Help needed ASAP Look at the picture

Help Needed ASAP Look At The Picture

Answers

Answer 1

Answer

Igneous Rock

Explanation:

It's Igneous because its coming straight from the magma. This type of rock is basically a magmatic rock.


Related Questions

Fossils usually occur in metamorphic rock. true or false?​

Answers

Answer:

false

Explanation:

They can't survive the great pressures metamorphic rocks go through. They usually are only in sedimentary rocks. Hope this helps!

Answer:

false

Explanation:

Fossils are very fragile and metamorphic rocks go through some harsh changes, so i'd be impossible for fossils to stay intact or even form in metamorphic rocks

What is the role of the nucleus in plant and animal cells?
O
A. It stores the genetic information for the cell.
B. It serves as a boundary for the cell.
o
C. It produces energy for the cell.
O
D. It stores waste for the cell.

Answers

Answer:

Explanation:

It’s A I’m pretty sure

Use the word “capacity”in a sentence.

Answers

Answer:

The weight capacity in this elevator is over its limit, somebody is gonna have to  step out

How is energy released from ATP?

Answers

Answer:

food zygote d9gugousfoysocysohcoecu sperm

Answer:

In a process called cellular respiration, chemical energy in food is converted into chemical energy that the cell can use, and stores it in molecules of ATP. ... When the cell needs energy to do work, ATP loses its 3rd phosphate group, releasing energy stored in the bond that the cell can use to do work.

William wanted to create a report on a geographical location with the greatest species diversity. Which ecosystem can he consider for his report?

Answers

Answer:

Forest ecosystem or marine ecosystem.

Explanation:

Forest ecosystem is considered for his report because large number of organisms are present in forest ecosystem. Species diversity is greatest in the geographical location of tropics, particularly in tropical forests. Marine ecosystem is also considered for his report due to the presence of large number of different types of species particularly in coral reef which is a habitat of large number of organism.

PLS HELP ME IM STRESSING RIGHT NOW I JUST NEED HELP ON THIS

Which statement accurately describes a mountain ecosystem?
They usually host three or more ecosystems where animals can’t live.
They usually host one ecosystem with a variety of wildlife.
They usually host one ecosystem with a variety of plants.
They host three or more distinct ecosystems.

Answers

Mountain life has many life and plants, so it’s not A, it could be b or c but D makes most sense I don’t know what 3 or more distinct ecosystems mean though

2.3/6.E.2.4 Test 1 2 of 30
Which element causes soil to appear red?
O A. calcium
B. iron
c. magnesium
D. silicon

Answers

Answer:

B

because iron appears the color red

Plants receive carbon dioxide through their ____________.

Answers

Answer:

leaves,stomata

Explanation:

The carbon dioxide enters the leaves of the plant through the stomata present on their surface.

Answer:

Carbon dioxide enters through tiny holes in a plant's leaves, flowers, branches, stems, and roots.

Explanation:

____ can be used for different types of surgery.
a. Lenses
b. Lasers
c. Diffractions
d. Refractions
(Lasers)

Answers

Answer:

lenses can be used for diffrent types of surgery

Priscilla was building a circuit that used copper wires to connect a battery to a light bulb. As she connected the final wire from the light bulb back to the battery, the light bulb turned on. Priscilla knew that current was now flowing through her closed circuit. What makes the current in the circuit flow?

Answers

Answer:

The complete path provided by the closed circuit enables electric current produced by the battery to flow round the circuit

Explanation:

Electric current consists of charges (electrons) in motion from one region to another.

An electrical circuit is any closed path through which electric current can flow.

An electrical circuit consists of an energy source that supplies the electrons moving, a path along which the electrons can travel, and a load or appliance that uses the electrical energy. When the circuit is broken at any point, electrons will cease to flow since there is no complete path for it to flow. Such a circuit is known as an open circuit.

In the circuit built by Priscilla, the battery serves as a source of energy by providing the electrons that moves round the circuit. The wires provides the path for electrons to flow from the battery through the light bulb and back to the battery. When she connected the final wire from the bulb back to the battery, the circuit becomes complete/closed and current then flows to light up the bulb.

Make a food web for the rainforest

Answers

Answer:

VEGETERIANS, VEGANS, CARNIVORES, CANNIBALS, Omnivores

Explanation: EVERYWHERE!!

How do I fly? :(;):)

Answers

Answer:

Hm

Explanation:

Try a few things like an airplane, jetpack, etc

By flying and flying and Flying some more

Plz help I’ll mark brainliest

Answers

Answer:

I'm pretty sure it's exponential growth.

Explanation:

Answer:

expontential growth!!

Explanation:

The sun, rocks, water are all example of...

Answers

Answer:

are examples of abiotic factors

Explanation:

I think it’s natural resources.

What are the DNA strands called?
What is the RNA stand called?

Answers

Answer:

it rna means

Ribonucleic acid

Answer:

DNA strands - polynucleotides

RNA strand - nucleotide chain

Explanation:

DNA strands are known as polynucleotides because they are comprised of two nucleotide chains.

RNA is composed of a single nucleotide chain.

Hope this helps :)

Which of the following could result if meiosis did not occur in the process of sexual reproduction?

Answers

What would happen if meiosis did not occur in sexually reproducing organisms? The chromosome number would double in each generation because the process of meiosis halves the number of chromosomes in the gametes. ... the exchange of genetic material between homologous chromosomes that results in recombinant chromosomes.

Hope this helps a bit

Use the following questions to write your conclusion to your lab report.

What did you learn from doing this lab? (Did the volcano have an effect on the ability of a predator to catch their prey? What might this mean for future generations? Include numbers from your data tables to show these changes.)



How could you make the lab better?

Answers

Answer:

WHat??

Explanation:

A environmental scientist buys 20 gallons of oil eating bacteria to help remediate an area affected by an oil spill. The volume of water the scientist wants to cover with this bacteria is 5 ft³. What volume of water can the scientist cover with the bacteria she purchased? (1 gal = 0.13 ft³)

Answers

Answer:

2.6  [tex]ft^3[/tex]

Explanation:

Using the conversion factor:

1 gallon = 0.13 [tex]ft^3[/tex]

Therefore,

20 gallons = 20 x 0.13

       = 2.6‬  [tex]ft^3[/tex]

This means that only 2.6  [tex]ft^3[/tex] out of the 5  [tex]ft^3[/tex] total volume of water the scientist wants to cover can actually be covered by the bacteria that was purchased.  

what type of EM waves are used to observe objects from outer space

Answers

Answer:

Space telescopes can carry instruments to observe objects emitting various types of electromagnetic radiation such as visible, infrared or ultraviolet light; gamma rays; or x-rays. X-ray telescopes, such as the Chandra X-ray Observatory, use X-ray optics to observe remote objects in the X-ray spectrum.

Explanation:

becuse u ugly jk jk jk im not serious ok

Type of EM waves used to observe objects from outer space would be infrared, ultraviolet light, gamma rays, and x-rays

7 Which answer best describes
condensation?
A A gas changing into a liquid
B A liquid changing into a solid
C A solid changing into a liquid
D A liquid changing into a gas

Answers

A is the correct answer.
The answer is: A gas changing into a liquid

Which list the layers of the atmosphere from earth surface outward?

Answers

Answer:

In order from earth to space it would be troposphere, stratosphere, Mesosphere, Thermosphere, exosphere (ionosphere.)

Explanation:

^

troposphere, stratosphere, mesosphere, thermosphere

what animals eat leafy sea dragons? also want to do leafy sea dragons eat?

Answers

Answer:

(1) In the wild, young sea dragons are preyed upon by other fish, crustaceans and even sea anemones.

(2) Leafy seadragons eat small, plankton crustaceans.

Help (will give crown for answer)

Answers

Answer:genes

Explanation:

Organisms are composed of many complex molecules. These molecules are composed mainly of carbon, hydrogen, oxygen, nitrogen, sulfur, and phosphorus. Which of the following statements most accurately describes how these molecules are made in ALL organisms?​

Answers

Its oxygen because all living organisms need oxygen to survive

pls help!!

Which row shows the chambers of the heart, from those with the thickest walls to those with the
thinnest walls?
from top to bottom it goes from the thickest to thinnest
A.
atria
left ventricle
right ventricle
B
atria
right ventricle
left ventricle
с
left ventricle
right ventricle
atria
D
right ventricle
left ventricle
atria

Answers

The answer is: B Atria, Right Ventricle, Left Ventricle
The right and left atria because they are low-pressure chambers that serve as storage units and conduits for blood so they would be the thinnest

Please Help!
The middle of an mRNA molecule contains the nucleotide sequence shown here. Much more of the mRNA is translated. Assume that the sequence is translated from left to right.

AUUUAACUGUUCUGUCUAGAG


1.

Construct an Explanation Based only on the information provided, why could the mRNA section be translated into three different sets of amino acids, instead of just one set?

2.

Use Models Use the genetic code to translate the sequence into each of the three possible sets of amino acids.

3.

Draw Conclusions Which of the three sets of amino acids is the most likely to be included in the polypeptide? Explain your reasoning.

Answers

Answer:

TAA ATT GAC AAG ACA GAT CTC

1. The more bases there are per codon the more information you can code for. There are only 22 different amino acids, in consequence we need minimum 3 bases per codon.

2. codon

three nucleotides—called a triplet or codon—codes for one particular amino acid in the protein. The nucleotide sequence in the DNA is first transcribed into a molecule of messenger RNA (ribonucleic acid).

3. Known as alpha helices and beta sheets, these stable folding patterns make up the secondary structure of a protein. Most proteins contain multiple helices and sheets, in addition to other less common patterns (Figure 2). The ensemble of formations and folds in a single linear chain of amino acids — sometimes called a polypeptide — constitutes the tertiary structure of a protein. Finally, the quaternary structure of a protein refers to those macromolecules with multiple polypeptide chains or subunits.

OKAY I THINK EVERYTHING IS RIGHT BUT SORRY IF WRONG ;)

The mRNA sequence could be translated into three different sets of amino acids because of the degeneracy of the genetic code.
Using the genetic code to translate the mRNA sequence, we get the following three possible sets of amino acids:Set 1: isoleucine-phenylalanine-leucine-serine-valine-arginineSet 2: isoleucine-asparagine-valine-leucine-serine-arginineSet 3: isoleucine-asparagine-leucine-serine-valine-arginine

3. It is not possible to determine which of the three sets of amino acids is the most likely to be included in the polypeptide based solely on the information provided.

What is a nucleotide sequence?

A nucleotide sequence is the order of nucleotides (the building blocks of nucleic acids) in a DNA or RNA molecule.

Nucleotides are composed of a sugar, a phosphate group, and a nitrogenous base, which can be adenine (A), cytosine (C), guanine (G), thymine (T) (in DNA) or uracil (U) (in RNA). The specific order of these nucleotides in a DNA or RNA molecule determines the genetic information that the molecule carries.

Learn more about nucleotide sequence, here:

https://brainly.com/question/30299889

#SPJ6

Bromine is a liquid at room temperature. The volume of a sample of bromine is measured in a 50 ml beaker and a 100 ml beaker. How will the two
measurements compare?
A. The volume of bromine will be larger in the 100ml beaker.
B. The volume of bromine will be smaller in the 50ml beaker,
C. The volumes will be the same.
D. Both A and B

Answers

I think it’s D bye have a nice day

The actual volume of bromine in each beaker will be same only the difference in height will be comparable. Therefore, option (C) is correct.

What are the properties of liquid ?

A liquid's attributes are;

1) Compared to the volume occupied by a gas, the volume of a liquid is relatively stable at conditions that allow it to remain in the liquid state.

2) A liquid will take the form of the container it is placed in.

3) A liquid's surface in a container must be flat for the attraction forces between its molecules to be in equilibrium both at the liquid's surface and within its body.

Therefore, there will be variations in the measured height of the same volume of bromine in each beaker given that the volume of the bromine is measured in a 50 ml beaker and a 100 ml beaker.

Learn more about Liquids, here:

https://brainly.com/question/13279941

#SPJ5

Which nutrient cycle has no Gas Phase?

Answers

Answer:

Describe the steps that you would take to effectively prepare for a discussion about a debatable issue.

Explanation:

Based on an analysis of the data, describe the effect of karrikins on seed
germination in the autotrophic host plants and the obligate parasitic weed plants.

Answers

Answer:

It triggers seed germination by activating hormone.

Explanation:

Karrikins has a great effect on seed  germination in the plants as well as the obligate parasitic weed plants because it trigger the germination of seed by signaling of hormone known as strigolactone which is responsible for the germination of see. Karrikins are the group of plant growth regulators which is present in the smoke of burning plant.

1. When a consumer eats a producer, 10 percent of the producer's energy is passed on to the consumer trophic level. What happens to the other 90 percent?

A. It is added back to the soil by decomposers.


B. It is used by the producer to pass on to the next trophic level.

C. It is used for cell processes or released as heat.

D. It is consumed and used by the consumer.

2. Why is there less biomass at the top of the energy pyramid?
A. Secondary and tertiary consumers have to consume a lot more food to support themselves, so there are fewer of them.

B. Secondary and tertiary consumers live longer, so there are fewer of them because they reproduce more slowly.

C. Secondary and tertiary consumers are larger, so there are fewer of them.

D. Secondary and tertiary consumers have bigger ranges, so there are fewer of them because they each need a lot of space.

3. Using the ten percent rule, determine how many kilocalories of energy the tertiary consumer tuna will receive.

Algae: 135,000 Kcal
Shrimp: _
Lantern Fish: _
Tuna: _

A. 135 Kcal

B. 1,350 Kcal

C. 135,000 Kcal

D. 13,500 Kcal

4. Read the following statements about various species of plants and animals. Which one would be classified as an invasive species?

A. Kudzu, a plant from Japan, was introduced as a foliage crop and to reduce soil erosion. It grows up to a foot per day, smothering low-growing plants and killing trees.

B. Dandelions are plants from Eurasia. They are often considered weeds by homeowners and killed off by using herbicide. They can be consumed in salads or as tea and are the first food resource for bees in the spring.

C. Honey bees are from Europe and can sting people. They are often farmed in America for their ability to pollinate and provide honey.

D. Loosestrife beetles, native to Eurasia, have been released in various American states to combat the invasive plant, purple loosestrife.

5. Using the following formula to find the efficiency of energy transfer between the harbor seal (2,500 Kcal) and a polar bear (375 Kcal)
(Energy level transferred to next level) / (Total energy input) × 100

A. 15%

B. 20%

C. 10%

D. 12%

Thank you so much if you answer this:) I'm working on it and will probably figure them out but a little help would be appreciated. <3​

Answers

Answer: I just to happen to be working on this quiz right now. I got 5/5 on it, so I hope this helps :D

~Ten Percent Rule Quick Check~

1. B) It is used for cell processes...

2. D) Secondary and tertiary consumers have to consume a lot more..

3. D) 135 Kcal

4. C) Kudzu, a plant from Japan...

5. A) 15%

^This is confirmed valid as of January 17th, 2022^

Consumers are the organisms that depend on others for food and energy for the metabolic process while the producers produce their food at the trophic levels.

The correct options are 1. C, 2. A, 3. A, 4. A and 5. A.

The trophic levels can be explained as:

1. In the trophic levels the energy gets decreased as it passes from one level to another because it is used in the cellular process it is released in the form of heat.

2. Secondary and tertiary consumers have to feed a lot and hence, they are fewer in number compared to the producers. They maintain the population and balance out the producer and consumer ratio.

3. According to the 10 % rule of energy transfer, the Tuna will receive 135 Kcal of energy because the energy decrease by 10% as one moves from the lower trophic to the upper levels.

4. The species that are non-native to a place or region are called invasive species hence, the Kudzu plant is the invasive species as it is introduced from Japan.

5. Given,

Energy of Seal = 2,500 Kcal

The energy of polar bear = 375 Kcal

The 10% of 2500 will be 250 and the 5 % 125 thus, 15% is the efficiency.

Therefore, the correct options are 1. C, 2. A, 3. A, 4. A and 5. A.

Learn more about energy transfer and trophic level here:

https://brainly.com/question/20586850

Other Questions
what is the equation of this line? The first mass extinction that occurred between the Paleozoic and the Mesozoic Era,caused the extinction of which organism?O Wooly mammothO DinosaursO TrilobitesFlying Reptiles 2x+2+2x-17=180 what's x? Multiply 2ab(a+2b+3)PLEASE HELP Solve for x*X+ 1914 + x You purchase a $1,000 asset for $800. It pays $60 a year for seven years at which time you receive the $1,000 principal. Prove that the annual return on this investment is not 9 percent. Kiara starts at 4, walks 6 blocks left and 2 blocks right. What is her displacement? HELP MEEEE! Best answer gets brainliest and a thanks on their profile!Hehe, sorry for being so dramatic. It's just that my questions are rarely answered on here, so I needed to find a way to grasp your attention.Here is what I need help with: Please rewrite the following quotation, writing the descriptive elements in caps. "Watching him cycle the brick streets of evening, you could see that Leo Auffmann was a man who coasted along, enjoying the way the thistles ticked in the hot grass when the wind blew.".Thank you for your time, and God bless. CAN SOMEONE HELLP MEE? *cries CAN SOMEONE PLEASE HELP ME??? A problem at work must be handled the same way as a personal conflict.Please select the best answer from the choices provided.F What are three reasons that animals can stay warm in the Arctic?A) seals, foxes, and bears B) fat and fur C) fat, fur, and body parts D) big feet, small ears, and white fur 4. A toy car travels 60 m during 5.7 s at a constant speed. What is the speed of the toy car?15.55613.5266.11610.526None of these is correct. Please help. Im struggling.. I will mark you as brainliest !!When comparing the various relationships between the government and businesses in marketand command economies, how might a mixed economy best address the needs of everyindividual? Figure 1 shows a seaside cliff. Figure 2 shows the same cliff after a period of time has passed. What caused the change from figure 1 to figure 2? A. rainfall only B. ocean waves only C. wind D. rainfall and ocean waves Read the text trailer for the short story 4102 Elm Street.Strange noises. Weird odors. No one seen going either in or out. Andrew knew something strange was going on in the house across the street, and he was determined to find out what it was. Armed with time, a map of the neighborhood, and a magnifying glass, Andrew set out to solve the mystery of 4102 Elm Street. He had no idea what he would find . . . and he was a little afraid to find out!The music that would best match the tone of this text trailer would besoft and classical.happy and uplifting.fast and exciting.sad and melancholic. Choose one of van Goghs paintings from the unit and write a two-paragraph critique of the piece. COMPLETEZ complete each sentence with the correct form of a verb from the list. One container of ice cream holds 9 scoops of ice cream. One package of ice cream cones has 12 cones. We want to make the fewest number of cones, with one scoop of ice cream on each cone and no ice cream or cones left over. How many containers of ice cream and packages of cones should be purchased? How many ice cream cones will we be able to make? The fewest number of ice cream cones we will be able to make is . We need to purchase containers of ice cream and packages of ice cream cones. Darla's family went on a vacation to Yellowstone Park. On day 1, they drove 14 the total distance, and on day 2 they drove an additional 15 the total distance. Which shows about how far the family has left to travel to Yellowstone Park?