HELP PLEASE PLEASE HELP Create an expression that includes 2 Operations 1 Must be addition or subtract, the other multiplication/division Write a word problem that leads us to this

Answers

Answer 1

Answer:

Margret, Jay, and Andi each have a sticker collection. Jay has 34 stickers. Margret has 3 times as many stickers as Andi. Andi has 9 more stickers than Jay. How many stickers does Margret have?

How to solve:

a = andi's stickers

j = jay's stickers (34)

m = margret's stickers

9 + j = a    or    9 + 34 = 43

so a = 43

a x 3 = m    or    43 x 3 = 129

m = 129

Margret has 129 stickers


Related Questions

what is the equation?

Answers

Answer:

Step-by-step explanation:

y = 10/4 x

y = 2.5 x

Figure b is a scale image of Figure A

Answers

Where is the scale image?

Ok offering the brainiest and 20 point to who ever can solves these question. The answers I marked were wrong.

Answers

Answer:

C multiply by 3, then subtract 5      

B

C m<7

Step-by-step explanation:


Kala, Chau, and Deshaun have a total of $68 in their wallets. Deshaun has 2 times what kala has. Kala has $8 less than Chau. How much do they
have in their wallets?
Amount in Kala's wallet:$
Amount in Chau's wallet:$
Amount in Deshaun's wallet:$

Answers

deshaun has $30 , kala has $15, Chau has $23

Which is an equation of a line with undefined slope?

Answers

Answer:

Any constant that is set to equal x would have an undefined slope.  For example, x=0 is just a horizontal line, so the slope is undefined.  

Step-by-step explanation:

The slope would be undefined because in a horizontal line, the length could be anything, but there is no distance between x-values.

Answer:

X=0

Step-by-step explanation:

gordan types 1800words in 25minutes words per minute ​

Answers

Answer:

ok? if the question is how many words does he type in a minute the answer is 72

Step-by-step explanation:

Answer:

72 is right i check

Step-by-step explanation:

he/she comment the same so it was there idea

I need help please and thank you

Answers

Answer:

A

Step-by-step explanation:

Movie tickets cost $9.95 for adults and $6.75 for students. The Ryder family buys 2 adult tickets, 3 student tickets, and then popcorn and drinks for $26. What is the total amount that they spend?

Answers

Answer:

$66.15

Step-by-step explanation:

(9.95x2)+(6.75x3)+26=66.15

Answer:

The Answer is 66.15 By the person above

ignore this there is nothing to see

Answers

Step by step explanation:

alright



lol

As an estimation we are told 5 miles is 8km Convert 4 km to miles

Answers

Answer: 2.5

Step-by-step explanation:

For this problem, we see that 4km is 1/2 of 8km.

So, we will have to find 1/2 of 5km.

1/2 of 5km = 2.5km

Your answer is 2.5km

Answer:

2.48548 Miles or simplified 2.5

Step-by-step explanation:

You Divide by 1.609 to find the answer.  

what is f - 11 = 14 2/7

Answers

31.286 i think that its 31.286 bc welp me smart

Can someone please help me with this math problem I don’t understand it

Answers

Answer:

i  need points

Step-by-step explanation:

i need points ,, hope you find your answer

What is the five number summary for this data set?
2,7, 15, 19, 26, 33, 39, 41, 49, 52
Assume the numbers in each answer choice are listed in this order: min, Q1,
median, Q3, max.
O A 2,19,29.5, 39, 52
B. 2, 19, 36, 39, 52
C. 2,15,29.5, 41,52
OD 2, 15, 36, 41,52

Answers

Answer: a p e x 2, 15, 29.5, 41, 52

Step-by-step explanation:

Determine if the number is a negative or positive integer. Dived 28 ft below sea level. *

Answers

Answer:

Its BELOW sea level

Step-by-step explanation:

Its below sea level

SOMEONE WHO IS GOOD AT GEO MATH PLZ HELPPP!!!
The Venn diagram represents enrollment in various classes at a certain high school. 12 students take math (Math) only. 11 students take English (Eng) only. 16 students take biology (Bio) only. 30 students are enrolled in math and English, but not biology. 15 students are enrolled in all three classes. 200 students attend the school, and 16 students take biology and English, but not math. How many students are enrolled in math and biology, but not English?

A.
12
B.
17
C.
75
D.
100



Please select the best answer from the choices provided


A
B
C
D

Answers

Using the symbols in the Venn diagram, we want to find A given that

B = 16

C = 15

D = 30

and given that 25 students don't take any of these courses.

There are 200 students total, so we need to have A plus the total number of students given in the diagram sum to 200. This means

(math only) + (English only) + (biology only) + (math and English, no biology) + (math and biology, no English) + (English and biology, no math) + (all three) + (none of the three) = 200

or

12 + 11 + 16 + 30 + A + 16 + 15 + 25 = 200

Solve for A to get A = 75, making the answer C.

help in like 2 mins pls!! 9+-6/-3

Answers

Answer:

11

Step-by-step explanation:

Answer:

11

Step-by-step explanation:

what is the value of x?

3x−6=21?

Answers

Answer:

X = 9

Step-by-step explanation:

Answer:

x = 9

Step-by-step explanation:

Move all terms that don't contain x to the right side and solve.

select the equation that represents the problem. Let × represent the unknown number.

Ms. Weaver bought 216 pencils for her class. The pencils came in packs of 24. How many packs did she buy?

A. 216× = 24

B. 216 - × = 24

C. × + 24 = 216

D. 24× = 216

Answers

Answer:

the is option d cause big number is divided by small ones.

Step-by-step explanation:

hope it's right

ddddd ddddddd ddddd dddd

Find the solution of the differential equation that satisfies the given initial condition. x ln(x) = y 1 + 8 + y2 y', y(1) = 1.

Answers

Answer:

[tex]\mathbf{((lnx)(2x^2)) -x^2 +39 =(2y^2 +(\dfrac{4}{3})(8+y^2)^{3/2})}[/tex]

Step-by-step explanation:

Given that:

[tex]x In(x) = y( 1+ \sqrt{8+ y^2}) \ } \ \dfrac{dy}{dx}[/tex]

[tex]xln(x) *dx= (y+y \sqrt{(8+y^2}) \ dy[/tex]

[tex]\int xln(x) dx = \int(y+y\sqrt{(8+y^2})) \ dy[/tex]

[tex]\int lnx (x)dx =(\dfrac{y^2}{2} +\dfrac{1}{3}(8+y^2^{)3/2})[/tex]

[tex](lnx \dfrac{x^2}{2})-\int((\dfrac{x^2}{2})\times \dfrac{1}{x} =(\dfrac{y^2}{2} +\dfrac{1}{3}(8+y^2)^{3/2})[/tex]

[tex]((lnx)(\dfrac{x^2}{2}))-\int(\dfrac{x}{2}) =(\dfrac{y^2}{2} +(\dfrac{1}{3})(8+y^2)^{3/2})[/tex]

[tex]((lnx)(\dfrac{x^2}{2}))-(\dfrac{x^2}{4}) +C= (\dfrac{y^2}{2 }+(\dfrac{1}{3})(8+y^2)^{3/2})[/tex]

For  y(1) = 1

[tex]((ln(1))(\dfrac{1^2}{2}))-(\dfrac{1^2}{4}) +C= (\dfrac{1^2}{2 }+(\dfrac{1}{3})(8+1^2)^{3/2})[/tex]

[tex](0)-(\dfrac{1}{4}) +C =(\dfrac{1}{2} +(\dfrac{1}{3})(3)^3)[/tex]

[tex]C=(\dfrac{19}{2}) +(\dfrac{1}{4})[/tex]

[tex]C=\dfrac{39}{4}[/tex]

[tex]((lnx)(\dfrac{x^2}{2}))-(\dfrac{x^2}{4}) +(\dfrac{39}{4}) = (\dfrac{y^2}{2} +(\dfrac{1}{3})(8+y^2)^{3/2})[/tex]

[tex]\mathbf{((lnx)(2x^2)) -x^2 +39 =(2y^2 +(\dfrac{4}{3})(8+y^2)^{3/2})}[/tex]

) Nadia wants to draw a scale diagram of the garden. The garden is rectangular and measures 1350 cm by 1000 cm Nadia says, “If I use a scale of 1 cm to 50 cm, the drawing will fit on a piece of A4 paper”. A4 paper measures 297 mm by 210 mm Is Nadia correct? Explain how you decide

Answers

Answer:

Nadia is correct

Step-by-step explanation:

Dimensions of the diagram:

Length ⇒ 1350/50 = 27 cmWidth ⇒ 1000/50 = 20 cm

Nadia is correct as the diagram of 27 cm × 20 cm will fit in A4 paper

can any one help me with this please ?this is worth 82 points

Answers

Answer:

1. YZX

2. XYZ

3. ZXY

4. EDF

5. MLN

6. FED

7. DFE

8. MNL

9. LMN

1 was flipped (reflected).

2 was slid (translated).

3 was slid (translated).

4 was rotated 180 degrees clockwise.

5 was flipped and rotated.

6 was flipped and rotated.

7, 8, 9 were translated.

Every month Tanesha pays a fixed fee of $10 to use the parking lot at her workplace. She must also pays $2 each day that she parks her car in the lot. If she parks there x days in one month, which of the following represents the amount in dollars that she must pay for using the parking lot that month?

Answers

10 + 2x • the amount of days in the month

The equation that represents the amount in dollars that she must pay for using the parking lot that month is y = 2x +10, the correct option is B.

What is an Equation?

An equation is a mathematical statement formed when two algebraic expressions are equated using an equal sign.

The equations are useful in determination of unknown parameters.

The equations are of various types, such as Trigonometric equations, quadratic equations.

The amount Tanesha pays to use the parking lot is $10

The daily amount she pays to use the parking is $2

Let x represents the days in one month.

Let y represents the amount in dollars that she must pay for using the parking lot that month.

The unknown parameters are x and y

The equation that can be formed is

y = 2x +10

It seems that your question is incomplete, the complete question is as follows:

A .  y = 2x

B. y = 2x +10

C. y = 10x +2

D. y = 10x

To know more about Equation

https://brainly.com/question/10413253

#SPJ5

A bakery is making apple pies and carrot cakes. Each
apple pie nets $5 profit. For each carrot cake, they
make $10 profit. Each pie take 4 hours to prepare and
1.5 hours to bake. The carrot cakes take 0.5 hours to
prepare and 0.5 hours to bake. The maximum
preparation time is 20 hours. The maximum baking
time is 10 hours. How many pies and cakes should be
made to maximize profits?

Answers

Answer:

8 thats how many pies and cakes you can do

Step-by-step explanation:

you have 20 minutes and 10 and the most cakes you can get with left over is 8

The pies and cakes should be made to maximize profits is 8 pies.

What is profit?

Profit is defined as the sum of revenue and income after all costs have been deducted by a business. A function with a business-oriented focus is called a profit function. The main goal of a business is to generate income through the sale of goods and services, minus the costs associated with producing those goods and services, in order to turn a profit.

Revenue minus costs equals profit.

Costs comprise both variable costs and fixed costs, whereas revenue is the total amount of positive cash flow that a business generates.

The maximum number of cakes you can get with leftovers in 20 minutes and 10 is 8.

Thus, the pies and cakes should be made to maximize profits is 8 pies.

To learn more about profit, refer to the link below:

https://brainly.com/question/15036999

#SPJ2

What is the equation of the line that has a slope of 4 and a y-intercept of -7?

y = -7 x + 4
y = -4 x + 7
y = 4 x - 7
y = 7 x - 4

Answers

Answer:

y = 4 x - 7

The slope is the number multiplied by x, 4

Step-by-step explanation:

;-;

Answer:

The answer is C

Step-by-step explanation:

Peter rolls 2 fair dice and adds the results from each.

Work out the probability of getting a total of 11.

Answers

Answer:

5/12

Step-by-step explanation:

im finding answers for hegarty maths and i got it wrong and it said 5/12 was the answers

thank me later

Answer:

2/36

Step-by-step explanation:

i found it on another website

I can take medication that is prescribed to my parents because it is family.

True
False

Answers

false because its not for you

Answer:

False

Step-by-step explanation:

Because it is your family, does not mean you should still take it. Yes genes are transmittable and inheritable, but that doesnt mean medication should be shared unless its a guarantee for the same issue. The answer if False.

Given sec A= and that angle A is in Quadrant I, find the exact value of csc A in
simplest radical form using a rational denominator.
Need help :(

Answers

The required value is [tex]\csc A=\dfrac{5}{4}[/tex].

Important information:

[tex]\sec A=\dfrac{5}{3}[/tex]Angle A is in Quadrant I.

We need to find the exact value of csc A.

Trigonometric Ratios:

Formulae used: If angle A is in Quadrant I.

[tex]\cos A=\dfrac{1}{\sec A}[/tex]

[tex]\sin A=\sqrt{1-\cos^2 A}[/tex]

[tex]\csc A=\dfrac{1}{\sin A}[/tex]

Using these formulae, we get

[tex]\cos A=\dfrac{3}{5}[/tex]

And,

[tex]\sin A=\sqrt{1-\left(\dfrac{3}{5}\right)^2}[/tex]

[tex]\sin A=\sqrt{1-\dfrac{9}{25}}[/tex]

[tex]\sin A=\sqrt{\dfrac{16}{25}}[/tex]

[tex]\sin A=\dfrac{4}{5}[/tex]

Now,

[tex]\csc A=\dfrac{1}{\sin A}[/tex]

[tex]\csc A=\dfrac{1}{\frac{4}{5}}[/tex]

[tex]\csc A=\dfrac{5}{4}[/tex]

Thus, the required value is [tex]\csc A=\dfrac{5}{4}[/tex].

Find out more about 'Trigonometric Ratios' here:

https://brainly.com/question/2263794

The required value of cscA is 1.25

Given,

[tex]secA=\frac{5}{3}[/tex]

Trigonometrical ratios:

In the first quadrant, all ratios are positives.

[tex]sin A=\frac{P}{H}[/tex]

And the value of hypotenuse is,

[tex]P=\sqrt{H^2-B^2} \\=\sqrt{5^2-3^2} \\=\sqrt{16}\\ P=4[/tex]

So, the sine A is,

[tex]sinA=\frac{P}{H}\\ =\frac{4}{5}[/tex]

So, the rational denominator is,

[tex]cscA=\frac{H}{P}\\ =\frac{5}{4}\\=1.25[/tex]

Learn More about Trigonometrical ratios:

https://brainly.com/question/24349828

Callista needs a carpet runner for her hallway. She needs it to be 1 1/2 feet wide and 4 feet long. What is the area of the carpet runner Callista needs?

Answers

Answer: 6 square feet

Step-by-step explanation: We simply need to do 1.5 x 4! This shows that the area of the carpet runner is 6 square feet.

Hope this helps :)

IDC IF THERE WRONG I JUST NEED AN ANSWER PLS 10 POINTS!!!

In an apartment building, the ratio of residents to cars is 4:6. If there 32 residents, how many cars are there?

Answers

Answer: 217 :D I think I did mental math so I might be wrong

Step-by-step explanation:

Answer:

21 (not even joking)

Explanation:

4/6 = .6 repeating

.6 x 32 = 21.3 which rounds to 21

hellllppp please help me

Answers

Answer:

[tex]F' = (-3,-3)[/tex]

[tex]G' = (-3,3)[/tex]

[tex]H' = (6,-3)[/tex]

Step-by-step explanation:

Given

The attached graph

[tex]Scale\ Factor = 1\frac{1}{2}[/tex]

Required

Determine the coordinates of F'G'H'

First, we need to get the coordinate of F, G and H from the graph

[tex]F = (-2,-2)[/tex]

[tex]G = (-2,2)[/tex]

[tex]H = (4,-2)[/tex]

The dilated coordinate is then calculated as:

[tex](FGH)' = (FGH) * Scale\ Factor[/tex]

This gives:

[tex]F' = (-2,-2) * 1\frac{1}{2}[/tex]

[tex]F' = (-2* 1\frac{1}{2},-2* 1\frac{1}{2})[/tex]

[tex]F' = (-3,-3)[/tex]

[tex]G' = (-2,2) * 1\frac{1}{2}[/tex]

[tex]G' = (-2 * 1\frac{1}{2},2 * 1\frac{1}{2})[/tex]

[tex]G' = (-3,3)[/tex]

[tex]H' = (4,-2) * 1\frac{1}{2}[/tex]

[tex]H' = (4 * 1\frac{1}{2},-2 * 1\frac{1}{2})[/tex]

[tex]H' = (6,-3)[/tex]

Other Questions
|-10| divided by 2 x |5| The graph of the equation x + 3y = 6intersects the y-axis at the point whosecoordinates are: (Find the y intercept)which answer?(0,2)(0,6)(0,18)(6,0) How many men did it take to capture Antigonea. 2b. 5c. 1d. 7 Transcribe the following DNA strand into mRNA and translate that strand into a polypeptidechain, identifying the codons, anticodons, and amino acid sequence.DNA: CGATACAATGGACCCGGTATGCGATATCC Jake walks to town every fifth day. Sam rides his bike to town every fourth day. What is the first day they are likely to meet in town? Why do numA and numB have the same scope in the subtract function? def subtract(numA, numB): return numA - numB def divide(numC, numD): return numC / numD answer = subtract(24,6) print (answer) The coda is considered to be Which process is best illustrated by the diagram? Billy has a gift card with a $160 balance. He buys several video games that cost $40 each. After the purchases, his gift card balance is $40. Enter an equation to help find out how many video games Billy bought. Which fraction is represented by point A on the number line? who want to play among us Celeste transferred 100 percent of her stock in Supply Chain Company to Marketing Corporation in a Type A merger. In exchange, she received stock in Marketing with a fair market value of $562,000 + $562,000 in cash. Celeste's tax basis in the Supply Chain stock was $1,320,000. What amount of loss does Celeste recognize in the exchange and what is her basis in the Marketing stock she receives? QUICKLY PLEASE!!!Respond to the following in three to five sentences.What is the purpose of netiquette guidelines? In an experiment, two unknown compounds (one an ether and the other an amine) of equal molecular mass were dissolved in water. The result of the experiment is shown in the table.Solubility ComparisonUnknown Compound Solubility (g/100 ml water)A 4B 0.25Which of the following correctly explains the identity of Compound A and its solubility? It is an amine; it contains a nitrogen atom that will allow nitrogen-hydrogen bonds to form while in water. It is an ether; because the oxygen atom is within the carbon chain, so it is free to form oxy-hydrogen bonds to make it more soluble. It is an ether; the high polarity of the oxygen-hydrogen bond makes it more soluble. It is an amine; because the lower electronegativity of N than H makes it more soluble. . Why is spell check not completely reliable as an editor? is francium found in nature or lab? what is a film interpretation The students are trying to raise 3.000 but they only have 1200 how much would they need to get to 3000 According to the graph below, at which point is the plant preforming the most photosynthesis? A. Point D. B. Point B. C. Point C. D. Point A. How did African American life compare to the typical white person's life in the 1950's?