HELP The graph of a function contains the points (-5, 1), (0,
3), (5, 5). Is the function linear? Explain.
HELP IS NEEDED
(Photo included

HELP The Graph Of A Function Contains The Points (-5, 1), (0,3), (5, 5). Is The Function Linear? Explain.HELP

Answers

Answer 1

The function of given set of points is linear, because the graph containing the points is a straight line and its equation is  [tex]y = (\frac{2}{5} )x + 3[/tex]

Define the term graph?

A diagram in x-y hub plot is a visual portrayal of numerical capabilities or data of interest on a Cartesian direction framework.

To determine if the function represented by the given set of points is linear, we can check if the slope between any two points is constant.

Let's consider the slope between the points (-5, 1) and (0, 3):

slope = (change in y)/(change in x) = (3 - 1)/(0 - (-5)) = 2/5

Now, let's consider the slope between the points (0, 3) and (5, 5):

slope = (change in y)/(change in x) = (5 - 3)/(5 - 0) = 2/5

Since the slopes between the two pairs of points are the same, we can conclude that the function represented by the given set of points is linear.

The point-slope form of a line's equation can be used to determine the line's equation:

⇒ y - y₁ = m(x - x₁)

where (x₁ , y₁) is one of the given points, and m is the slope. Let's use the point (0, 3):

⇒ [tex]y - 3 = (\frac{2}{5} )(x - 0)[/tex]

⇒  [tex]y = (\frac{2}{5} )x + 3[/tex]

Therefore, the function represented by the given set of points is linear, and its equation is [tex]y = (\frac{2}{5} )x + 3[/tex]

To know more about graph, visit:

https://brainly.com/question/11803331

#SPJ1


Related Questions

Find the inverse laplace transform of F(s)=(8s^2-4s+12)/s(s^2+4)

Answers

The inverse Laplace transform of F(s)=(8s^2-4s+12)/s(s^2+4) is 3 + 5cos(2t) - 2sin(2t).

Explanation:

To determine the inverse Laplace transform of(8s^2-4s+12)/s(s^2+4), follow these steps:

Step 1: To find the inverse Laplace transform of F(s)=(8s^2-4s+12)/s(s^2+4), use partial fraction decomposition:

F(s) = (A/s) + (Bs+C)/(s^2+4)

Step 2: Multiplying both sides by s(s^2+4) and equating coefficients, we get:

8s^2 - 4s + 12 = A(s^2+4) + (Bs+C)s

Simplifying, we get:

8s^2 - 4s + 12 = As^2 + 4A + B*s^2 + Cs

Equating coefficients, we get:

A + B = 8

C = -4

4A = 12

Solving for A, B, and C, we get:

A = 3

B = 5

C = -4

Therefore, we can write F(s) as:

F(s) = 3/s + (5s-4)/(s^2+4)

Step 3: Taking the inverse Laplace transform of each term separately, we get:

L^-1{3/s} = 3

L^-1{(5s-4)/(s^2+4)} = 5L^-1{s/(s^2+4)} - 2L^-1{1/(s^2+4)}

Using the table of Laplace transforms, we can find that:

L^-1{s/(s^2+4)} = cos(2t)

L^-1{1/(s^2+4)} = (1/2) sin(2t)

Therefore, the inverse Laplace transform of F(s) is:

L^-1{F(s)} = 3 + 5cos(2t) - 2sin(2t). where L^-1 denotes the inverse Laplace transform operator.

Therefore, the inverse Laplace transform of (8s^2-4s+12)/s(s^2+4) is 3 + 5cos(2t) - 2sin(2t).

Know more about inverse Laplace transform click here:

https://brainly.com/question/31322563

#SPJ11

a circle has an initial radius of 50 ft when the radius begins degreasing at the rate of 4 ft/min. what is the rate of change of area at the instant thate radius ois 20 ft?

Answers

The rate of change of the area at the instant when the radius is 20 ft is -160π square feet per minute.

How to find the area of a circle?

The area of a circle is given by the formula A = π [tex]r^2[/tex], where r is the radius of the circle.

We are given that the radius of the circle is decreasing at a rate of 4 ft/min. This means that the rate of change of the radius with respect to time is -4 ft/min (negative because the radius is decreasing).

At the instant when the radius is 20 ft, we can calculate the rate of change of the area by taking the derivative of the area formula with respect to time:

dA/dt = d/dt (π[tex]r^2)[/tex]

Using the chain rule, we get:

dA/dt = 2πr (dr/dt)

Substituting r = 20 ft and dr/dt = -4 ft/min, we get:

dA/dt = 2π(20)(-4) = -160π

Therefore, the rate of change of the area at the instant when the radius is 20 ft is -160π square feet per minute.

Learn more about area of a circle

brainly.com/question/28642423

#SPJ11

find the derivative of the function ()=sin((2 −2))

Answers

The derivative of f(x) = sin(x²) is f'(x) = 2x × cos(x²).

The chain rule is a rule of calculus used to find the derivative of a composition of functions. It allows us to differentiate a function that is constructed by combining two or more functions, where one function is applied to the output of another function.

To find the derivative of the function f(x) = sin(x²), we need to apply the chain rule of differentiation, which states that if f(x) = g(h(x)), then f'(x) = g'(h(x)) × h'(x).

Here, g(x) = sin(x) and h(x) = x². Therefore, g'(x) = cos(x) and h'(x) = 2x.

Applying the chain rule, we have

f'(x) = g'(h(x)) × h'(x) = cos(x²) × 2x

Learn more about chain rule here

brainly.com/question/28972262

#SPJ4

suppose X ~N(8,5)show a normal bell curve for mu=8 and sigma=5, with x-axis scaling. add and label all the relevant features, including the percentile!

Answers

In this case, we can use a standard normal distribution table or a calculator to find that the value for P75 is approximately 12.1.

Here is a normal bell curve for a normal distribution with mean (μ) of 8 and standard deviation (σ) of 5:

The horizontal axis represents the range of possible values for the variable X, and the vertical axis represents the probability density of each value occurring.

The curve is symmetrical around the mean (μ=8), which is located at the peak of the curve. The standard deviation (σ=5) determines the width of the curve, with wider curves having larger standard deviations.

The shaded area under the curve represents the probability of a value falling within a certain range. For example, the area under the curve between X=3 and X=13 represents the probability of a value falling within 1 standard deviation of the mean, which is approximately 68%.

The percentile of a certain value can also be determined from the normal distribution. For example, the 75th percentile (represented as P75) is the value that separates the lowest 75% of values from the highest 25%. In this case, we can use a standard normal distribution table or a calculator to find that the value for P75 is approximately 12.1.

To learn more about determined visit:

https://brainly.com/question/22801094

#SPJ11

Video Que Q.1 Pythagorean theorem 155 A flying squirrel lives in a nest that is 8 meters up in a tree, but wants to eat an acorn that is on the ground 2 meters away from the base of his tree. If the flying squirrel glides from his nest to the acorn, then scurries back to the base of the tree, and then climbs back up the tree to his nest, how far will the flying squirrel travel in total? If necessary, round to the nearest tenth​

Answers

The distance that is being travelled by the flying squirrel in total would be = 18.2m.

How to calculate the distance covered by the flying squirrel?

To calculate the distance covered by the squirrel, the Pythagorean formula should be used. That is;

C² = a² + b²

a = 8m

b = 2m

c²= 8² + 2²

= 64+4

c = √68

= 8.2m

The total distance travelled by the flying squirrel is to find the perimeter of the triangle covered by the squirrel.

perimeter = length+width+height

= 8+2+8.2 = 18.2m.

Learn more about perimeter here:

https://brainly.com/question/31619854

#SPJ1

The equation 5 factorial equals

Answers

Answer: 120

Step-by-step explanation:

The factorial function multiplies all numbers below that number going to 1. For example,

   2! = 2 * 1 = 2

   3! = 3 * 2 * 1 = 6
   4! = 4 * 3 * 2 * 1 = 24

Thus, 5! would be 5 * 4 * 3 * 2 * 1 = 120.

Segments HS and WB are equal in length. HS= (8x +15) and WB = (12-13). Which of the following is the value of x?
A) 3
B)4
C)6.5
D)7

Answers

Since HS=WB, we can set their expressions equal to each other:

8x + 15 = 12 - 13

Simplifying the right-hand side:

8x + 15 = -1

Subtracting 15 from both sides:

8x = -16

Dividing both sides by 8:

x = -2

Therefore, none of the given options are correct.

Answer:lol it was 7

Step-by-step explanation:

Daisy and diesel play a game where diesels chance of winning is always 1/4. they play the game again and again until one of them wins 6 games. Find the probalbility that diesel will win her 6th game on the 18th game(that is, Diesel will win the 18th game, at which point she will have a total of 6 wins).

Answers

The probability that Diesel will win her 6th game on the 18th game is approximately 0.000568, or 0.0568%.

The probability that Diesel will win her 6th game on the 18th game is calculated using the binomial distribution formula.

Let's define the following terms:
- n = number of trials (games played) = 18
- k = number of successes (games won by Diesel) = 6
- p = probability of success (Diesel winning a game) = 1/4
- q = probability of failure (Daisy winning a game) = 1 - p = 3/4

The formula for the probability of exactly k successes in n trials is:

P(k) = (n choose k) * p^k * q^(n-k)

where (n choose k) is the binomial coefficient, which represents the number of ways to choose k successes out of n trials. It can be calculated as:

(n choose k) = n! / (k! * (n-k)!)

Plugging in the values, we get:

P(6) = (18 choose 6) * (1/4)^6 * (3/4)^12
= 18! / (6! * 12!) * (1/4)^6 * (3/4)^12
= 18564 * 0.00000244 * 0.0122
= 0.000568

Therefore, the probability that Diesel will win her 6th game on the 18th game is approximately 0.000568, or 0.0568%.

To know more about probability  refer here:

https://brainly.com/question/30034780

#SPJ11

let f(x) = x4(x − 4)3. (a) find the critical numbers of the function f. (enter your answers from smallest to largest.)

Answers

The critical numbers of the function f(x) = [tex]x^{4} (x - 4)^{3}[/tex] are x = 0 and x = 4.

Find the critical numbers of the function f?

To find the critical numbers of the function f(x) = [tex]x^{4}(x - 4)^{3}[/tex], we need to find the values of x at which the derivative of f(x) is equal to zero or undefined.

First, we will find the derivative of f(x) using the product rule:

f'(x) = [tex]4x^{3} (x - 4)^{3} + x^{4} 3(x - 4)^{2}(1)[/tex]

Simplifying this expression, we get:

f'(x) = [tex]4x^{3} (x - 4)^{2} (4 - x)[/tex]

Now, we can set f'(x) equal to zero and solve for x:

[tex]4x^{3} (x - 4)^{2} (4 - x)[/tex] = 0

From this equation, we can see that the critical numbers are x = 0, x = 4, and x = 4.

To check if x = 4 is a critical number, we need to find the limit of f'(x) as x approaches 4 from the left and from the right:

lim x→4- f'(x) = lim x→4- 4[tex]x^{3}[/tex][tex](x - 4)^{2}[/tex](4 - x) = 0

lim x→4+ f'(x) = lim x→4+ 4[tex]x^{3}[/tex][tex](x - 4)^{2}[/tex](4 - x) = 0

Since both limits are equal to zero, x = 4 is a critical number.

Therefore, the critical numbers of the function f(x) = [tex]x^{4} (x - 4)^{3}[/tex] are x = 0 and x = 4.

to know more about numbers

brainly.com/question/17429689

#SPJ1

Write F2 + F4 + F6 + ... + F2n in summation notation. Then show that F2 + F4 + F6 + ... + F2n = F2n+1 - 1.

Answers

a) The summation notation of F₂ + F₄ + F₆ + ... + F₂ₙ is ∑ᵢ₌₁ᵗⁿ F₂ᵢ

b) Proved that F₂ + F₄ + F₆ + ... + F₂ₙ = F₂ₙ₊₁ - 1.

The Fibonacci sequence is defined as F₁ = 1, F₂ = 1, and Fₙ = Fₙ₋₁ + Fₙ₋₂ for n ≥ 3.

To express F₂ + F₄ + F₆ + ... + F₂ₙ in summation notation, we can observe that the terms are all even Fibonacci numbers. Thus, we can write:

∑ᵢ₌₁ᵗⁿ F₂ᵢ = ∑ᵢ₌₁ᵗⁿ₋₁ F₂ᵢ + F₂ₙ

where n is even.

We can then use the recurrence relation of the Fibonacci sequence to simplify this:

∑ᵢ₌₁ᵗⁿ F₂ᵢ = ∑ᵢ₌₁ᵗⁿ₋₁ F₂ᵢ + F₂ₙ

= (F₂₁ - 1) + F₂ₙ

= F₂ₙ₊₁ - 1

where we have used the fact that F₂₁ = F₁ = 1.

Therefore, we have shown that F₂ + F₄ + F₆ + ... + F₂ₙ = F₂ₙ₊₁ - 1.

Learn more about summation notation here

brainly.com/question/29334900

#SPJ4

1 2 3 3 10 2 2 -2 2 2 . Find the complete solution x= Xp + xn of the system Ax = b, A= b where 3 7 6 -3 11 2 4 0 -6 Xp stands for a particular solution and Xn the general solution of the associated homogeneous system.

Answers

Therefore, the complete homogeneous system solution is: x = [-0.1765, 0.6471, -0.0882] + t1[2, -1, 1] + t2[0, -1, 1]

The system, first we need to find the inverse of matrix A, which is:

A = [3 7 6]

[-3 11 2]

[4 0 -6]

det(A) = 3*(-611 - 20) - 7*(-3*-6) + 6*(-3*2) = -204

adj(A) = [72 18 42]

[54 6 33]

[14 28 14]

[tex]A^{(-1) }= adj(A)/det(A):[/tex]

[-0.3529 0.0882 -0.2059]

[-0.2647 -0.0294 -0.1618]

[-0.0686 -0.1373 -0.0686]

Next, we need to solve for Xp using Xp = [tex]A^{(-1)} * b:[/tex]

b = [1 2 2]

Xp = [tex]A^{(-1)} * b:[/tex]= [-0.1765, 0.6471, -0.0882]

To find Xn, we solve the associated homogeneous system Ax = 0:

[3 7 6][x1] [0]

[-3 11 2][x2] = [0]

[4 0 -6][x3] [0]

Writing this system in augmented form, we have:

[3 7 6 | 0]

[-3 11 2 | 0]

[4 0 -6 | 0]

We can use row reduction to solve for the reduced row echelon form:

[1 0 -2 | 0]

[0 1 1 | 0]

[0 0 0 | 0]

The general solution can be written as:

x = t1[2, -1, 1] + t2[0, -1, 1]

Here t1 and t2 are arbitrary constants.

Learn more about homogeneous system visit: brainly.com/question/30465708

#SPJ4

Correct Question:

Find the complete solution x= Xp + xn of the system Ax = b, A= b where 3 7 6 -3 11 2 4 0 -6 Xp stands for a particular solution and Xn the general solution of the associated homogeneous system. {1 2 3 3 10 2 2 -2 2 2 . }

Syrinus and Natalia were filling their rectangular garden with dirt. The area of the garden is 30 feet. If the length of the garden is 6 feet, what is the width?​

Answers

Answer:

The answer is 5ft

Step-by-step explanation:

A=L×B

A=L×W

30=6×W

30=6W

divide both sides by 6

W=5ft

What is the area? Round to the nearest tenth if necessary.

Answers

Answer:

Set your calculator to degree mode.

Draw a line from point O to a vertex of this octagon to form a right triangle.

tan(67.5°) = 17/x, so x = 17/tan(67.5°)

Area = (1/2)(34/tan(67.5°))(8)(17) = 957.7

[tex]\underset{ \textit{angle in degrees} }{\textit{area of a regular polygon}}\\\\ A=na^2\cdot \tan\left( \frac{180}{n} \right) ~~ \begin{cases} n=sides\\ a=apothem\\[-0.5em] \hrulefill\\ n=8\\ a=17 \end{cases}\implies A=(8)(17)^2\tan\left( \frac{180}{8} \right) \\\\\\ A=2312\tan(22.5^o)\implies A\approx 957.7[/tex]

Make sure your calculator is in Degree mode.

On an average, a metro train completes 4 round trips of 90 kilometres in a day. What is the average distance travelled by the metro?

Answers

On average, the metro train travels a distance of 90 kilometers in a single trip.

Since the metro train completes 4 round trips of 90 kilometres, the total distance traveled in a day would be 4290 = 720 kilometres (since a round trip is equivalent to two journeys of 90 kilometres).

To find the average distance traveled, we need to divide the total distance by the number of trips made. Since 4 round trips have been made, the number of trips made would be 4*2 = 8 (since each round trip is equivalent to 2 trips).

Therefore, the average distance traveled by the metro in a day would be 720/8 = 90 kilometres.

To learn more about distance click on,

https://brainly.com/question/25538217

#SPJ1

Find the matrix A of the rotation about the y -axis through an angle of pi/2, clockwise as viewed from the positive y -axis. A=

Answers

The matrix A of the rotation about the y-axis through an angle of π/2 clockwise as viewed from the positive y-axis is [tex]A=\left[\begin{array}{ccc}0 & 0 & -1 \\0 & 1 & 0 \\1 & 0 & 0\end{array}\right][/tex].

In mathematics, a matrix is a rectangular array or table of numbers, symbols, or expressions, arranged in rows and columns, which is used to represent a mathematical object or a property of such an object.

To find the matrix A of the rotation about the y-axis through an angle of π/2 (90 degrees) clockwise as viewed from the positive y-axis, we can use the following rotation matrix:

[tex]A=\left[\begin{array}{ccc}\cos (\theta) & 0 & -\sin (\theta) \\0 & 1 & 0 \\\sin (\theta) & 0 & \cos (\theta)\end{array}\right][/tex]

Substitute θ with π/2, which is the angle of rotation.

[tex]A=\left[\begin{array}{ccc}\cos \left(\frac{\pi}{2}\right) & 0 & -\sin \left(\frac{\pi}{2}\right) \\0 & 1 & 0 \\\sin \left(\frac{\pi}{2}\right) & 0 & \cos \left(\frac{\pi}{2}\right)\end{array}\right][/tex]

Compute the trigonometric values for cos( π/2) and sin( π/2).

cos( π/2) = 0
sin( π/2) = 1

Substitute the computed values back into the matrix.

[tex]A=\left[\begin{array}{ccc}0 & 0 & -1 \\0 & 1 & 0 \\1 & 0 & 0\end{array}\right][/tex]

Learn more about matrix:

https://brainly.com/question/11989522

#SPJ11

if a student stands 15m away directly west of a tree, what is the tree's bearing from the student?​

Answers

Answer:

90 or 270

Step-by-step explanation:

To determine the bearing of the tree from the student, we need to use the reference direction of North. Typically, bearings are measured in degrees clockwise from North.

If the student stands 15 meters away directly west of the tree, then we can draw a line connecting the student and the tree, which would be a line going directly east to west.

Since we want to find the bearing of the tree from the student, we need to measure the angle between the line connecting the student and the tree and the North direction. Since the line between the student and the tree is going directly east to west, this angle will be either 90 degrees or 270 degrees, depending on which direction we consider as North.

If we consider North to be directly above the student, then the bearing of the tree from the student would be 90 degrees, since the line connecting the student and the tree is perpendicular to the North direction.

If we consider North to be directly below the student, then the bearing of the tree from the student would be 270 degrees, since the line connecting the student and the tree is perpendicular to the South direction (which is opposite to North).

Therefore, depending on the reference direction of North that we choose, the tree's bearing from the student will be either 90 degrees or 270 degrees.

A blueprint for a cottage has a scale of 1:40 one room measures 3.4 m by 4.8 . calculate the dimensions of the room on the blueprint.

​I need students to solve it, with operations

Answers

Answer: its 12.92

first i multiplide 3.4 by 4.8

The term error is used in two different ways in the context of a hypothesis test. First, there is the concept of standard error (i.e. average sampling error), and second, there is the concept of a Type I error.
a. What factor can a researcher control that will reduce the risk of a Type I error?
b. What factor can a researcher control that will reduce the standard error?

Answers

The following parts can be answered by the concept of hypothesis test.

a. To reduce the risk of a Type I error, a researcher can control the significance level or alpha level of their hypothesis test. By setting a lower alpha level (such as 0.01 instead of 0.05), the researcher is decreasing the likelihood of rejecting the null hypothesis when it is actually true.

b. To reduce the standard error, a researcher can increase the sample size of their study. As the sample size increases, the standard error decreases because there is less variability in the sample means. Additionally, ensuring that the sample is representative of the population can also help reduce standard error.

To learn more about hypothesis test here:

brainly.com/question/30588452#

#SPJ11

Think About the Process What is true about a figure and an image created by
a translation? The vertices of parallelogram GRAM are G(-9,-9), R(-8,-6),
A(-4,-6), and M(-5,-9). Graph GRAM and G'R'A'M', its image after a translation
10 units right and 2 units up.
What is true about a figure and an image created by a translation? Select all that apply.
A. Each point in the image has the same x-coordinate as the corresponding point
in the figure.
B. The figure and the image are the same shape.
C. The figure and the image are the same size.
D. Each point in the image moves the same distance and direction from the
figure.

Answers

Step-by-step explanation:

A. Each point in the image has the same x-coordinate as the corresponding point

in the figure.

D. Each point in the image moves the same distance and direction from the

figure.

These two statements are true about a figure and an image created by a translation. When a figure is translated, every point in the figure is moved the same distance and direction. This means that each point in the image has moved the same way as its corresponding point in the figure. Additionally, since a translation only involves moving a figure without changing its shape or size, the image and figure are the same shape and size, but just in different positions. As such, statement B and C are not true for figures and images created by translation.

To graph the image G'R'A'M', we need to add 10 to each x-coordinate and subtract 2 from each y-coordinate:

G': (-9+10, -9-2) = (1,-11)

R': (-8+10, -6-2) = (2,-8)

A': (-4+10, -6-2) = (6,-8)

M': (-5+10, -9-2) = (5,-11)

Graphing these points and connecting them gives us parallelogram G'R'A'M'.

complete the transformations below. then enter the final coordinates of the figure

Answers

The transformations of coordinates of A(2,2) is  A'' = (-1, -1) , B(1, -2) is  B'' = (0, 3) and C (4,-4) is  C'' = (-3, 5).

The coordinates are given in the figure as,

A's coordinates are (2, 2) ;

B's coordinates are (1, -2) ;

and C's coordinates are (4, -4)

The coordinates are to be transformed as A", B" and C'' as,

First invert the number's sign and then to add up 1.

Therefore,

For A" :

At x- axis, +2 becomes -2 and the by adding 1 we get, -1

Similarly at y- axis, +2 becomes -2 and the by adding 1 we get, -1

Thus, A'' = (-1, -1)

For B" :

At x- axis, +1 becomes -1 and the by adding 1 we get, 0

Similarly at y- axis, -2 becomes +2 and the by adding 1 we get, +3

Thus, B'' = (0, 3)

For C" :

At x- axis, +4 becomes -4 and the by adding 1 we get, -3

Similarly at y- axis, -4 becomes +4 and the by adding 1 we get, +5

Thus, C'' = (-3, 5)

To know more about transformations of coordinates here

https://brainly.com/question/16989680

#SPJ1

Answer:A(-1,5) B(0,1) C(-3,-1)

Step-by-step explanation:I had the question

Find the measurement of angle A and round the answer to the nearest tenth. :)
(Show work if you can plsss)

Answers

Answer:

40.82

Step-by-step explanation:

You need to use trig identities, which are sin(θ)=opposite length/hypotenuse length, cos(θ)=adjacent length/hypotenuse length, and tan(θ)=opposite length/adjacent length.

In your diagram, we see that the only available information is the length opposite of the angle x (19) and adjacent to angle x (22), so we will use the tan identity.

tan(x)=19/22

we need to solve for x, and so we need to get x alone. This can be done by using inverse tan: arctan or [tex]tan(x)^{-1}[/tex]. Note that we ARE NOT taking the equation to the exponent of -1, this is just notation for a trig identify.

arctan(x)tan(x)=x

x= arctan(19/22)

arctan(19/22)= 40.82

and so

x=40.82

write three more equations for 1 2/3 that are all true and all different

Answers

One possible set of three equations that are all true and different for 1 2/3 is (5/3) + (1/3) = (8/3), (4/3) + (2/3) = (2), and (10/6) + (1/6) = (11/6).

Each of these equations represents a different way of expressing the same value of 1 2/3, which is equal to 5/3 or 1.6666... when expressed as a decimal.

The first equation shows that adding 1/3 to 5/3 results in a sum of 8/3, which is another way of expressing 1 2/3.The second equation shows that adding 2/3 to 4/3 results in a sum of 2, which is yet another way of expressing 1 2/3.Finally, the third equation shows that adding 1/6 to 10/6 results in a sum of 11/6, which is also equivalent to 1 2/3.

Overall, these equations demonstrate the flexibility and versatility of mathematical expressions and show how different values can be represented in multiple ways through simple operations like addition and division.

To learn more about Mathematical expressions, visit:

https://brainly.com/question/723406

#SPJ11

Write the summation in expanded form.k + 1 i(i!)i = 1 i(i!) + k(k!) + (k + 1)((k + 1)!)i(i!) + + (k + 1)((k + 1)!)1(1!) + 2(2!) + 3(3!) + + (i + 1)((i + 1)!)1(1!) + 2(2!) + 3(3!) + + (k + 1)((k + 1)!)1(1!) + 2(2!) + 3(3!) + + (k)(k!)

Answers

The given summation can be expanded as a series of terms, where each term is the product of two factors: one factor consists of the index variable, i or k+1, and the factorial i! or (k+1)!. The other factor consists of the sum of the first i or k terms of the corresponding factorial sequence, i.e., 1(1!), 2(2!), 3(3!), and so on.

Because i in the first term runs from 1 to k, the total is made up of the first k terms of the i! sequence multiplied by the appropriate value of i. Because k is the sole index variable in the second term, the total is composed of the first k terms of the k! sequence multiplied by each matching value of k.

The following terms have i ranging from k+1 to the summation's ultimate value, and the total is made up of the first i-1 terms of the i! sequence multiplied by each corresponding value of i. The first component, (k+1)!, accounts for the terms not included in the first two terms in the prior summations.

Overall, the summation represents a combination of factorials and their corresponding sum sequences, with the index variables determining the range of terms to include in each sum.

To learn more about summation, visit:

https://brainly.com/question/30931273

#SPJ11

B Find C in degrees. 40° 120° a A 8 C = [?] degrees -С​

Answers

The value of angle C in degrees is 20.0°

What is sum of angle in a triangle?

A triangle is a closed, 2-dimensional shape with 3 sides, 3 angles, and 3 vertices. A triangle is also a polygon. There are different types of triangle, examples are; Scalene triangle, isosceles triangle, equilateral triangle e.t.c

A triangular theorem states that the sum of angle In a triangle is 180°. This means that , if A,B,C are the angle in a triangle, then A+B+C = 180°

This means that ;

40+120+C = 180°

160+C = 180°

collecting like terms

C = 180- 160

C = 20.0°( nearest tenth)

therefore the value of angle C is 20.0°

learn more about sum of angles in triangle from

https://brainly.com/question/22262639

#SPJ1

Mrs. Smith has a bag containing colored counters, as shown below. Bag of Color Counters 2 If a student draws 1 counter out of the bag without looking, what is the probability that the counter will be orange?​

Answers

If a student draws 1 counter out of the bag without looking, then the probability of drawing an orange counter is 0.25 or 25%.

What is probability?

Probability is a measure of the likelihood or chance of an event occurring. It is a number between 0 and 1, where 0 indicates that the event is impossible, and 1 indicates that the event is certain to occur.

Probability is usually expressed as a fraction, decimal, or percentage. For example, if the probability of an event occurring is 0.5, this means there is a 50% chance that the event will occur.

The probability of an event can be calculated by dividing the number of favorable outcomes by the total number of possible outcomes. For example, if a fair six-sided die is rolled, the probability of rolling a 3 is 1/6, because there is one favorable outcome (rolling a 3) out of six possible outcomes (rolling a 1, 2, 3, 4, 5, or 6).

According to the given information

The probability of drawing an orange counter out of the bag can be calculated by dividing the number of orange counters by the total number of counters in the bag.

The total number of counters in the bag is:

6 + 2 + 10 + 6 = 24

The number of orange counters is:

6

Therefore, the probability of drawing an orange counter is:

6/24 = 1/4 = 0.25

So the probability of drawing an orange counter is 0.25 or 25%.

To know more about probability visit:

brainly.com/question/30034780

#SPJ1

Use the Integral Test to determine whether the series is convergent or divergen sigma^infinity_n=1 ne^(-9n) Evaluate the following integral^infinity-1 xe^-9x dx.
Since the integral _______ finite, the series is_______

Answers

To use the Integral Test to determine whether the series is convergent or divergent, we need to evaluate the integral ∫(xe^(-9x) dx) from 1 to ∞.

Let's evaluate the integral first:

∫(xe^(-9x) dx) from 1 to ∞

We use integration by parts for this, where:

u = x, dv = e^(-9x) dx
du = dx, v = -1/9 e^(-9x)

According to the integration by parts formula, ∫u dv = uv - ∫v du.

So, ∫(xe^(-9x) dx) = -1/9 x e^(-9x) - ∫(-1/9 e^(-9x) dx)

Now, we can integrate -1/9 e^(-9x) dx:

∫(-1/9 e^(-9x) dx) = (-1/9) * (-1/9) * e^(-9x) = 1/81 e^(-9x)

Thus, our integral becomes:

-1/9 x e^(-9x) - 1/81 e^(-9x)

Now we must evaluate the integral from 1 to ∞:

lim (x→∞) [ -1/9 x e^(-9x) - 1/81 e^(-9x) ] - [ -1/9 (1) e^(-9) - 1/81 e^(-9) ]

Since the exponential term e^(-9x) approaches 0 as x approaches ∞, the limit becomes:

0 - [ -1/9 e^(-9) - 1/81 e^(-9) ] = 1/9 e^(-9) + 1/81 e^(-9)

Since the integral is finite, the series is convergent.

Visit here to learn more about Integral  : https://brainly.com/question/18125359
#SPJ11

Bus Company A claims that it is typically on time 95% of the time While Bus
Company B has a record of being on time 47 days out of the 50 days that it
operates. Which bus company seems to be doing b

Answers

Therefore, based on the information given, it seems that Bus Company A is doing slightly better in terms of on-time performance.

Which bus company seems to be doing better?

To determine which bus company seems to be doing better, we need to compare their on-time performance.

Bus Company A claims that it is typically on time 95% of the time. This means that out of 100 trips, it expects to be on time for 95 of them.

On the other hand, Bus Company B has a record of being on time 47 days out of the 50 days that it operates. This means that its on-time performance is:

47/50 = 0.94 or 94%

Comparing the two percentages,

we can see that Bus Company A claims to have a higher on-time performance (95%) than Bus Company B's actual on-time performance (94%).  Bus Company B's on-time performance is based on actual data from 50 days of operation.

Therefore, based on the information given, it seems that Bus Company A is doing slightly better in terms of on-time performance.

Learn more about time here:

https://brainly.com/question/28050940

#SPJ1

Complete question:

Bus Company A claims that it is typically on time 95% of the time While Bus

Company B has a record of being on time 47 days out of the 50 days that it

operates. Which bus company seems to be doing better?

a.)find the open interval on which the function H(t)=t^12-6/7t^14 is increasing and decreasing.
b.)identify the functions local and absolute extreme values, if any, saying where they occur.

Answers

Therefore, H(t) is increasing on the intervals (-∞, -1/[tex]\sqrt7[/tex]) and ([tex]1/\sqrt7[/tex], ∞) and decreasing on the interval ([tex]-1/\sqrt7[/tex], [tex]1/\sqrt7[/tex]).and There are no local or absolute maximum values for H(t).

To find the intervals on which the function H(t) is increasing or decreasing, we need to take the first derivative of H(t) and find its critical points.

a.) First derivative of H(t):

[tex]H'(t) = 12t^11 - 84/7t^13[/tex]

[tex]= 12t^11(1 - 7t^2)/7t^2[/tex]

The critical points are where H'(t) = 0 or H'(t) is undefined.

So, setting H'(t) = 0, we get:

[tex]12t^11(1 - 7t^2)/7t^2 = 0[/tex]

[tex]t = 0[/tex] or t = ±([tex]1/\sqrt7[/tex])

H'(t) is undefined at t = 0.

Now, we can use the first derivative test to determine the intervals on which H(t) is increasing or decreasing. We can do this by choosing test points between the critical points and checking whether the derivative is positive or negative at those points.

Test point: -1

[tex]H'(-1) = 12(-1)^11(1 - 7(-1)^2)/7(-1)^2 = -12/7 < 0[/tex]

Test point: (-1/√7)

[tex]H'(-1/\sqrt7) = 12(-1/\sqrt7)^11(1 - 7(-1/\sqrt7)^2)/7(-1/\sqrt7)^2 = 12/7\sqrt7 > 0[/tex]

Test point: (1/√7)

[tex]H'(1/\sqrt7) = 12(1/\sqrt7)^11(1 - 7(1/\sqrt7)^2)/7(1/\sqrt7)^2 = -12/7\sqrt7 < 0[/tex]

Test point: 1

[tex]H'(1) = 12(1)^11(1 - 7(1)^2)/7(1)^2 = 5/7 > 0[/tex]

Therefore, H(t) is increasing on the intervals (-∞, -1/√7) and (1/√7, ∞) and decreasing on the interval (-1/√7, 1/√7).

b.) To find the local and absolute extreme values of H(t), we need to check the critical points and the endpoints of the intervals.

Critical points:

[tex]H(-1/\sqrt7) \approx -0.3497[/tex]

[tex]H(0) = 0[/tex]

[tex]H(1/\sqrt7) \approx-0.3497[/tex]

Endpoints:

H (-∞) = -∞

H (∞) = ∞

Since H (-∞) is negative and H (∞) is positive, there must be a global minimum at some point between -1/√7 and 1/√7. The function is symmetric about the y-axis, so the global minimum occurs at t = 0, which is also a local minimum. Therefore, the absolute minimum of H(t) is 0, which occurs at t = 0.

There are no local or absolute maximum values for H(t).

To know more about derivative visit:

https://brainly.com/question/23847661

#SPJ1

Find the general solution of the differential equation. y (5) - 7y (4) + 13y" - 7y" +12y = 0. NOTE: Use C1, C2, C3, C4, and c5 for the arbitrary constants. C5 y(t) =

Answers

The general solution of the differential equation will be in the form: y(t) =[tex]C1 * e^(r1 * t) + C2 * e^(r2 * t) + C3 * e^(r3 * t) + C4 * e^(r4 * t) + C5 * e^(r5 * t),[/tex] where C1, C2, C3, C4, and C5 are arbitrary constants.

To find the general solution of the differential equation, we first need to find the characteristic equation by assuming a solution of the form y(t) = e^(rt). Plugging this into the differential equation, we get:

[tex]r^5 - 7r^4 + 13r^3 - 7r^2 + 12r = 0[/tex]

Factoring out an r term, we can simplify this to:

[tex]r(r^4 - 7r^3 + 13r^2 - 7r + 12) = 0[/tex]

We can solve for the roots of the polynomial using either factoring or the quadratic formula, but it turns out that there is only one real root, r = 1, with a multiplicity of 3, and two complex conjugate roots, r = 1 ± i. Therefore, the general solution is:

[tex]y(t) = C1 e^t + (C2 + C3 t + C4 t^2) e^(1+i)t + (C2 - C3 t + C4 t^2) e^(1-i)t + C5[/tex]

where C1, C2, C3, C4, and C5 are arbitrary constants to be determined by initial or boundary conditions. The last term, C5, represents the general solution to the homogeneous differential equation, since it contains no terms involving the roots of the characteristic equation.
To find the general solution of the given differential equation y(5) - 7y(4) + 13y'' - 7y' + 12y = 0, we first need to find the characteristic equation. The characteristic equation for this differential equation is:

[tex]r^5 - 7r^4 + 13r^3 - 7r^2 + 12r = 0.[/tex]
Now, we need to find the roots of this equation. Let's denote them as r1, r2, r3, r4, and r5.



To learn more about equation visit;

brainly.com/question/29657983

#SPJ11

In a certain year, there were 80 days with measurable snowfall in Denver, and 63 days with measurable snowfall in Chicago. A meteorologist computes (80+1)/(365+2)=0.22,(63+1)/(365+2)=0.17,(80+1)/(365+2)=0.22,(63+1)/(365+2)=0.17, and proposes to compute a 95% confidence interval for the difference between the proportions of snowy days in the two cities as follows: 0.22−0.17±1.96(0.22)(0.78)367+(0.17)(0.83)3670.22−0.17±1.96367(0.22)(0.78)​+367(0.17)(0.83)​
​ Is this a valid confidence interval? Explain.

Answers

Yes, this is a valid confidence interval calculation for comparing the proportions of snowy days in Denver and Chicago.

The meteorologist is using a standard method for constructing a 95% confidence interval for the difference between two proportions. The formula applied is: (p1 - p2) ± z * sqrt[(p1(1-p1)/n1) + (p2(1-p2)/n2)], where p1 and p2 are the proportions of snowy days in Denver and Chicago, respectively, n1 and n2 are the total number of days considered for each city, and z is the z-score corresponding to the desired level of confidence (1.96 for 95% confidence).In this case, p1 = 0.22, p2 = 0.17, n1 = n2 = 367 (365 days in a year plus 2 to account for the added 1 to both numerators). Plugging these values into the formula, the meteorologist computes the confidence interval as: 0.22 - 0.17 ± 1.96 * sqrt[(0.22 * 0.78 / 367) + (0.17 * 0.83 / 367)].This method assumes the samples are large enough and the proportions can be approximated by a normal distribution, which is reasonable given the sample sizes. The confidence interval provides an estimate of the range in which the true difference between the proportions of snowy days in the two cities lies, with 95% confidence.

For more such question on confidence interval

https://brainly.com/question/29392393

#SPJ11

Other Questions
2 Aggregate production strategies are part of your _______________ planning.a. Long rangeb. Short rangec. Intermediate range Mammals have fur, they suckle their young and the young develop inside the mother. is it True or False decribe teh mechansims resonpitble for con-a induced hemagglucnation reaction answer fast pls Translate these descriptions into a numerical expression:Find the sum of 2 and 4, then multiply by 7.Divide 12 by 3, then multiply by 5 In the first stage of photosynthesis, light energy is converted into chemical energy and reducing equivalents (NADPH + H+). This phenomenon is called A) energy transduction B) decay c) radiation D) kinetic energy E) potential energy 16.5 ft tall giraffe casts a 12-ft. shadow. at the same time a zookeeper casts a 4-ft shadow how tall in feet is the zookeeper how many grams of na2co3 (fm 105.99) should be mixed with 5.00 g of nahco3 (fm 84.01) to produce 100 ml of buffer with ph 10.00? After plotting the voltage waveform, obtain a 0.2-mp expressions and generate plots for (t), p (t), and w (t) for i by capacitor. The voltage waveforms are given:(a) v_1(t) = 5r(t) - 5r(t 2) V (b) v_2(t) = 10u(-t) + 10u(t) - 5r(t-2) + 5r(t-4) V (c) v_3(t) = 15u(-t) + 15e^(-0.5t) u(t) V (d) v_4(t) = 150[1 - e^(-0.5t)] u(t) V angles of a triangle Are dichotomous keys purely a human invention? Explain. in galatians, paul uses ___________ as an example of one justified by faith. It is recommended to interview the HIS users to identify vital information to daily operation in contingency planning True False Which network topology is the most reliable and why?OA. Ring topology, because data flows in one direction from node tonode around the ringB. Star topology, because the server manages all network traffic inone location, making it convenientC. Bus topology, because on large networks it is easy to fix if a cablefails and all nodes lose connectionD. Fully connected mesh topology, because it provides a connectionfrom each node to every other node in the network A rule that CANNOT be violated by database users is called a:(A) password.(B) program.(C) constraint.(D) view. Which of the following variables of an asteroid collision affects the impact crater they leave behind?O SizeO SpeedO MassO All of the above 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? Question 1. You want to clone a human DNA sequence into a plasmid. This DNA fragment was cut out of the human genome with restriction enzyme Sunl, whose restriction site is shown in the figure below. Sunl restriction site CGTACG GCATGC Plasmid cloning region AGGATCCCGAGTGTACACGTGGTACCAGAATTCCTTGGTACCTTTAAAACA TCCTAGGGCTCACATGTGCACCATGGTCTTAAGGAACCATGGAAATTTTGT BamHI Kpl EcoRI Asp7181 Dral Aau This figure also shows the multiple cloning region of your plasmid, with the potential restriction sites marked. A. Which of these restriction enzymes could be used to cleave the plasmid for successful insertion of this human DNA fragment? Note that there could be more than one correct answer B. Briefly explain how you would go about cloning the fragment into the plasmid. C. You successfully clone the human DNA into the plasmid, and store it in the freezer. Several months later, your advisor asks you to use this recombinant plasmid to prepare a large quantity of the human insert sequence with as little plasmid sequence as possible. Can you do this with restriction enzymes? What enzymes would you choose? You are spinning two identical balls attached to strings in uniform circular motion, Ball 2 has a string that is twice as long as the string with ball 1, and the rotational speed (v) of ball 2 is three times the rotational speed of ball 1. What is the ratio of the centripetal force of ball 2 to that of ball 1? Select all of the ratios that are equivalent to 1:5. What starting alkyl halide and ketone would give 2-methyl-2-pentanol? Write a grignard synthesis for this reaction. Please help!!!There is a photo! Pleasee help!!