look green under sunlight and black under the moonlight? Do mice show a preference for using one paw over the other? Attempting to answer this question, a researcher tested a random sample of 48 mice and observed which forepaw (right or left) the mice used to retrieve food from a narrow tube. Eighteen of the mice used their right paw, while the rest used their left paw.Does this data suggest that mice show a preference towards one paw over the other? Carry out the appropriate test and include all steps for full credit. During the course of the experiment, the researcher noticed that individual mice sometimes switched which forepaw they used to retrieve the food. So she repeated this study on the same 48 mice, but measured each one 10 times and she recorded which forepaw was used each time. With her new dataset of 480 observations, would you be able to run the same analysis as in part (a)? If so, carry out the analysis and compare the results. If not, why not? In RST, r = 5 cm, t = 6.8 cm and T=23. Find all possible values of R, to the nearest 10th of a degree. I have a discussion-based assignment and the topic is "analyze the reasons for and the goals of the United Nations" anyone has some good things I should start with and I would appreciate some articles for me to research this as well (unless brainly doesn't let people share links because they don't like people using other resources to study) 10) An online movie club has an initiation fee of $10 plus $4 per movie rented.Another club has an initiation fee of $20 plus $2 per movie rented write about the oppression that happened to esmeralda and the other gypies How does the fact that there are usually many cosmetologists to choose from shape client expectations?A. Clients are not likely to return if the service is not great since there are many options.B. Clients are less likely to care about service since they can get it anywhere.C. Most clients prefer seeing a different cosmetologist each time to seeing the same person.D. While there are many cosmetologists, few actually have the skills that clients seek. pls help ill give brainliest thanks Which term below correctly completes the following sentence?If a function has a vertical asymptote at a certain x-value, then the function is ______ at that value.A. zeroB. rationalC. negativeD. undefined