. A protease is added to a suspension of egg protein in a test-tube and kept at 37°C. After 8 minutes, the protein changes from cloudy to transparent. Which product, or products, will now be present in the test-tube
Answer:
amino acids
Explanation:
A protease is an enzyme capable of catalyzing the breakdown of proteins into polypeptide fragments and single amino acids, which are the building block of proteins. Proteases act by breaking peptide bonds by a process called hydrolysis, a reaction where water molecules break down peptide bonds (hydro means water and lysis means split). Proteases can be classified depending on the catalytic residue into cysteine, serine, threonine, aspartic, glutamic and metalloproteases.
The product that will be present in the test tube will be amino acids.
Protease is an enzyme that acts on protein by converting it into different
types of amino acids.
Amino acids are referred to as the building block of life and are important
nutrients in growth and replacement of worn-out tissues. The protease acts
on the protein by breaking the peptide bonds under the required
temperature.
An inadequate temperature may result in the denaturing of the enzyme
which was why the test was done at 37°C. This is the body temperature of
humans which led to the formation of amino acids which is absorbed by cells
of the body.
Read more on https://brainly.com/question/20299415
What is a society that is able to survive and function over a specified time?
Answer:because time and society are different
Explanation:
Which is NOT a function of lipids?
1.Absorption of Vitamins
2.Genetic Storage
3.Insulation/Cushioning
4.Energy
Lipids don't store genetic informations so the answer is 2
they absorb liposoluble vitamins they offer insulation/cushioning they store energy
What’s the corresponding mRNA strand for this DNA strand: TACGGGATAAGGCCACCTCTGGTAGACCACATT
Thymine(T) pairs with adenine(A)
Adenine(A) pairs with uracil(U)
Cytosine(C) pairs with guanine(G)
therefore the corresponding mRNA strand for TACGGGATAAGGCCACCTCTGGTAGACCACATT
is
AUGCCCUAUUCCGGUGGAGACCAUCUGGUGUAA
What do you think might be causing these changes in cells?
a
A problem with the enzymes needed for protein synthesis.
b
A mutation in the DNA.
c
A problem with transcription, or the making of mRNA.
d
A problem with the ribosomes used in translation.
Answer:
I require more Information on the changes these cells are undergoing
A molecule is a unit of energy
True or False
Answer:
true
Explanation:
Molecules are both vehicles for storing and transporting energy, and the means of converting it from one form to another when the formation, breaking, or rearrangement of the chemical bonds within them is accompanied by the uptake or release of heat.
Answer:
true
Explanation: Molecules are two or more atoms held together By chemical bonds.
ASAP Here is a nitrogen base sequence for a piece of one of the strands of a DNA molecule: ATTCGCGAT.
What would be the base sequence of the other complementary strand at this part of the DNA molecule?
Answer:
TAAGCGCTA
Explanation:
The music and pictures connected with a story can also show blas.
A
True
B.
False
Answer:
A
Explanation:
I took the question in a online quiz
Think about the variety of biomes on Earth and differences in their weather patterns. Which list shows environments from highest
average temperature to be lowest average temperature?
A) swamp, mountain, desert
B) swamp, desert, mountain
C) desert, swamp, mountain
D) mountain, desert, mounatin
Answer:
C
Explanation:
hope this helps
The list of biomes that shows environments from the highest average temperature to the lowest average temperature is desert, swamp, and mountain. Therefore, option C is correct.
What are biomes?Since they belong to certain areas or zones that, due to their geographical characteristics, share a climate, vegetation, and wildlife, biomes provide the primary support for the harmony of nature.
Any biome can include a wide range of habitats because the term "biome" is more general than "habitat." An area's climate and geography determine the biome classification. Communities that have adapted to the unique climate and ecology of the biome make up each one. Depending on the surroundings, they come in a variety of forms. The temperate deciduous biome is the ideal environment for human habitation.
The list of biomes that shows environments from the highest average temperature to the lowest average temperature is desert, swamp, and mountain. Therefore, option C is correct.
Learn more about biomes, here:
https://brainly.com/question/18601179
#SPJ6
Mr. Szarka tries to sprint a marathon and comes up very short. Explain why foolhardy Mr. Szarka could not complete the marathon and what would happen to his energy systems once he rested and caught his breath. What processes would be restricted during this sprint attempt, and how would they be regulated?
Answer: It’s not in shape like it’s cut out
Explanation:
Answer:
he could not complete it cut he out of shape
what type of species is a key element in keeping the ecosystem in balance
Answer:
predators keep the population of mice under control, insects pollinate flowers, and worms decompose leaf litter. All species are important and help keep the ecosystem balanced.
Explanation:
Answer:
keystone species
Explanation:
If an organism has 30 chromosomes in its body cells, how many chromosomes would it have in its sex cells (gametes)?
Answer:
15
Explanation:
Gametes have half the amount of dipliod somatic ells
What are the answers here? Select all that apply.
Answer:
the first, second, fourth, and fifth
28) 6CO2 + 6H20 + (energy) → C6H12O6 + 602
Where does the energy come from in the reactants side of the chemical equation?
Plz help I have 10 mins left
Answer:The energy change in a chemical reaction is due to the difference in the amounts of stored chemical energy between the products and the reactants. This stored chemical energy, or heat content, of the system is known as its enthalpy.
Explanation:
Answer: The energy in this reaction (photosynthesis) comes from light.
Sorry about cutting it close, hope this helps.
25. Which of these does natural selection work on?
a. Only animals
b. All populations
c. Only microscopic organism
d. Individuals
e. Only small
PLEASE HELP
the question is in the pic
Which of the following equations are balanced?
2Fe + Cu(NO 3) 2 → 2Cu + Fe(NO 3) 2
2K + 2H 2O → H 2 + 2KOH
Li + Cl 2 → LiCl
2H 2 + O 2 → 2H 2O
2S + 3O 2 → 2SO 3
Answer:
the second, fourth and fifth ones are balanced.
HELP! I NEED IT SOON! ILL GIVE BRAINLIEST
Answer: A: People with different goals can make contributions to scientific knowledge.
Schwann and Virchow both had different goals for what they were trying to discover, but both ended up adding to the same theory.
Hope this helps :)
A wetland that contains a mixture of fresh water and salt water is called
an estuary
a stream
a river.
a pond
Answer:
an estuary
Explanation:
A wetland which contains a mixture of fresh water and salt water is called as an estuary. Thus, the correct option is A.
What is an estuary?An estuary is an example of a partially enclosed, coastal water body where the freshwater from rivers and streams mixes up with the salt water from the ocean bodies. Estuaries, and their surrounding lands, are the places of transition from the land area to the sea area.
Estuaries and their surrounding wetlands are the bodies of water which are usually found where the rivers meet the sea. Estuaries are the home to many of the unique plant and animal communities which have adapted to the brackish water, which is a mixture of fresh water draining from the land and the salty seawater.
Therefore, the correct option is A.
Learn more about Estuary here:
https://brainly.com/question/17564221
#SPJ6
Summarize the possible applications of gene knockout GMOs.
Answer:
This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.
Explanation:
This method involves creating a DNA construct containing the desired mutation. For knockout purposes, this typically involves a drug resistance marker in place of the desired knockout gene. ... This method then relies on the cell's own repair mechanisms to recombine the DNA construct into the existing DNA.
How does geotheHow does geothermal energy differ from solar energy?
Geothermal energy is cooler and denser than solar energy.
Geothermal energy comes from the internal heat of Earth.
Geothermal energy is transmitted through the atmosphere.
Geothermal energy results from radiation of electromagnetic waves.rmal energy differ from solar energy?
Answer: B || Geothermal energy comes from the internal heat of Earth.
Explanation:
hope it helped xx :))
help?????????????trdgdgdrd
Answer:
B
Explanation:
its facing more to the east
Multiply (2x + 5)(3x - 4).
Answer:
6 [tex]x^{2}[/tex] + 7 x − 20
What cellular function is negatively impacted by an increase in cell size?
Answer: c
Explanation:
Help me please!!! N thanksss!
Answer:
c
Explanation:
I ..........
Answer:
seismic waves caused earthquakes and caused the plates to shift
Explanation:
What reactant is needed in the light dependent reaction
Answer:
ATP and NADPH
Explanation:
they use it to reduce carbon dioxide and convert the energy into chemical bond energy in carbohydrates such as glucose
Red blood cells are classifed as type A or type B, based on their surface antigens. Type O
blood does not contain any antigens. The chart below shows the possible phenotypes of
each blood type.
Blood Types
Blood Type Phenotype Alleles
B:
AB
B
AB
Which mechanism explains how both A and B antigens produce type AB blood?
Answer:
codominance
Explanation:
The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles are expressed equally in the phenotype, which means that both the A and B antigens are present on the surface of the red blood cells in type AB blood.
what is antigen?The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles in a heterozygous individual are fully expressed in the phenotype. Therefore, in the case of blood type AB, the A and B alleles are codominant, and both antigens are expressed on the surface of the red blood cells.
Hence, The mechanism that explains how both A and B antigens produce type AB blood is codominance. In codominance, both alleles are expressed equally in the phenotype, which means that both the A and B antigens are present on the surface of the red blood cells in type AB blood.
Learn more about the antigen here
https://brainly.com/question/30587809
#SPJ2
What is the average speed of a soccer ball that travels 34 m in 2s?
Answer:
17 m/s
Explanation:
s=d/t
s=34m/2s
Answer:
34/2 = 17 m/s
Explanation:
Distance Covered: s = 34 m
Time in which distance covered: t = 2 s
----
Average Speed: v = Distance Covered/time taken = s/t
v = 34/2
v = 17 m/s
I hope this helps explain things a little better.
Explain why Hurricane Harvey traveled from the east (Africa) towards the west (Florida) when our weather in Wisconsin starts in the west and travels east?
PLEASE HELP!
Answer:
Due presence of Sahara desert that is responsible for the formation of this hurricane and its movement towards Florida.
Explanation:
Hurricane Harvey traveled from the Africa towards the Florida because these hurricane formed at the African region due to the presence of Sahara desert. The hot and dry wind of Sahara desert meets with the cool, moist air from the south produces these hurricane which then moves from the Africa to the west side where Florida is located so that's why Hurricane Harvey traveled from Africa towards the Florida.
please help meee i don’t get this :(
Answer I think the answer went to RNA