How do I turn (7, -1) and (21, -5) into slope intercept form

Answers

Answer 1
The answer is y = -2/7x + 1


I think the easiest way to do this is through point slope form, but first you’ll need to find your slope.

To make it easier first you want to label your points x1, y1, x2, y2
7 is x1
-1 is y1
21 is x2
-5 is y2
the formula to find the slope is
y2-y1
m= ———
x2-x1
then you’re going to plug in all the numbers
it should look like this
-5 + 1
m= ———
21-7
hint: two negative makes a positive that’s how it ended up being plus 1

then do you math.
you should end up with -4/14
which simplifies to -2/7

NOW you need to find the “b” by doing point slope
formula: y-y1 = m(x - x1)
you’re only plugging things in for y1, m, and x1.
so you’re equations should look like this
y + 1 = -2/7(x - 7)

REMEMBER( two negatives make a positive.. that’s why it’s + 1 and not -1)

Distribute -2/7
y+1 = -2/7x + 2

Subtract 1 from 2
y = -2/7x + 1

Andd done.

Related Questions

Cereal is on sale this week. Is it a better buy to get the 10-ounce box for $1.86 or the 14-ounce box for $2.61?

A. 10-oz. box
B. 14-oz. box

Answers

Answer:

b 14oz .box

Step-by-step explanation:

10 oz cost 1.86

1 oz is .19 cents

14 oz cost 2.61

1 oz is .19 cents

so the for one oz is .19 cents for both of them

so chose 14 oz for 2.61 because it gives you more cereal for the same price per oz

PLEASE HELP ME FIND THE CORRECT ANSWERS FOR QUESTIONS 2 AND 3!!!
I WILL MARK BRAINLIEST!!

Answers

Answer:

top one is a

Step-by-step explanation:

bottom is d

On many cell phones with GPS, an approximate location can be given before the GPS signal is received. This is done by a process called triangulation, which works by using the distance from two known points. Suppose there are two cell phone towers within range of you, located 6000 feet apart along a straight highway that runs east to west, and you know you are north of the highway. Based on the signal delay, it can be determined you are 5050 feet from the first tower, and 2420 feet from the second. Determine the angle, , between your line of sight to the first tower and the highway to the nearest tenth of a degree. (A calculator is needed for this question)

Answers

Answer:

it is A?? I'm not sure but Stan nct.....

consider the equation 36+ =6(6+5)

Answers

Answer:

36+30 = 6(6+5)

Step-by-step explanation:

We just simply expand the brackets:

6×6=36

6×5=30

30+36=76

so 76-36=30

So the missing number was 30

SOMEONE HELP ME PLEASE AND THANK YOU!!!!! :D :"(

Answers

Answer:

what are the drop down words.

Add 1/6 +3/4 + 2/3. Simplify the answer and write it as a mixed number, if possible.

Answers

Answer:

1 7/12

Step-by-step explanation:

Answer:

1 7/12

Step-by-step explanation:

Firstly, I'm not a native speaker, nor do we do mathematics in English but I'll explain it as I could possibly

Let all the denominators be 12, so multiplying 1/6 with 2, becomes 2/12

3/4 becomes 9/12 (multiplying with 3)

2/3 becomes 8/12

Adding them you get 19/12,

after you divide 19 by 12, the remaining is 7,

so as in mixed numbers, it's 1 7/12.

PLEASE HELP ME

Jane and Eric are helping their teacher buy supplies for a research project. Every student will get a bag with 2 pencils and 30 index cards.

The teacher gave Jane $17 to buy pencils from the school store. The pencils come in boxes of 12 and cost $1.69 per box.

Eric was given $19 to buy index cards at an office supply store. Index cards are sold in packs of 150 cards and cost $2.99 per pack.

Jane buys as many boxes of pencils as she can afford. Eric buys as many packages of index cards as he can afford. How many complete bags of supplies can they make?

Answers

Answer:

They can make 30 Bags total.

Step-by-step explanation:

Jane has $17. There are 12 pencils in each pack for $1.60.

Jane can bay 10 packs of 12 pencils for $16.9 or else she will go over the amount of money she has.

1.69 x 10 = 16.9

Eric has $19. There are 150 cards in one pack for $2.99.

Eric can bay 6 packs of 150 cards for $17.94 or he ill go over the amount of money he has.

2.99 x 6 = 17.94

Eric.

150^6 = 900

900/30 = 30

Jane.

12^10 = 120

120/2 = 60

60/2 = 30

Together.

30 cards can go into 30 bags, and 2 pencils can go into 30 bags

A carpenter makes $24/hour and works a 40 hour week. The employer withholds $83 federa
tax, $74 FICA, and $41 state tax. The carpenter's take-home pay is

Answers

Answer:

762

Step-by-step explanation:

Since he makes 24 dollars a hour and he worked for a total of 40 hours that'll equal to 960 and when you subtract all the taxes away from his payment it'll equal to 762

The net income of the carpenter will be $762.

What is net income?

The amount paid by any company or industry to the employees after deductions of the several taxes is the net income.

Given that:-

A carpenter makes $24/hour and works a 40 hour week.The deductions are $83 federal tax, $74 FICA, and $41 state tax.

So the net income of the carpenter will be calculated as:-

Gross pay will be =  24   x  40  =  $960

Net income  =  960  -  (  83  +  74  +  41  )  =  $762

Hence the net income of the carpenter will be $762.

To know more about net income follow'

https://brainly.com/question/25623677

#SPJ2

Please help! I will mark Brainliest.
Part A: Write an algebraic expression for 4 more than 3 times a number.

Part B: Write a verbal expression for 2(n + 9).

Answers

Part a: 3x+4

Part b: 2 times the quantity 9 more than n
Part A: 4 > 3x

Part B: two multiplied by a number plus nine.

I need help asap please!!! "Find the measure of Arc AC in the figure below. Explain your answer by showing your steps or explain by writing 2-3 sentences. "

Answers

The angle measure of arc AC at the center of the circle is; 21°

Circle theorems

From the task content;

The angle subtended by the arc at the center of the circle is; (3x +9)°

The angle subtended by the arc on the circumference of the circle is; (3x -1.5)°

It follows that from circle theorems that; The angle subtended by an arc at the center of a circle is twice that which it subtends at the circumference.

Hence;

(3x +9)° = 2(3x -1.5)°

3x +9 = 6x -3

3x = 12

x = 4.

By substituting x= 4 into the expression; (3x +9)°

Hence, the angle subtended at the center of the circle is; 12+9 = 21°.

Read more on arcs;

https://brainly.com/question/25832396

need help with the problem.

a school principal of 790 students needs to determine what percent of students passed and did not pass a state wide examination.Round to the nearest percent.

a. if 570 students pass the exam, what percent passed the test?

B. what percent didn't pass the test?​

Answers

Answer 40% passed

and 50% failed

Step-by-step explanation:

Help me please I beg if you can

Answers

Answer: The mean is 3780

Step-by-step explanation:

Mean is found by adding all values and dividing the sum by how many values were added.

4250+4019+3895+3739+3401+3376=22680
22680/6=3780

What is the measure of QS?

Answers

Check the picture below.

can someone help me with this question, please?

Answers

Answer:

which question?

Step-by-step explanation:

I'm confused on what your trying to solve

What is the volume of this sphere?
Use a 3.14 and round your answer to the nearest hundredth.
10 yd

Answers

[tex]=Solution,\\\\Diameter(d)=10yd\\\\Radius(r)=10yd/2=5yd\\\\Now,\\\\Volume=\frac{4}{3} \pi r^{3} \\\\Volume=\frac{4}{3} *\pi*(5yd)^{3} \\\\Volume=\frac{4}{3}*3.14*125yd^{3} \\\\Volume=523.33yd^{3}[/tex]

Function of the
graph

Answers

It’s a set of ordered pairs

how do you calculate percentile in excel? How many students scored lower than 490?

Mean 540
2.5% Bound 400
97.5% Bound 680
Student's Score 490

Answers

Calculate rank percentile in Excel

To calculate the rank percentile of a list data, you can use a formula. Select a blank cell that you will place the rank percentile at, type this formula =RANK. EQ(B2,$B$2:$B$9,1)/COUNT($B$2:$B$9), press Enter key and drag fill handle down to calculate all rank percentiles.

a sprinter running in the olympics starts at the 0 meter mark and ends at the 400 meter mark. it took him 65 seconds to run this distance what is his velocity?

Answers

Answer:

I am not too sure but I think the answer would be 6

Step-by-step explanation:

Given f(x) = 4x - 6 and g(x) = f(2x), write an equation for g.

Answers

f(x)=4x-6

g(x) = f(2x)

Substitute 2x into the first equation, which you get

f(2x)=8x-6

So, g(x)=8x-6

-
3/1
213
- 3)
-
Simplify the expression
properties of operations used.
Cite the
5

(please help if you can and thank you so much!) hurry

Answers

Answer:

7/10 or 0.7

Step-by-step explanation:

-3/2 (1/3 - 4/5)

(-3/2) (1/3 + -4/5)

(-3/2)(1/3) + (-3/2)(-4/5)

-1/2 + 6/5

7/10

I think this PDF should assist you in the property of operations for fractions and also help you in solving future problems.

Plss help i need it!

Answers

Answer:

A  

Hope this helps!

Step-by-step explanation:

Answer:

A

Step-by-step explanation:

Because a line segment does not have two arrows on the end and it does not have one arrow and it does not have nothing some the correct answer is A

The line L1 is defined Ax + By = 3. The line L2 is defined by the equation Ax + By = 2. The line
L3 is defined by Bx − Ay = 1. Determine whether L1, L2 and L3 are parallel or perpendicular to each other.

Answers

Step-by-step explanation:

Line 1: Ax+By=3

By=-Ax+3

-> slope is -A/B

Line 2: Ax+By=2

By=-Ax+2

-> slope is -A/B

Line 3: Bx-Ay=1

Ay=Bx-1

-> slope is B/A

So lines 1,2 are parallel, and lines 1,3 and 2,3 are perpendicular

HELPPPPPPPPUJJJJ
PLEASEEEEEE

Answers

Answer (Left to right per row):

-1, 2, 4, 6, 6.9, 6.99, 6.999

Step-by-step explanation:

y is anything less than 7

What is correct answer for this question?

Answers

Answer:

0.47 dollars per kilogram and 2.14 kilograms per dollar should be it.

What is the solution to the equation below?
-3 + square root 3x - 11 = 5

Answers

Answer:

25 is correct answer try it

Step-by-step explanation:

Answer:

25 is correct answer try it

squareroot (3x-11)^2=(5+3)^2

3x-11=64

3x=64+11

3x=75

x=25

use data to create a scatter plot 100 points

Answers

Answer:

Look at attached image

Step-by-step explanation:

Graph using (X, Y)

Hope this helps!

PLS MARK BRAINLIEST!!!

The recipe calls for 1/4 cups of cream.
What is the fraction of a pint do u need?

Answers

Answer:

Your answer is 1/8 pint.

Step-by-step explanation:

Since there are two cups for every one pint, this means that 1/4 a cup would equal 1/8 pint.

The figure shows the construction of a line tangent to a circle from a point on the circle. From the diagram, which statement is true?
1. OP ≈ QR
2. P is the midpoint of OR
3. OQ+QP=QP + PR
4. PQ≈ PR

Answers

The required statement that is true for the given circle is PQ = PR. Option D is correct.

What is a circle?

A circle is a closed shape consisting of all points in a plane that are at a constant distance from a single fixed point called the center. The distance between the center and any point on the circle is called the radius, and the distance across the circle, passing through the center, is called the diameter.

Here,
From the figure,
QP = PR,

So P is the midpoint of QR,

Thus, the required statement that is true is PQ = PR. Option D is correct.

Learn more about circle here:

brainly.com/question/11833983

#SPJ2

A random survey of 75 seventh graders at Cedar Middle School showed that 37 of them do volunteer work. Use these results to predict the approximate number of students who do volunteer work out of the 500 seventh graders at the school. Round to the nearest whole number.

Answers

Answer:

247 students

Step-by-step explanation:

37/75 = .49333...

so you multiply the 500 by .49333... and get

246.666

round up and get 247

Write the ratio statement as a fraction and reduce to lowest te
20 pounds to 45 ounces

Answers

Answer:

5/9

Step-by-step explanation:

fraction: 20/45

lcd of 25 and 45 is 5

25 ÷ 5 = 5

45 ÷ 5 = 9

therefore; 5/9

Other Questions
Which form of poetry expresses feelings or ideas about a topic?Group of answer choices1. lyric poetry2. narrative poetry3. musical poetry4. tragic poetry Please help if you answer correctly I will give brainliest thank you!!!!!!!! A field is a rectangle with a perimeter of 960 feet. The length is 400 feet more than the width. Find the width and length of the rectangular field. CSI Miami: Using DNA to Solve a RobberyThe year is 2023. You are a detective for the Miami Dade Police Department. Youre on the scene of a crime where a man single-handedly just robbed a bank. Luckily, being the ingenious detective that you are, you were able to find a little spot of the mans blood where he cut his arm as he made his escape through a broken window. You take the blood to the lab so tests can be run. Unfortunately, no one was able to see the face of the man, so there are no suspects yet. Thanks to a study done in 2022, scientists have now figured which genes in DNA code for which characteristics in a person. On the next page is a strand of the sample of DNA extracted from the blood at the crime scene. Follow the steps below to help you come up with a sketch of the man who perpetrated this crime.methionine-leucine-proline = Protein that causes DARK SKINmethionine-leucine-leucine = Protein that causes LIGHT SKINvaline-proline-proline-lysine = Protein that causes GREEN EYESproline-leucine-valine-proline = Protein that causes BLUE EYESproline-lysine-proline-proline = Protein that causes BROWN EYESlysine-arginine-threonine-valine-serine-serine = BLOND HAIRlysine-arginine-threonine-valine-serine-cystine = BLACK HAIRlysine-arginine-threonine-valine-serine-valine = BROWN HAIRasparagine-isoleucine-arginine = CURLY HAIRasparagine-asparagine-isoleucine = STRAIGHT HAIRleucine-arginine-glutamic acid-arginine = BIG NOSEleucine-asparagine-arginine-glutamic acid = SMALL NOSEleucine-asparagine-asparagine-glutamic acid = MEDIUM NOSEproline-tyrosine-tyrosine-(stop) = SMALL EARSproline-proline-tyrosine-(stop) = MEDIUM EARS proline-tyrosine-phenylalanine-(stop) = BIG EARS Step 1: Decode the DNA into mRNAStep 2: Decode the mRNA into the corresponding amino acids from pg. 211 of your book. Write the amino acids in the order of the codons from the mRNA.Step 3: On a separate sheet of paper, draw a sketch of what this person might look like based on the traits you came up with. DNA: TACGATGAAGGCAATCAAGGGTTCTCCTGTCAAAGTACATTATAGGCAGACTTAGCGGTTGGAATGAAAATC | | |AUGmRNA:Protein Sequence: 1. Methionine 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17. 18. 19. 20. 21. 22. 23. 24. Step 4: Change the underlined nucleotide to a G. Refigure out your mRNA sequence and resulting amino acids. How would this mutation affect your picture? What kind of mutation did you just create?Step 5: Answer the following wrap-up questions:1) When you performed step 1, what enzyme were you imitating?2) In step 2, what molecule would have brought the amino acids that the codons asked for?3) In step 2, what molecule would have helped the amino acids line up and attach to one another?4) In step 2, what connected the amino acids together? What does In Truth's day-star mean in Edgar Allan Poe poem A Dream Which quotation from "Harrison Bergeron" by Kurt Vonnegut Jr. Best develops the theme that attempting to make people "equal every which way" is a dangerous and harmful goal? Question 3 options: "All this equality was due to the 211th, 212th, and 213th Amendments to the constitution, and the unceasing vigilance of agents of the United States. " "Then other people'd get away with it and pretty soon we'd be right back to the dark ages again, with everybody competing against everybody else. " The musicians scrambled back into their chairs, and Harrison stripped them of their handicaps, too. " "Every twenty seconds or so, the transmitter would send out some sharp noise to keep people like George from taking unfair advantages of their brains. ". PLSSS HELP IF YOU TURLY KNOW THISS You sell triangular flags made from felt. How much felt do you need to make 60 flags? Bill's chocolate bar is 69% cocoa. If the weight of the chocolate bar is 83 grams, how many grams of cocoa does it contain? Round your answer to the nearest tenth. Le dimanche 27 aot, Katy Perry (1)(donner) un concert au stade de France. a/C' (2)(tre) son premier concert parisien-Il y en a trois autres au programme, et il n'y (3)(avoir plus une seule place de libre l'intrieur, le public (4)(attendre) la star avec impatience quand tout coup, Katy Perry (5)(faire) son apparition. Elle(6)(sortir) d'une boule disco et elle (7)(commencer) sonspectacle. Les fans (8)(adorer)!Verbs in pass compose or imparfait. President Woodrow Wilson a. promoted racial equality. b. promised to respect Latin Americas independence. c. stopped U.S. investment in Latin America and the Caribbean. d. aligned with Dollar Diplomacy. e. designed a program to instill American values in Latin American schools. List three reasons why a study may be considered invalid. A neutral atom of Fluorine has seven valence electrons. How many valence electrons are present in the ion F-1? Conflict avoidance in relationship can someone explain the answer plz Which of the following is formed when minerals and extreme heat and pressure are combined? PLS I WILL GIVE YOU 23 POINTS IF YOU ANSWER ME CORRECTLYThe diagram shows 3/4 of a fraction strip shaded. Mary erases some of the shadings to show 5/8. Explain the steps she took to shade 5/8 of the fraction strip. Sean is filling his truck with gasoline. He knows the total cost, C, will be proportional to thenumber of gallons of gasoline, g, that he puts into the gas tank. After putting 8.5 gallons in.the tank, the cost is $23.63.(a) Find the ratio of the cost to the gallons as(b) What is the real world meaning of youra unit rate. Show the division as a fraction answer in (a)?and then state the answer with appropriateunits.(c) If c is the cost and g is the number ofgallons bought, write a proportioninvolving c and g and then solve it for c.(d) If Sean puts 17 gallons of gasoline intohis truck, what is his cost? Justify. 57 women make up an all female choir in a church.Two women are chosen to sing together for a duet.How many possible pairs could be chosen for the duet? Why is physical activity so important in preventing heart disease?