Highlight all the atoms of the four functional groups, but do not highlight any bonds. When you click on each atom, it will change color. To deselect an atom, click on it again. Before you submit, check that you have not selected any bonds.

Answers

Answer 1

Hi. You did not submit any image, table or description of a molecule for the functional groups to be pointed out. This makes it impossible for your question to be answered. However, I will try to help you as best I can.

A functional group is a set of atoms of different chemical elements that take the place of a hydrogen atom that was part of a hydrocarbon (it is a molecule composed of carbon and hydrogen atoms). The most common functional group is −OH, but you also often encounter −SH, −NH2, and −OPO2−3 functional groups.

-


Related Questions

What is the source of the carbon dioxide that is used in photosynthesis?

Answers

Answer:

Photosynthetic cells

Explanation:

photosynthetic cells are diverse and are found in green plants during the process of photosynthesis cells use carbon dioxide and energy from the sun to make sugar molecules and make oxygen

mango tree and Vanda ecological interaction​

Answers

Answer:

The relation between a mango tree and an orchid is commensalism. An orchid growing on the branch of a mango tree is an epiphyte. Epiphytes are plants growing on other plants which, however, do not derive nutrition from them.

hope it helps


Which correctly describes the projected growth of the world's population in
the future?
A. The rate of growth will remain the same.
B. It will not grow much higher than it is now.
C. The population will eventually begin declining.
D. The rate of growth will slow down by 2100.

Answers

Answer:

D the rate of growth will slow down by 2100

Explanation:

Sorry if it’s wrong

World's population growth rate will slow down by 2100 in future.

What is world's  population growth ?The rise in the number of people in a population or dispersed group is known as population growth. Global population growth is roughly 83 million people per year, or 1.1 percent per year. From 1 billion in 1800 to 7.9 billion in 2020, the world's population has increased dramatically.

What will be the world's population growth rate in future?The world's population is expected to reach 10.9 billion by 2100 in future, with yearly growth of less than 0.1 percent – a significant decrease from present rates. Between 1950 and today, the world's population increased by 1% to 2% per year, going from 2.5 billion to more than 7.7 billion people.

Hence, the correct option is D.

To know more about population growth here,

https://brainly.com/question/17487289

#SPJ2

pls help ASAP i will mark brainliest

Answers

Answer:

ok

i can help you ..............

Explanation:

drop in the air pressure objects small mammals and insects in many ways mice and mouse are good weather indicators people who spend a lot of time outdoor have obeserved that field mice come out there holes squeak and run around before a storms appearce.

PLEASE HELP WILL MARK BRANLIEST!
Fungi and bacteria are examples of _____:

A. decomposers, B. producers, C. consumers, D. demagorgans

Answers

Answer:

a. decomposers

Explanation:

Bacteria and fungi are best classified as decomposers. They decompose the bodies of dead plants and animals.

What molecule forms a double helix structure composed of two complimentary strands of nucleotides?

Answers

DNA! the question is a typical descrption of it


Why do potato plants no longer need to use glucose from starch in respiration once they have grown above ground?

Answers

They no longer need the respiration to grow

two types of global food webs show the feeding relationships of organsms. What distinguishes one type of global web from the other?
A whether the producers are located on land or in water
B whether or not the food web includes tertiary consumers
C whether the web includes animals that migrate during the year
D whether the ecosystem described by the web is localized or very broad

Answers

Answer:

A. wheter the producers are located on land or in the water.

the tRNA for GUCAUCGAUCGAUCGGAUGCC

Answers

Answer:

CAGUAGCUGCUAGCCUACGG

Explanation:

A and U are opposites

C and G are opposites

so you would do the opposite that would correspond.

Describe the processes involved in photosynthesis

Answers

Explanation:

During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. ... Then, via respiration processes, cells use oxygen and glucose to synthesize energy-rich carrier molecules, such as ATP, and carbon dioxide is produced as a waste product.

Answer:

During the process of photosynthesis, cells use carbon dioxide and energy from the Sun to make sugar molecules and oxygen. Then, via respiration processes, cells use oxygen and glucose to synthesize energy-rich carrier molecules, such as ATP, and carbon dioxide is produced as a waste product.

What is the function of the class of macromolecules represented in the following diagram

Answers

Answer:

lods ayarn na:)

Explanation:

The four classes of biological macromolecules are (1) Proteins, (2) Lipids, (3) Carbohydrates, (4) Nucleic Acids.

Proteins are made up of amino acids linked by peptide bonds. They have multiple functions, depending on the number of amino acids and its specific sequence. They serve as major workers composing motor and structural elements in the cell. They can also function as catalytic proteins (enzymes), as well as helpers for storage, signal, transport, reception, defensive, and contractile tasks.

Lipids are made up of fatty acids (a carboxylic acid with a hydrocarbon chain + terminal carboxyl group) and glycerols (organic compound made up of multiple hydroxyl groups). They are a hydrophobic compound that are used for energy storage, thermal insulation, protection, and chemical messengers. Lipids also regulate membrane permeability and aid in fat soluble vitamin production.

Carbohydrates are made up of monosaccharides which build up a polysaccharide (carbohydrates). Monosaccharides are basic sugars which cannot be broken down anymore by water (glucose, fructose, galactose). Carbohydrates' major functions include energy provision, blood glucose regulation, biological processes recognition, and breakdown of fatty acids for ketosis prevention.

Nucleic acids are made up of nucleotides which are organic molecules that forms the Deoxyribonucleic acid (DNA) and Ribonucleic acid (RNA). Their structure consists of a nitrogenous base, pentose, and an attached phosphate group. The function of nucleic acids are the creation and storage of genetic information.

natural selection selects ___________ less fit individuals .
natural selection selects ____________ viable individuals .

Answers

Answer:

viable

Explanation:

Only the animals who are able to survive will live long enough to reproduce

Question # 1: Which shape is CLOSEST to the truth for the shape of planet 1 point
Earth?
1. Which object best represents a true scale model
of the shape of Earth? (1) a table tennis ball
(2) a football (3) an egg (4) a pear
Option 1
Option 2
Option 3
Option 4

Answers

Answer:

(1) a table tennis ball

Explanation:

The earth will most closely resemble any type of sphere or circular ball.

Meiosis makes sperm and egg cells which are called

A. Gametes

B. Somatics

C. Spindles

Answers

Answer:

A. Gametes

hope it is helpful to you ☺️

the answer is gametes

Please help me with please

Answers

no so do it yourself and get smart

Question 2 of 10
What is the term for the condition of the atmosphere in a given area at a
given time?
A Weather
B. Latitude

C Climate
D. Altitude
SUBMIT
Need ASAP

Answers

A is the answer to this

Answer:

A .Weather

Explanation:

The state of atmosphere over an area at any point of time is known as weather. It is the state of the atmosphere over short periods of time. ... Precipitation, humidity, temperature, pressure, cloudiness, and wind are the basic atmospheric conditions that make up the weather of a region.

hiii! ill give brainliest if u answer this :))

Why are enzymes important?

1. They contain the genetic material.

2. They speed up chemical reactions.

3. They bring water into the cell.

4. They help the cell maintain its shape.

Answers

They speed up chemical reactions

Starch is a polysaccharide used as a component of cell walls in plants.


True

False

Answers

Answer:

false

Explanation:

is type of carbohydrates

False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.

What are structural component of cell wall?

Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.

Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.

Learn more about cell wall, here:

https://brainly.com/question/965751

#SPJ2

I’m 98% sure it’s c but it might be B could someone check pls

Answers

Answer:

I think C

Have a great day

[tex]#Liliflim✌[/tex]

Answer:

Explanation:

A

What could be inferred from suntans?

Group of answer choices

A tan might indicate sun damage to the skin.

Tanning produces healthier skin.

A tan strengthens the elastic in the skin.

Tanning makes skin look younger.

Answers

Answer:

A tan might indicate sun damage to the skin.

Explanation:

Tanning is the process by which the skin is exposed to the ultraviolet rays that comes from the sun with the purpose of producing a dark-brown coloration called a TAN.

A tan achieved by exposure to the sun can actually indicate that a person's skin is undergoing damage from the UV rays of the sun, hence, the skin responds by producing a protein called melanin, which protects the skin and later forms the dark coloration- tan. From this explanation, tan is got in response to a damaging signal received by the cell, hence, a tan might indicate sun damage to the skin.



What is the
Magnification
of a plant cell?

Answers

Answer:

400x

Explanation:

Which type of weather is associated with the eye of the hurricane?

calm

stormy

windy weather

Answers

Answer:

A windy weather

Explanation:

Tree will began to swayed


Which of the substances below are PRODUCTS of the overall chemical reaction of
photosynthesis?
A. ammonia
B. Unitrogen
C. carbon dioxide
D. water
oxygen
sugars

Answers

Answer:

essentially glucose and oxygen are the products of photosynthesis

Explanation:

Macroscopic urinalysis collects data on all EXCEPT which of the following?
A. turbidity
B. color
C. pH
D. odor

Answers

Answer:

The correct answer is - pH.

Explanation:

Macroscopic urinalysis is the evaluation of the physical appearance of the urine. It evaluates the amount, color, odor and clarity, and other physical appearances or characteristics.

It also checks if there are any clotting, or sediments are found in the sample. It does not include the pH of the urine in the microscopic urinalysis. It is recommended to check underlying medical conditions.

Because conservation means using fewer natural resources and reducing wastes, it helps
a.
slow overpopulation and grow food.
b.
prevent habitat destruction and reduce pollution.
c.
prevent biodiversity and destroy species.
d.
stop exotic species and create habitats.


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

a

Explanation:

just did it

Answer:

the answer should be "B"

which two molecule do green plants use to make glucose

Answers

Answer:

Carbon Dioxide and Water

Many functions in the body are controlled by
special compounds. Which statements about
these compounds do you think are true? Check
all that apply.
The body can make all of the compounds it
needs.
.
The body gets energy from some
compounds.
um
Some compounds determine physical
characteristics.

Answers

Answer:

Its either a or b

Explanation:

A say the body can make all of the compound its need

my suggestion compound are made up of water ,mineral protein carbs and fat

our body produce little nutrients so we need to eat to get the nutrients we need

im am going with b

B is the answer

There are 20 different types of amino acids, which can result in a wide variety of protein shapes. Which of the following is not a function associated with proteins?
A. providing structure
B. speeding up chemical reactions as enzymes
C. information storage
D. all of these are functions of proteins​

Answers

Answer:

c information storage

Explanation:

information is stored in dna which provides the instructions required to make proteins . proteins do not store information

species I
species II
species III
species IV

Answers

Answer: It’s species II because it matches the unknown

What two taxon make up the scientific name? Pick all that apply.
Kingdom
Phylum
Class
Order
Genus
Family
Species

Answers

Answer:

genus and species are combined to form a scientific name

Answer:

GenusSpecies

Explanation:

The word is genus and species. These two taxon make up the scientific name.

Other Questions
write a story which includes a sentence it was easy to see why everyone wanted to meet him Find the value of x that will make line u parallel to line v. Show all of your work Baum, like Rakove, argues that the Framers a. Were unconcerned about the Supreme Court's functions and saw no real role for it.b. Intended the Supreme Court to rule only on the constitutionality of federal laws.c. Never intended for the Supreme Court to rule on the constitutionality of legislation.d. Probably always understood that the Supreme Court would rule on constitutionality.\ What is the perimeter of this rectangle? 13.How did Reconstruction end? How did the Election of 1876, Jim Crow laws, and the Plessey v? Ferguson case impact the end of Reconstruction. In a biscuit tin, there are 10 chocolate and 4 shortbread biscuits. What proportion are, a) Chocolate ? need help? will get brainlylist List down (five) 5 daily activities that use water. Opposite of it, write a sentence showing how water isconserved in each activity. A small country had a population of 7.1 x 10 in 1990. Since then, the original population has doubled, and an additional 7.7 x 1010 people have immigrated into the country. What is the population of the country now? The population is A x 10 where Monetary policy Select one: a. cannot be implemented quickly and most of its impact on aggregate demand occurs months after policy is implemented. b. can be implemented quickly and most of its impact on aggregate demand occurs very soon after policy is implemented. c. can be implemented quickly, but most of its impact on aggregate demand occurs months after policy is implemented. d. cannot be implemented quickly, but once implemented most of its impact on aggregate demand occurs very soon afterward. Directions: Answer each question briefly. Write your answer on a separate sheet of paper.1. Among the three kinds of texture, which do you love to listen to? Why?2. When is the texture of music considered thick and when is it thin? Robert has 3.38 pounds of cat food he uses 0.26 of cat food to feed one cat how many cats can Robert feed with the cat food he has Determine the distance between points (x1, y1) and point (x2, y2), and assign the result to point Distance. The calculation is: if f(x)=x+2 and g(x)=3x^2+7x find (f x g)(x) Determine the value for x in the picture below. Find the lateral surface area of the cylinder. Round your answer to the nearest tenth. Like many multicellular organisms, plants have organs that perform specificfunctions. Which of the following correctly pairs a plant organ with its function?A Plant leaves capture nutrients from rain.B Plant roots absorb water needed for photosynthesis.C Plant stems store carbon dioxide for cellular respiration.D Plant flowers provide the energy needed for eggs to develop. What is the area of this cube 6 4 5 GELPPPPPP(1) Distributive property(2) Associative property(3) Addition property of equality(4) Division property of equality Question and choices are in the photo please explain the answer